Identification and Characterization of a Luteinizing Hormone Receptor (LHR) Homolog from the Chinese Mitten Crab Eriocheir sinensis
Abstract
:1. Introduction
2. Results
2.1. Molecular Characterization and Phylogenetic Analysis of EsLHR Homolog
2.2. Tissue Distribution of EsLHR mRNA
2.3. ISH localization of EsLHR mRNA in the Ovaries at Various Stages
2.4. qPCR Quantitation of EsLHR mRNA in the Ovaries at Various Stages
2.5. Induced Expression of EsLHR mRNA by the Crab GnRH Homolog
3. Materials and Methods
3.1. Ethics Statement
3.2. Animals and Tissue Sampling
3.3. GnRH Homolog Injection Experiments
3.4. Cloning of the Full-Length EsLHR Complementary DNA (cDNA)
3.5. Tissue Distribution of EsLHR Gene
3.6. Probe Preparation and in situ Hybridization
3.7. Real-Time qPCR Analysis
3.8. Bioinformatics Analysis
4. Discussion
Author Contributions
Funding
Acknowledgments
Conflicts of Interest
References
- Kalra, S.P. Neural Regulation of Luteinizing Hormone Secretion in the Rat*. Endocr. Rev. 1983, 4, 311–351. [Google Scholar] [CrossRef]
- Sower, S.A.; Freamat, M.; Kavanaugh, S.I. The origins of the vertebrate hypothalamic–pituitary–gonadal (HPG) and hypothalamic–pituitary–thyroid (HPT) endocrine systems: New insights from lampreys. Gen. Comp. Endocrinol. 2009, 161, 20–29. [Google Scholar] [CrossRef]
- Schulz, R.; Vischer, H.; Cavaco, J.E.; Santos, E.; Tyler, C.; Goos, H.; Bogerd, J. Gonadotropins, their receptors, and the regulation of testicular functions in fish. Comp. Biochem. Physiol. B Biochem. Mol. Boil. 2001, 129, 407–417. [Google Scholar] [CrossRef]
- Levavi-Sivan, B.; Bogerd, J.; Mañanós, E.; Gómez, A.; Lareyre, J.; Mañanós, E. Perspectives on fish gonadotropins and their receptors. Gen. Comp. Endocrinol. 2010, 165, 412–437. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Du, Y.-X.; Ma, K.-Y.; Qiu, G.-F. Discovery of the genes in putative GnRH signaling pathway with focus on characterization of GnRH-like receptor transcripts in the brain and ovary of the oriental river prawn Macrobrachium nipponense. Aquaculture 2015, 442, 1–11. [Google Scholar] [CrossRef]
- Zhang, Y.; Devries, M.E.; Skolnick, J.; Murray, D. Structure Modeling of All Identified G Protein–Coupled Receptors in the Human Genome. PLOS Comput. Boil. 2006, 2, e13. [Google Scholar]
- Rispoli, L.; Nett, T. Pituitary gonadotropin-releasing hormone (GnRH) receptor: Structure, distribution and regulation of expression. Anim. Reprod. Sci. 2005, 88, 57–74. [Google Scholar] [CrossRef]
- Hauze, D.B.; Chengalvala, M.V.; Cottom, J.E.; Feingold, I.B.; Garrick, L.; Green, D.M.; Huselton, C.; Kao, W.; Kees, K.; Lundquist, J.T.; et al. Small molecule antagonists of the gonadotropin-releasing hormone (GnRH) receptor: Structure–activity relationships of small heterocyclic groups appended to the 2-phenyl-4-piperazinyl-benzimidazole template. Bioorganic Med. Chem. Lett. 2009, 19, 1986–1990. [Google Scholar] [CrossRef]
- Kumar, R.; Trant, J.M. Piscine glycoprotein hormone (gonadotropin and thyrotropin) receptors: A review of recent developments. Comp. Biochem. Physiol. B Biochem. Mol. Boil. 2001, 129, 347–355. [Google Scholar] [CrossRef]
- Oba, Y.; Hirai, T.; Yoshiura, Y.; Kobayashi, T.; Nagahama, Y. Fish gonadotropin and thyrotropin receptors: The evolution of glycoprotein hormone receptors in vertebrates. Comp. Biochem. Physiol. B Biochem. Mol. Boil. 2001, 129, 441–448. [Google Scholar] [CrossRef]
- Kwok, H.-F.; So, W.-K.; Wang, Y.; Ge, W. Zebrafish Gonadotropins and Their Receptors: I. Cloning and Characterization of Zebrafish Follicle-Stimulating Hormone and Luteinizing Hormone Receptors—Evidence for Their Distinct Functions in Follicle Development1. Boil. Reprod. 2005, 72, 1370–1381. [Google Scholar] [CrossRef]
- Rocha, A.; Gómez, A.; Zanuy, S.; Cerdá-Reverter, J.M.; Carrillo, M. Molecular characterization of two sea bass gonadotropin receptors: cDNA cloning, expression analysis, and functional activity. Mol. Cell. Endocrinol. 2007, 272, 63–76. [Google Scholar] [CrossRef] [Green Version]
- An, K.W.; Lee, K.-Y.; Yun, S.G.; Choi, C.Y. Molecular characterization of gonadotropin subunits and gonadotropin receptors in black porgy, Acanthopagrus schlegeli: Effects of estradiol-17β on mRNA expression profiles. Comp. Biochem. Physiol. B Biochem. Mol. Boil. 2009, 152, 177–188. [Google Scholar] [CrossRef]
- Kobayashi, T.; Pakarinen, P.; Torgersen, J.; Huhtaniemi, I.; Andersen, Ø. The gonadotropin receptors FSH-R and LH-R of Atlantic halibut (Hippoglossus hippoglossus)—2. Differential follicle expression and asynchronous oogenesis. Gen. Comp. Endocrinol. 2008, 156, 595–602. [Google Scholar] [CrossRef]
- Oba, Y.; Hirai, T.; Yoshiura, Y.; Yoshikuni, M.; Kawauchi, H.; Nagahama, Y. Cloning, Functional Characterization, and Expression of a Gonadotropin Receptor cDNA in the Ovary and Testis of Amago Salmon (Oncorhynchus rhodurus). Biochem. Biophys. Res. Commun. 1999, 263, 584–590. [Google Scholar] [CrossRef]
- Maugars, G.; Schmitz, M. Molecular cloning and characterization of FSH and LH receptors in Atlantic salmon (Salmo salar L.). Gen. Comp. Endocrinol. 2006, 149, 108–117. [Google Scholar] [CrossRef]
- Mittelholzer, C.; Andersson, E.; Taranger, G.; Consten, D.; Hirai, T.; Senthilkumaran, B.; Nagahama, Y.; Norberg, B. Molecular characterization and quantification of the gonadotropin receptors FSH-R and LH-R from Atlantic cod (Gadus morhua). Gen. Comp. Endocrinol. 2009, 160, 47–58. [Google Scholar] [CrossRef]
- Jeng, S.-R.; Yueh, W.-S.; Chen, G.-R.; Lee, Y.-H.; Dufour, S.; Chang, C.-F. Differential expression and regulation of gonadotropins and their receptors in the Japanese eel, Anguilla japonica. Gen. Comp. Endocrinol. 2007, 154, 161–173. [Google Scholar] [CrossRef]
- Vischer, H.; Bogerd, J. Cloning and Functional Characterization of a Gonadal Luteinizing Hormone Receptor Complementary DNA from the African Catfish (Clarias gariepinus). Boil. Reprod. 2003, 68, 262–271. [Google Scholar] [CrossRef]
- Kumar, R.S.; Ijiri, S.; Trant, J.M. Molecular Biology of Channel Catfish Gonadotropin Receptors: 1. Cloning of a Functional Luteinizing Hormone Receptor and Preovulatory Induction of Gene Expression1. Boil. Reprod. 2001, 64, 1010–1018. [Google Scholar] [CrossRef] [Green Version]
- Liu, X.; Ma, K.; Liu, Z.; Feng, J.; Ye, B.; Qiu, G. Transcriptome analysis of the brain of the Chinese mitten crab, Eriocheir sinensis, for neuropeptide abundance profiles during ovarian development. Anim. Reprod. Sci. 2019, 201, 63–70. [Google Scholar] [CrossRef]
- Ma, K.-Y.; Zhang, S.-F.; Wang, S.-S.; Qiu, G.-F. Molecular cloning and characterization of a gonadotropin-releasing hormone receptor homolog in the Chinese mitten crab, Eriocheir sinensis. Gene 2018, 665, 111–118. [Google Scholar] [CrossRef]
- Fang, J.-J.; Qiu, G.-F. Molecular cloning of cyclin B transcript with an unusually long 3′ untranslation region and its expression analysis during oogenesis in the Chinese mitten crab, Eriocheir sinensis. Mol. Biol. Rep. 2009, 36, 1521–1529. [Google Scholar] [CrossRef]
- Ma, K.-Y.; Chen, J.; Liu, Z.-Q.; Qiu, G.-F. Inhibitory effects of RNAi-mediated knockdown of EsDmrt-like gene on testicular development in the Chinese mitten crab Eriocheir sinensis. Aquaculture 2016, 463, 217–223. [Google Scholar] [CrossRef]
- Livak, K.J.; Schmittgen, T.D. Analysis of Relative Gene Expression Data Using Real-Time Quantitative PCR and the 2−ΔΔCT Method. Methods 2001, 25, 402–408. [Google Scholar] [CrossRef]
- Bogerd, J.; Granneman, J.C.; Schulz, R.W.; Vischer, H.F. Fish FSH receptors bind LH: How to make the human FSH receptor to be more fishy? Gen. Comp. Endocrinol. 2005, 142, 34–43. [Google Scholar] [CrossRef]
- Kobayashi, Y.; Nakamura, M.; Sunobe, T.; Usami, T.; Kobayashi, T.; Manabe, H.; Paul-Prasanth, B.; Suzuki, N.; Nagahama, Y. Sex Change in the Gobiid Fish Is Mediated through Rapid Switching of Gonadotropin Receptors from Ovarian to Testicular Portion or Vice Versa. Endocrinology 2009, 150, 1503–1511. [Google Scholar] [CrossRef] [Green Version]
- Ohkubo, M.; Yabu, T.; Yamashita, M.; Shimizu, A. Molecular cloning of two gonadotropin receptors in mummichog Fundulus heteroclitus and their gene expression during follicular development and maturation. Gen. Comp. Endocrinol. 2013, 184, 75–86. [Google Scholar] [CrossRef]
- Nyuji, M.; Kazeto, Y.; Izumida, D.; Tani, K.; Suzuki, H.; Hamada, K.; Mekuchi, M.; Gen, K.; Soyano, K.; Okuzawa, K. Greater amberjack Fsh, Lh, and their receptors: Plasma and mRNA profiles during ovarian development. Gen. Comp. Endocrinol. 2016, 225, 224–234. [Google Scholar] [CrossRef]
- Chen, J.; Liu, P.; Li, Z.; Chen, Y.; Qiu, G.-F. The cloning of the cdk2 transcript and the localization of its expression during gametogenesis in the freshwater giant prawn, Macrobrachium rosenbergii. Mol. Boil. Rep. 2013, 40, 4781–4790. [Google Scholar] [CrossRef]
- Nagahama, Y.; Yoshikuni, M.; Yamashita, M.; Tokumoto, T.; Katsu, Y. 4 Regulation of Oocyte Growth and Maturation in Fish. In Current Topics in Developmental Biology; Pedersen, R.A., Schatten, G.P., Eds.; Academic Press: Cambridge, MA, USA, 1995; pp. 103–145. [Google Scholar]
- Swanson, P. Pituitary gonadotropins and their receptors in fish. In Proceedings of the XIII International Congress of Comparative Endocrinology, Yokohama, Japan, 16–21 November 1997; pp. 841–846. [Google Scholar]
- Bao, B.; Garverick, H.A.; Smith, G.W.; Smith, M.F.; Salfen, B.E.; Youngquist, R.S. Changes in Messenger Ribonucleic Acid Encoding Luteinizing Hormone Receptor, Cytochrome P450-Side Chain Cleavage, and Aromatase are Associated with Recruitment and Selection of Bovine Ovarian Follicles1. Boil. Reprod. 1997, 56, 1158–1168. [Google Scholar] [CrossRef]
- Qiu, G.-F.; Chen, Y.; Cui, Z.; Zhu, X.-L. Localization of germline marker vasa homolog RNA to a single blastomere at early cleavage stages in the oriental river prawn Macrobrachium nipponense: Evidence for germ cell specification by preformation. Gene 2013, 513, 53–62. [Google Scholar] [CrossRef]
- Chen, X.Y.; Wen, H.S.; Feng, H.E.; Chen, C.F.; Zhang, J.R.; Jin, G.X.; Shi, B. Partial Sequence Cloning of LHR Gene in Cynoglossus semilaevis and Its Tissue Expression Analysis. Period. Ocean Univ. China 2010, 40, 71–77. [Google Scholar]
- Herbison, A.E. Multimodal Influence of Estrogen upon Gonadotropin-Releasing Hormone Neurons. Endocr. Rev. 1998, 19, 302–330. [Google Scholar] [CrossRef]
- Saetan, J.; Senarai, T.; Tamtin, M.; Weerachatyanukul, W.; Chavadej, J.; Hanna, P.J.; Parhar, I.; Sobhon, P.; Sretarugsa, P. Histological organization of the central nervous system and distribution of a gonadotropin-releasing hormone-like peptide in the blue crab, Portunus pelagicus. Cell Res. 2013, 353, 493–510. [Google Scholar] [CrossRef]
- Senarai, T.; Saetan, J.; Tamtin, M.; Weerachatyanukul, W.; Sobhon, P.; Sretarugsa, P. Presence of gonadotropin-releasing hormone-like peptide in the central nervous system and reproductive organs of the male blue swimming crab, Portunus pelagicus, and its effect on spermatogenesis. Cell Res. 2016, 365, 265–277. [Google Scholar] [CrossRef]
- Ngernsoungnern, P.; Ngernsoungnern, A.; Sobhon, P.; Sretarugsa, P. Gonadotropin-releasing hormone (GnRH) and a GnRH analog induce ovarian maturation in the giant freshwater prawn, Macrobrachium rosenbergii. Invertebr. Reprod. Dev. 2009, 53, 125–135. [Google Scholar] [CrossRef]
- Ye, H.-H.; Huang, H.Y.; Li, S.-J.; Wang, G.Z. Immunorecognition of FSH and LH in Optic Ganglion of Scylla serrata. J. Xiamen Univ. 2006, 45, 297–298. [Google Scholar]
- Huang, H.; Ye, H.; Li, S.; Wang, G. Immunocytological evidence for the presence of vertebrate FSH- and LH-like substances in the brain and thoracic ganglion of the swimming crab, Portunus trituberculatus. Prog. Nat. Sci. Mater. Int. 2008, 18, 1453–1457. [Google Scholar] [CrossRef]
- Żukowska-Arendarczyk, M. Effect of hypophyseal gonadotropins (FSH and LH) on the ovaries of the sand shrimp Crangon crangon (Crustacea: Decapoda). Mar. Boil. 1981, 63, 241–247. [Google Scholar] [CrossRef]
- Wang, C.-Z.; Qiu, G.-F. Partial isolation and immunological characterization of a GnRH-like peptide from Chinese mitten crab (Eriocheir sinensis). J. Fish. 2012, 36, 908. [Google Scholar] [CrossRef]
- Song, Y.-N.; Shi, L.-L.; Liu, Z.-Q.; Qiu, G.-F. Global analysis of the ovarian microRNA transcriptome: Implication for miR-2 and miR-133 regulation of oocyte meiosis in the Chinese mitten crab, Eriocheir sinensis (Crustacea:Decapoda). BMC Genom. 2014, 15, 547. [Google Scholar] [CrossRef]
Primers | sequence (5′ → 3′) | Usage |
---|---|---|
LHR-F1 | ATGTCCTCTGGAAGTGCAAAGAT | RT-PCR |
LHR-R1 | TTACTGCTTGGAGAAGAAGTCTTTG | |
LHR-F2 | GGTGGCAGGTCTTCCGCTTAT | 3′-RACE |
LHR-R2 | GCCCGTCTCAGGTTTGGTT | 5′-RACE |
LHR-F3 | GGTGGCAGGTCTTCCGCTTAT | cloning for ISH probes |
LHR-R3 | GCCCGTCTCAGGTTTGGTT | |
LHR-F4 | TGGCAGGTCTTCCGCTTATT | qPCR |
LHR-R4 | GCCCTTGTACTTCATCGCTC | |
β-actin F | CCTCACCCTCAAATACCCCAT | RT-PCR and qPCR |
β-actin R | GGGGTGTTGAAGGTCTCGGA |
© 2019 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (http://creativecommons.org/licenses/by/4.0/).
Share and Cite
Yuan, L.-J.; Peng, C.; Liu, B.-H.; Feng, J.-B.; Qiu, G.-F. Identification and Characterization of a Luteinizing Hormone Receptor (LHR) Homolog from the Chinese Mitten Crab Eriocheir sinensis. Int. J. Mol. Sci. 2019, 20, 1736. https://doi.org/10.3390/ijms20071736
Yuan L-J, Peng C, Liu B-H, Feng J-B, Qiu G-F. Identification and Characterization of a Luteinizing Hormone Receptor (LHR) Homolog from the Chinese Mitten Crab Eriocheir sinensis. International Journal of Molecular Sciences. 2019; 20(7):1736. https://doi.org/10.3390/ijms20071736
Chicago/Turabian StyleYuan, Li-Juan, Chao Peng, Bi-Hai Liu, Jiang-Bin Feng, and Gao-Feng Qiu. 2019. "Identification and Characterization of a Luteinizing Hormone Receptor (LHR) Homolog from the Chinese Mitten Crab Eriocheir sinensis" International Journal of Molecular Sciences 20, no. 7: 1736. https://doi.org/10.3390/ijms20071736