Characterization and Establishment of an Immortalized Rabbit Melanocyte Cell Line Using the SV40 Large T Antigen
Abstract
:1. Introduction
2. Results
2.1. Immortalization of RMCs Using SV40-LT Lentiviral Expression
2.2. Morphology and Proliferation of the Immortalized RMCs
2.3. Tissue-Specific Gene Expression in the Primary and Immortalized Melanocytes
2.4. Malignant Transformation of Immortalized RMCs
3. Discussion
4. Materials and Methods
4.1. Ethics Statement
4.2. Isolation, Cultivation, and Passage of Primary RMCs
4.3. Immortalization of Primary RMCs Using Lentiviral Vectors
4.4. Monoclonal Selection
4.5. Dopa Staining
4.6. Immunofluorescence
4.7. Quantitative Real-Time PCR (qRT-PCR) and Semi-Quantitative PCR (Sq-PCR)
4.8. Western Blot Analysis
4.9. Growth Curves
4.10. Cell Cycle Analysis
4.11. Karyotype Analysis
4.12. Soft Agar Assays
4.13. Tumorigenesis Assays
4.14. Statistical Analysis
Author Contributions
Funding
Conflicts of Interest
Abbreviations
Pri RMC | primary rabbit melanocyte |
Im RMC | immortalized rabbit melanocyte |
Im RMC P56 | immortalized rabbit melanocyte at passage 56 |
SV40-LT | simian virus 40 Large T |
HPV | human papilloma virus |
qRT-PCR | quantitative real time PCR |
NC | negative control |
Sq-PCR | semi-quantitative PCR |
MOI | multiplicity of infection |
DMEM | dulbecco’s Modified Eagle Medium |
FBS | fetal bovine serum |
HMGS-2 | human melanocyte growth supplement-2 |
BSA | bovine serum albumin |
RIPA | radio-immunoprecipitation assay |
PMSF | phenylmethanesulfonyl fluoride |
PBS | phosphate buffer saline |
FITC | fluorescein isothiocyanate |
KCL | potassium chloride |
TYR | tyrosinase |
TYRP1 | tyrosinase related protein 1 |
MITF | microphthalmia-associated transcription factor |
GAPDH | glyceraldehyde-3-phosphate dehydrogenase |
References
- Slominski, A.; Tobin, D.J.; Shibahara, S.; Wortsman, J. Melanin pigmentation in mammalian skin and its hormonal regulation. Physiol. Rev. 2004, 84, 1155–1228. [Google Scholar] [CrossRef] [PubMed]
- Yamaguchi, Y.; Brenner, M.; Hearing, V.J. The regulation of skin pigmentation. J. Biol. Chem. 2007, 282, 27557–27561. [Google Scholar] [CrossRef] [PubMed]
- Thomas, A.J.; Erickson, C.A. The making of a melanocyte: the specification of melanoblasts from the neural crest. Pigm. Cell Melanoma. R. 2008, 21, 598–610. [Google Scholar] [CrossRef] [PubMed]
- Park, H.Y.; Kosmadaki, M.; Yaar, M.; Gilchrest, B.A. Cellular mechanisms regulating human melanogenesis. Cell Mol. Life Sci. 2009, 66, 1493–1506. [Google Scholar] [CrossRef] [PubMed]
- Ozeki, H.; Ito, S.; Wakamatsu, K.; Hirobe, T. Chemical characterization of hair melanins in various coat-color mutants of mice. J. Invest. Dermatol. 1995, 105, 361–366. [Google Scholar] [CrossRef] [PubMed]
- Lamoreux, M.L.; Wakamatsu, K.; Ito, S. Interaction of major coat color gene functions in mice as studied by chemical analysis of eumelanin and pheomelanin. Pigm. Cell Res. 2001, 14, 23–31. [Google Scholar] [CrossRef]
- Umehara, K.; Sun, Y.C.; Hiura, S.; Hamada, K.; Itoh, M.; Kitamura, K.; Oshima, M.; Iwama, A.; Saito, K.; Anzai, N.; et al. A New Conditionally Immortalized Human Fetal Brain Pericyte Cell Line: Establishment and Functional Characterization as a Promising Tool for Human Brain Pericyte Studies. Mol. Neurobiol. 2018, 55, 5993–6006. [Google Scholar] [CrossRef]
- Bikkul, M.U.; Faragher, R.G.A.; Worthington, G.; Meinke, P.; Kerr, A.R.W.; Sammy, A.; Riyahi, K.; Horton, D.; Schirmer, E.C.; Hubank, M.; et al. Telomere elongation through hTERT immortalization leads to chromosome repositioning in control cells and genomic instability in Hutchinson-Gilford progeria syndrome fibroblasts, expressing a novel SUN1 isoform. Gene Chromosome Canc. 2019, 58, 341–356. [Google Scholar] [CrossRef] [PubMed]
- Kumar, A. Structural and Biochemical Investigations of the Roles of Simian Virus 40 Large Tumor Antigen in the Initiation of Replication and Cellular Transformation. Ph.D. Thesis, Tufts University, Boston, MA, USA, 2007. [Google Scholar]
- Srinivasan, A.; Mcclellan, A.J.; Vartikar, J.; Marks, I.; Cantalupo, P.; Li, Y.; Whyte, P.; Rundell, K.; Brodsky, J.L.; Pipas, J.M. The amino-terminal transforming region of simian virus 40 large T and small t antigens functions as a J domain. Mol. Cell. Biol. 1997, 17, 4761–4773. [Google Scholar] [CrossRef] [Green Version]
- Porrás, A.; Bennett, J.; Howe, A.; Tokos, K.; Bouck, N.; Henglein, B.; Sathyamangalam, S.; Thimmapaya, B.; Rundell, K. A novel simian virus 40 early-region domain mediates transactivation of the cyclin A promoter by small-t antigen and is required for transformation in small-t antigen-dependent assays. J. Virol. 1996, 70, 6902–6908. [Google Scholar] [Green Version]
- Sullivan, C.S.; Cantalupo, P.; Pipas, J.M. The molecular chaperone activity of simian virus 40 large T antigen is required to disrupt Rb-E2F family complexes by an ATP-dependent mechanism. Mol. Cell. Biol. 2000, 20, 6233–6243. [Google Scholar] [CrossRef] [PubMed]
- Kierstead, T.D.; Tevethia, M.J. Association of p53 binding and immortalization of primary C57BL/6 mouse embryo fibroblasts by using simian virus 40 T-antigen mutants bearing internal overlapping deletion mutations. J. Virol. 1993, 67, 1817–1829. [Google Scholar] [PubMed]
- Nobre, A.; Kalve, I.; Cesnulevicius, K.; Rangancokova, D.; Ratzka, A.; Halfer, N.; Wesemann, M.; Krampfl, K.; Claus, P.; Grothe, C. Characterization and differentiation potential of rat ventral mesencephalic neuronal progenitor cells immortalized with SV40 large T antigen. Cell Tissue Res. 2010, 340, 29–43. [Google Scholar] [CrossRef] [PubMed]
- Tsao, S.W.; Wang, X.H.; Liu, Y.; Cheung, Y.C.; Feng, H.C.; Zheng, Z.; Wong, N.; Yuen, P.W.; Lo, A.K.F.; Wong, Y.C.; et al. Establishment of two immortalized nasopharyngeal epithelial cell lines using SV40 large T and HPV16E6/E7 viral oncogenes. Biochim. Biophys. Acta Mol. Cell Res. 2002, 1590, 150–158. [Google Scholar] [CrossRef] [Green Version]
- Kwack, M.H.; Yang, J.M.; Won, G.H.; Kim, M.K.; Kim, J.C.; Sung, Y.K. Establishment and characterization of five immortalized human scalp dermal papilla cell lines. Biochem. Biophys. Res. Commun. 2018, 496, 346–351. [Google Scholar] [CrossRef] [PubMed]
- Takenouchi, T.; Kitani, H.; Suzuki, S.; Nakai, M.; Fuchimoto, D.; Tsukimoto, M.; Shinkai, H.; Sato, M.; Uenishi, H. Immortalization and Characterization of Porcine Macrophages That Had Been Transduced with Lentiviral Vectors Encoding the SV40 Large T Antigen and Porcine Telomerase Reverse Transcriptase. Front. Vet. Sci. 2017, 4, 132. [Google Scholar] [CrossRef] [PubMed]
- Chen, Y.; Hu, S.S.; Mu, L.; Zhao, B.H.; Wang, M.M.; Yang, N.S.; Bao, G.L.; Zhu, C.G.; Wu, X.S. Slc7a11 Modulated by POU2F1 is Involved in Pigmentation in Rabbit. Int. J. Mol. Sci. 2019, 20, 2493. [Google Scholar] [CrossRef] [PubMed]
- Hellström, A.R.; Brenda, W.; Shahrzad Shirazi, F.; Danièle, T.; Paula, M.M.; Kristina, N.M.; Barn, E.; Shosuke, I.; Kazumasa, W.; Jimmy, L. Inactivation of Pmel alters melanosome shape but has only a subtle effect on visible pigmentation. PLoS Genet. 2011, 7, e1002285. [Google Scholar] [CrossRef]
- Zufferey, R.; Dull, T.; Mandel, R.J.; Bukovsky, A.; Quiroz, D.; Naldini, L.; Trono, D. Self-inactivating lentivirus vector for safe and efficient in vivo gene delivery. J. Virol. 1998, 72, 9873–9880. [Google Scholar] [PubMed]
- Simons, J.W.I.M. A Theory on Cellular Aging and Cell Immortalization. Prog. Mol. Subcell. Biol. 2000, 24, 1–21. [Google Scholar] [PubMed]
- Gifford, R.J.; Katzourakis, A.; Tristem, M.; Pybus, O.G.; Winters, M.; Shafer, R.W. A transitional endogenous lentivirus from the genome of a basal primate and implications for lentivirus evolution. Proc. Natl. Acad. Sci. USA 2008, 105, 20362–20367. [Google Scholar] [CrossRef] [Green Version]
- Han, G.Z.; Worobey, M. Endogenous Lentiviral Elements in the Weasel Family (Mustelidae). Mol. Biol. Evol. 2012, 29, 2905–2908. [Google Scholar] [CrossRef] [PubMed]
- Cui, J.; Holmes, E.C. Endogenous Lentiviruses in the Ferret Genome. J. Virol. 2012, 86, 3383–3385. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Zhuang, J.Q.; Mei, J.G.; Wang, W.X.; Shen, Z.Q. Progress in Research and Application of Cell Immortalization Technology. Life Sci. Res. 2011, 15, 363–368. [Google Scholar]
- David, S.G.P.D. The Molecular Perspective: Simian Virus 40. Stem Cells 2010, 18, 301–303. [Google Scholar]
- Counter, C.M.; Hirte, H.W.; Bacchetti, S.; Harley, C.B. Telomerase activity in human ovarian carcinoma. Proc. Natl. Acad. Sci. USA 1994, 91, 2900–2904. [Google Scholar] [CrossRef] [PubMed]
- Wright, W.E.; Pereira-Smith, O.M.; Shay, J.W. Reversible cellular senescence: implications for immortalization of normal human diploid fibroblasts. Mol. Cell. Biol. 1989, 9, 3088. [Google Scholar] [CrossRef] [PubMed]
- Kang, H.Y.; Choi, Y.K.; Jeong, Y.I.; Choi, K.C.; Hyun, S.H.; Hwang, W.S.; Jeung, E.B. Immortalization of Porcine 11 beta-Hydroxysteroid Dehydrogenase Type 1-Transgenic Liver Cells Using SV40 Large T Antigen. Int. J. Mol. Sci. 2017, 18, 2625. [Google Scholar] [CrossRef] [PubMed]
- Liu, C.; Wang, X.F.; Zhang, H.; Xie, X.H.; Liu, P.H.; Liu, Y.; Jani, P.H.; Lu, Y.B.; Chen, S.; Qin, C.L. Immortalized Mouse Floxed Fam20c Dental Papillar Mesenchymal and Osteoblast Cell Lines Retain Their Primary Characteristics. J. Cell. Physiol. 2015, 230, 2581–2587. [Google Scholar] [CrossRef] [PubMed]
- Jha, K.K.; Banga, S.; Palejwala, V.; Ozer, H.L. SV40-Mediated Immortalization. Exp. Cell Res. 1998, 245, 1–7. [Google Scholar] [CrossRef] [PubMed]
- Ray, F.A.; Peabody, D.S.; Cooper, J.L.; Cram, L.S.; Kraemer, P.M. SV40 T antigen alone drives karyotype instability that precedes neoplastic transformation of human diploid fibroblasts. J. Cell Biochem. 1990, 42, 13–31. [Google Scholar] [CrossRef] [PubMed]
- Vantyghem, S.A.; Postenka, C.O.; Chambers, A.F. Estrous cycle influences organ-specific metastasis of B16F10 melanoma cells. Cancer Res. 2003, 63, 4763–4765. [Google Scholar] [PubMed]
- Voltarelli, F.A.; Frajacomo, F.T.; Padilha, C.S.; Mtj, T.; Cella, P.S.; Ribeiro, D.F.; de Oliveira, D.X.; Veronez, L.C.; Bisson, G.S.; Moura, F.A. Syngeneic B16F10 Melanoma Causes Cachexia and Impaired Skeletal Muscle Strength and Locomotor Activity in Mice. Front. Physiol. 2017, 8, 715. [Google Scholar] [CrossRef] [PubMed]
1 | GGAATTC ATGGATAAAGTTTTAAACAG GGAATTC ATGGATAAAGTTTTAAACAG CGGGATCC TTATGTTTCAGGTTCAGGG |
Name | Sequence(5′ to 3′) | Product Length/bp | Experiment |
---|---|---|---|
SV40-LT | GGAATTC ATGGATAAAGTTTTAAACAG | 2148 | Cloning |
CGGAATTC TTATGTTTCAGGTTCAGGG | |||
hu GAPDH | TGCACCACCAACTGCTTAGC | 87 | qRT-PCR |
GGCATGGACTGTGGTCATGAG | |||
SV40-LT | AAGTTTAATGTGGCTATGGG | 92 | qRT-PCR |
ACTGTGAATCAATGCCTGTT | |||
ra MITF | CCTCCAAGCCTCCGATAAGCTC | 151 | PCR |
TCACGGGCACTCTCTGTTGCAT | |||
ra TYR | GCACAACCGGGAATCCTACA | 169 | PCR |
CCAGATCCGACTGGCTTGTT | |||
ra TYRP1 | AGCAATCCTGGGCTCAGTTC | 190 | PCR |
CCATCATGGGGGTAATGGGG | |||
ra GAPDH | CACCAGGGCTGCTTTTAACTCT | 146 | PCR |
CTTCCCGTTCTCAGCCTTGACC |
© 2019 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (http://creativecommons.org/licenses/by/4.0/).
Share and Cite
Chen, Y.; Hu, S.; Wang, M.; Zhao, B.; Yang, N.; Li, J.; Chen, Q.; Liu, M.; Zhou, J.; Bao, G.; et al. Characterization and Establishment of an Immortalized Rabbit Melanocyte Cell Line Using the SV40 Large T Antigen. Int. J. Mol. Sci. 2019, 20, 4874. https://doi.org/10.3390/ijms20194874
Chen Y, Hu S, Wang M, Zhao B, Yang N, Li J, Chen Q, Liu M, Zhou J, Bao G, et al. Characterization and Establishment of an Immortalized Rabbit Melanocyte Cell Line Using the SV40 Large T Antigen. International Journal of Molecular Sciences. 2019; 20(19):4874. https://doi.org/10.3390/ijms20194874
Chicago/Turabian StyleChen, Yang, Shuaishuai Hu, Manman Wang, Bohao Zhao, Naisu Yang, Jiali Li, Qiuran Chen, Ming Liu, Juan Zhou, Guolian Bao, and et al. 2019. "Characterization and Establishment of an Immortalized Rabbit Melanocyte Cell Line Using the SV40 Large T Antigen" International Journal of Molecular Sciences 20, no. 19: 4874. https://doi.org/10.3390/ijms20194874