The Apolipoprotein A-I Mimetic L-4F Attenuates Monocyte Activation and Adverse Cardiac Remodeling after Myocardial Infarction
Abstract
:1. Introduction
2. Results
2.1. L-4F Attenuates Adverse Post-MI Left Ventricular (LV) Remodeling and Systolic Dysfunction
2.2. L-4F Alleviates Systemic Ly6Chi Monocyte Activation after Reperfused MI
2.3. L-4F Restrains Pro-Inflammatory Ly6Chi Macrophages in Healing Infarcted Hearts
2.4. L-4F Inhibits M1-Macrophage Activation and Induces Macrophage Plasticity In Vitro
3. Discussion
4. Materials and Methods
4.1. L-4F Peptide Synthesis and Purification
4.2. Mouse MI Model and Experimental Protocol
4.3. Echocardiography
4.4. Isolation of Mononuclear Cells and Flow Cytometry
4.5. Isolation, Polarization, and In Vitro L-4F Treatment of Peritoneal Macrophages
4.6. RT-PCR Analysis
4.7. Statistical Analysis
Supplementary Materials
Author Contributions
Funding
Conflicts of Interest
Abbreviations
MI | Myocardial infarction |
I/R | Ischemia reperfusion |
HF | Heart Failure |
apoA1 | Apolipoprotein A-1 |
EDV | End diastolic volume |
ESV | End systolic volume |
EF | Ejection fraction |
HSC | Hematopoietic stem cell |
TNF | Tumor necrosis factor |
CCL3 | C-C motif chemokine ligand 3 |
iNOS | Inducible nitric oxide synthase |
HIF | Hypoxia inducible factor |
GLUT1 | Glucose transporter 1 |
References
- Prabhu, S.D.; Frangogiannis, N.G. The biological basis for cardiac repair after myocardial infarction: From inflammation to fibrosis. Circ. Res. 2016, 119, 91–112. [Google Scholar] [CrossRef] [PubMed]
- Nahrendorf, M.; Swirski, F.K.; Aikawa, E.; Stangenberg, L.; Wurdinger, T.; Figueiredo, J.L.; Libby, P.; Weissleder, R.; Pittet, M.J. The healing myocardium sequentially mobilizes two monocyte subsets with divergent and complementary functions. J. Exp. Med. 2007, 204, 3037–3047. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Yan, X.; Anzai, A.; Katsumata, Y.; Matsuhashi, T.; Ito, K.; Endo, J.; Yamamoto, T.; Takeshima, A.; Shinmura, K.; Shen, W.; et al. Temporal dynamics of cardiac immune cell accumulation following acute myocardial infarction. J. Mol. Cell. Cardiol. 2013, 62, 24–35. [Google Scholar] [CrossRef] [PubMed]
- Panizzi, P.; Swirski, F.K.; Figueiredo, J.L.; Waterman, P.; Sosnovik, D.E.; Aikawa, E.; Libby, P.; Pittet, M.; Weissleder, R.; Nahrendorf, M. Impaired infarct healing in atherosclerotic mice with ly-6c(hi) monocytosis. J. Am. Coll. Cardiol. 2010, 55, 1629–1638. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Ismahil, M.A.; Hamid, T.; Bansal, S.S.; Patel, B.; Kingery, J.R.; Prabhu, S.D. Remodeling of the mononuclear phagocyte network underlies chronic inflammation and disease progression in heart failure: Critical importance of the cardiosplenic axis. Circ. Res. 2014, 114, 266–282. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Bansal, S.S.; Ismahil, M.A.; Goel, M.; Zhou, G.; Rokosh, G.; Hamid, T.; Prabhu, S.D. Dysfunctional and proinflammatory regulatory t-lymphocytes are essential for adverse cardiac remodeling in ischemic cardiomyopathy. Circulation 2019, 139, 206–221. [Google Scholar] [CrossRef]
- Imaizumi, S.; Navab, M.; Morgantini, C.; Charles-Schoeman, C.; Su, F.; Gao, F.; Kwon, M.; Ganapathy, E.; Meriwether, D.; Farias-Eisner, R.; et al. Dysfunctional high-density lipoprotein and the potential of apolipoprotein a-1 mimetic peptides to normalize the composition and function of lipoproteins. Circ. J. 2011, 75, 1533–1538. [Google Scholar] [CrossRef] [Green Version]
- White, C.R.; Garber, D.W.; Anantharamaiah, G.M. Anti-inflammatory and cholesterol-reducing properties of apolipoprotein mimetics: A review. J. Lipid Res. 2014, 55, 2007–2021. [Google Scholar] [CrossRef] [Green Version]
- Van Lenten, B.J.; Wagner, A.C.; Jung, C.L.; Ruchala, P.; Waring, A.J.; Lehrer, R.I.; Watson, A.D.; Hama, S.; Navab, M.; Anantharamaiah, G.M.; et al. Anti-inflammatory apoa-i-mimetic peptides bind oxidized lipids with much higher affinity than human apoa-i. J. Lipid Res. 2008, 49, 2302–2311. [Google Scholar] [CrossRef] [Green Version]
- Navab, M.; Anantharamaiah, G.M.; Reddy, S.T.; Van Lenten, B.J.; Datta, G.; Garber, D.; Fogelman, A.M. Human apolipoprotein a-i and a-i mimetic peptides: Potential for atherosclerosis reversal. Curr. Opin. Lipidol. 2004, 15, 645–649. [Google Scholar] [CrossRef]
- Gupta, H.; Dai, L.; Datta, G.; Garber, D.W.; Grenett, H.; Li, Y.; Mishra, V.; Palgunachari, M.N.; Handattu, S.; Gianturco, S.H.; et al. Inhibition of lipopolysaccharide-induced inflammatory responses by an apolipoprotein ai mimetic peptide. Circ. Res. 2005, 97, 236–243. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Garber, D.W.; Datta, G.; Chaddha, M.; Palgunachari, M.N.; Hama, S.Y.; Navab, M.; Fogelman, A.M.; Segrest, J.P.; Anantharamaiah, G.M. A new synthetic class a amphipathic peptide analogue protects mice from diet-induced atherosclerosis. J. Lipid Res. 2001, 42, 545–552. [Google Scholar] [PubMed]
- Smythies, L.E.; White, C.R.; Maheshwari, A.; Palgunachari, M.N.; Anantharamaiah, G.M.; Chaddha, M.; Kurundkar, A.R.; Datta, G. Apolipoprotein a-i mimetic 4f alters the function of human monocyte-derived macrophages. Am. J. Physiol. Cell Physiol. 2010, 298, C1538–C1548. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Swirski, F.K.; Nahrendorf, M.; Etzrodt, M.; Wildgruber, M.; Cortez-Retamozo, V.; Panizzi, P.; Figueiredo, J.L.; Kohler, R.H.; Chudnovskiy, A.; Waterman, P.; et al. Identification of splenic reservoir monocytes and their deployment to inflammatory sites. Science 2009, 325, 612–616. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Leuschner, F.; Rauch, P.J.; Ueno, T.; Gorbatov, R.; Marinelli, B.; Lee, W.W.; Dutta, P.; Wei, Y.; Robbins, C.; Iwamoto, Y.; et al. Rapid monocyte kinetics in acute myocardial infarction are sustained by extramedullary monocytopoiesis. J. Exp. Med. 2012, 209, 123–137. [Google Scholar] [CrossRef]
- Auffray, C.; Emre, Y.; Geissmann, F. Homeostasis of dendritic cell pool in lymphoid organs. Nat. Immunol. 2008, 9, 584–586. [Google Scholar] [CrossRef]
- Lieu, Y.K.; Reddy, E.P. Impaired adult myeloid progenitor cmp and gmp cell function in conditional c-myb-knockout mice. Cell Cycle 2012, 11, 3504–3512. [Google Scholar] [CrossRef] [Green Version]
- Hilgendorf, I.; Gerhardt, L.M.; Tan, T.C.; Winter, C.; Holderried, T.A.; Chousterman, B.G.; Iwamoto, Y.; Liao, R.; Zirlik, A.; Scherer-Crosbie, M.; et al. Ly-6chigh monocytes depend on nr4a1 to balance both inflammatory and reparative phases in the infarcted myocardium. Circ. Res. 2014, 114, 1611–1622. [Google Scholar] [CrossRef] [Green Version]
- Roiniotis, J.; Dinh, H.; Masendycz, P.; Turner, A.; Elsegood, C.L.; Scholz, G.M.; Hamilton, J.A. Hypoxia prolongs monocyte/macrophage survival and enhanced glycolysis is associated with their maturation under aerobic conditions. J. Immunol. 2009, 182, 7974–7981. [Google Scholar] [CrossRef] [Green Version]
- Takeda, N.; O’Dea, E.L.; Doedens, A.; Kim, J.W.; Weidemann, A.; Stockmann, C.; Asagiri, M.; Simon, M.C.; Hoffmann, A.; Johnson, R.S. Differential activation and antagonistic function of hif-{alpha} isoforms in macrophages are essential for no homeostasis. Genes Dev. 2010, 24, 491–501. [Google Scholar] [CrossRef] [Green Version]
- Watson, C.E.; Weissbach, N.; Kjems, L.; Ayalasomayajula, S.; Zhang, Y.; Chang, I.; Navab, M.; Hama, S.; Hough, G.; Reddy, S.T.; et al. Treatment of patients with cardiovascular disease with l-4f, an apo-a1 mimetic, did not improve select biomarkers of hdl function. J. Lipid Res. 2011, 52, 361–373. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- von Eckardstein, A.; Nofer, J.R.; Assmann, G. High density lipoproteins and arteriosclerosis. Role of cholesterol efflux and reverse cholesterol transport. Arterioscler. Thromb. Vasc. Biol. 2001, 21, 13–27. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Heywood, S.E.; Richart, A.L.; Henstridge, D.C.; Alt, K.; Kiriazis, H.; Zammit, C.; Carey, A.L.; Kammoun, H.L.; Delbridge, L.M.; Reddy, M.; et al. High-density lipoprotein delivered after myocardial infarction increases cardiac glucose uptake and function in mice. Sci. Transl. Med. 2017, 9, eaam6084. [Google Scholar] [CrossRef] [PubMed]
- McQueen, M.J.; Hawken, S.; Wang, X.; Ounpuu, S.; Sniderman, A.; Probstfield, J.; Steyn, K.; Sanderson, J.E.; Hasani, M.; Volkova, E.; et al. Lipids, lipoproteins, and apolipoproteins as risk markers of myocardial infarction in 52 countries (the interheart study): A case-control study. Lancet 2008, 372, 224–233. [Google Scholar] [CrossRef]
- Wilson, P.W.; Abbott, R.D.; Castelli, W.P. High density lipoprotein cholesterol and mortality. The framingham heart study. Arteriosclerosis 1988, 8, 737–741. [Google Scholar] [CrossRef] [Green Version]
- Gordts, S.C.; Muthuramu, I.; Nefyodova, E.; Jacobs, F.; Van Craeyveld, E.; De Geest, B. Beneficial effects of selective hdl-raising gene transfer on survival, cardiac remodelling and cardiac function after myocardial infarction in mice. Gene Ther. 2013, 20, 1053–1061. [Google Scholar] [CrossRef] [Green Version]
- Amin, R.; Muthuramu, I.; Aboumsallem, J.P.; Mishra, M.; Jacobs, F.; De Geest, B. Selective hdl-raising human apo a-i gene therapy counteracts cardiac hypertrophy, reduces myocardial fibrosis, and improves cardiac function in mice with chronic pressure overload. Int. J. Mol. Sci. 2017, 18, 2012. [Google Scholar] [CrossRef] [Green Version]
- Buga, G.M.; Navab, M.; Imaizumi, S.; Reddy, S.T.; Yekta, B.; Hough, G.; Chanslor, S.; Anantharamaiah, G.M.; Fogelman, A.M. L-4f alters hyperlipidemic (but not healthy) mouse plasma to reduce platelet aggregation. Arterioscler. Thromb. Vasc. Biol. 2010, 30, 283–289. [Google Scholar] [CrossRef] [Green Version]
- Sharifov, O.F.; Xu, X.; Gaggar, A.; Tabengwa, E.M.; White, C.R.; Palgunachari, M.N.; Anantharamaiah, G.M.; Gupta, H. L-4f inhibits lipopolysaccharide-mediated activation of primary human neutrophils. Inflammation 2014, 37, 1401–1412. [Google Scholar] [CrossRef] [Green Version]
- Datta, G.; Kramer, P.A.; Johnson, M.S.; Sawada, H.; Smythies, L.E.; Crossman, D.K.; Chacko, B.; Ballinger, S.W.; Westbrook, D.G.; Mayakonda, P.; et al. Bioenergetic programming of macrophages by the apolipoprotein a-i mimetic peptide 4f. Biochem. J. 2015, 467, 517–527. [Google Scholar] [CrossRef] [Green Version]
- Vecoli, C.; Cao, J.; Neglia, D.; Inoue, K.; Sodhi, K.; Vanella, L.; Gabrielson, K.K.; Bedja, D.; Paolocci, N.; L’Abbate, A.; et al. Apolipoprotein a-i mimetic peptide l-4f prevents myocardial and coronary dysfunction in diabetic mice. J. Cell. Biochem. 2011, 112, 2616–2626. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Dunbar, R.L.; Movva, R.; Bloedon, L.T.; Duffy, D.; Norris, R.B.; Navab, M.; Fogelman, A.M.; Rader, D.J. Oral apolipoprotein a-i mimetic d-4f lowers hdl-inflammatory index in high-risk patients: A first-in-human multiple-dose, randomized controlled trial. Clin. Transl. Sci. 2017, 10, 455–469. [Google Scholar] [CrossRef] [PubMed]
- van Amerongen, M.J.; Harmsen, M.C.; van Rooijen, N.; Petersen, A.H.; van Luyn, M.J. Macrophage depletion impairs wound healing and increases left ventricular remodeling after myocardial injury in mice. Am. J. Pathol. 2007, 170, 818–829. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Ben-Mordechai, T.; Holbova, R.; Landa-Rouben, N.; Harel-Adar, T.; Feinberg, M.S.; Abd Elrahman, I.; Blum, G.; Epstein, F.H.; Silman, Z.; Cohen, S.; et al. Macrophage subpopulations are essential for infarct repair with and without stem cell therapy. J. Am. Coll. Cardiol. 2013, 62, 1890–1901. [Google Scholar] [CrossRef] [Green Version]
- Tapp, L.D.; Shantsila, E.; Wrigley, B.J.; Pamukcu, B.; Lip, G.Y. The cd14++cd16+ monocyte subset and monocyte-platelet interactions in patients with st-elevation myocardial infarction. J. Thromb. Haemost. 2012, 10, 1231–1241. [Google Scholar] [CrossRef]
- Wrigley, B.J.; Shantsila, E.; Tapp, L.D.; Lip, G.Y. Increased formation of monocyte-platelet aggregates in ischemic heart failure. Circ. Heart Fail. 2013, 6, 127–135. [Google Scholar] [CrossRef] [Green Version]
- Datta, G.; Chaddha, M.; Hama, S.; Navab, M.; Fogelman, A.M.; Garber, D.W.; Mishra, V.K.; Epand, R.M.; Epand, R.F.; Lund-Katz, S.; et al. Effects of increasing hydrophobicity on the physical-chemical and biological properties of a class a amphipathic helical peptide. J. Lipid Res. 2001, 42, 1096–1104. [Google Scholar]
- Wang, G.W.; Guo, Y.; Vondriska, T.M.; Zhang, J.; Zhang, S.; Tsai, L.L.; Zong, N.C.; Bolli, R.; Bhatnagar, A.; Prabhu, S.D. Acrolein consumption exacerbates myocardial ischemic injury and blocks nitric oxide-induced pkcepsilon signaling and cardioprotection. J. Mol. Cell. Cardiol. 2008, 44, 1016–1022. [Google Scholar] [CrossRef]
- Evonuk, K.S.; Prabhu, S.D.; Young, M.E.; DeSilva, T.M. Myocardial ischemia/reperfusion impairs neurogenesis and hippocampal-dependent learning and memory. Brain Behav. Immun. 2017, 61, 266–273. [Google Scholar] [CrossRef] [Green Version]
- Nguyen, S.D.; Javanainen, M.; Rissanen, S.; Zhao, H.; Huusko, J.; Kivela, A.M.; Yla-Herttuala, S.; Navab, M.; Fogelman, A.M.; Vattulainen, I.; et al. Apolipoprotein a-i mimetic peptide 4f blocks sphingomyelinase-induced ldl aggregation. J. Lipid Res. 2015, 56, 1206–1221. [Google Scholar] [CrossRef] [Green Version]
- Bansal, S.S.; Ismahil, M.A.; Goel, M.; Patel, B.; Hamid, T.; Rokosh, G.; Prabhu, S.D. Activated t lymphocytes are essential drivers of pathological remodeling in ischemic heart failure. Circ. Heart Fail. 2017, 10, e003688. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Patel, B.; Bansal, S.S.; Ismahil, M.A.; Hamid, T.; Rokosh, G.; Mack, M.; Prabhu, S.D. Ccr2+ monocyte-derived infiltrating macrophages are required for adverse cardiac remodeling during pressure overload. JACC Basic Transl. Sci. 2018, 3, 230–244. [Google Scholar] [CrossRef] [PubMed]
- Weisheit, C.; Zhang, Y.; Faron, A.; Köpke, O.; Weisheit, G.; Steinsträsser, A.; Frede, S.; Meyer, R.; Boehm, O.; Hoeft, A.; et al. Ly6clow and not ly6chigh macrophages accumulate first in the heart in a model of murine pressure-overload. PLoS ONE 2014, 9, e112710. [Google Scholar] [CrossRef]
- Kingery, J.R.; Hamid, T.; Lewis, R.K.; Ismahil, M.A.; Bansal, S.S.; Rokosh, G.; Townes, T.M.; Ildstad, S.T.; Jones, S.P.; Prabhu, S.D. Leukocyte inos is required for inflammation and pathological remodeling in ischemic heart failure. Basic Res. Cardiol. 2017, 112, 19. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Pelegrin, P.; Surprenant, A. Dynamics of macrophage polarization reveal new mechanism to inhibit il-1beta release through pyrophosphates. EMBO J. 2009, 28, 2114–2127. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Hamid, T.; Gu, Y.; Ortines, R.V.; Bhattacharya, C.; Wang, G.; Xuan, Y.T.; Prabhu, S.D. Divergent tumor necrosis factor receptor-related remodeling responses in heart failure: Role of nuclear factor-kappab and inflammatory activation. Circulation 2009, 119, 1386–1397. [Google Scholar] [CrossRef]
- Hamid, T.; Guo, S.Z.; Kingery, J.R.; Xiang, X.; Dawn, B.; Prabhu, S.D. Cardiomyocyte nf-kappab p65 promotes adverse remodelling, apoptosis, and endoplasmic reticulum stress in heart failure. Cardiovasc. Res. 2011, 89, 129–138. [Google Scholar] [CrossRef]
- Wang, G.; Hamid, T.; Keith, R.J.; Zhou, G.; Partridge, C.R.; Xiang, X.; Kingery, J.R.; Lewis, R.K.; Li, Q.; Rokosh, D.G.; et al. Cardioprotective and antiapoptotic effects of heme oxygenase-1 in the failing heart. Circulation 2010, 121, 1912–1925. [Google Scholar] [CrossRef] [Green Version]
Gene Name | Gene ID | Forward Sequence | Reverse Sequence |
---|---|---|---|
GLUT-1 (SIca1) | 20525 | CGAGGGACAGCCGATGTG | TGCCGACCCTCTTCTTTCAT |
HIF-1α | 15251 | GGGAGGACGATGAACATCAAG | TGGCCCGTGCAGTGAAG |
HIF-2α (Epas1) | 13819 | ATGCCCTGGATTCGGAGAA | TGCCCCTTGGTGCACAA |
HK2 | 15277 | CCCTGCCACCAGACGAAA | GACTTGAACCCCTTAGTCCATGA |
CCL3 | 20302 | TTGGGGTCAGCGCAGATCTG | TCCCAGCCAGGTGTCATTTT |
Arginase (Arg1) | 11846 | GCTCCAAGCCAAAGTCCTTAGA | CCTCGAGGCTGTCCTTTTGA |
TNFα | 21929 | CAGCCGATGGGTTGTACCTT | GGCAGCCTTGTCCCTTGA |
iNOS (Nos2) | 18126 | AGACCTCAACAGAGCCCTCA | GCAGCCTCTTGTCTTTGACC |
CD206 (Mrc1) | 17533 | CCCAAGGGCTCTTCTAAAGCA | CGCCGGCACCTATCACA |
18s rRNA | 19791 | CGAACGTCTGCCCTATCAACTT | ACCCGTGGTCACCATGGTA |
© 2020 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (http://creativecommons.org/licenses/by/4.0/).
Share and Cite
Hamid, T.; Ismahil, M.A.; Bansal, S.S.; Patel, B.; Goel, M.; White, C.R.; Anantharamaiah, G.M.; Prabhu, S.D. The Apolipoprotein A-I Mimetic L-4F Attenuates Monocyte Activation and Adverse Cardiac Remodeling after Myocardial Infarction. Int. J. Mol. Sci. 2020, 21, 3519. https://doi.org/10.3390/ijms21103519
Hamid T, Ismahil MA, Bansal SS, Patel B, Goel M, White CR, Anantharamaiah GM, Prabhu SD. The Apolipoprotein A-I Mimetic L-4F Attenuates Monocyte Activation and Adverse Cardiac Remodeling after Myocardial Infarction. International Journal of Molecular Sciences. 2020; 21(10):3519. https://doi.org/10.3390/ijms21103519
Chicago/Turabian StyleHamid, Tariq, Mohamed Ameen Ismahil, Shyam S. Bansal, Bindiya Patel, Mehak Goel, C. Roger White, G. M. Anantharamaiah, and Sumanth D. Prabhu. 2020. "The Apolipoprotein A-I Mimetic L-4F Attenuates Monocyte Activation and Adverse Cardiac Remodeling after Myocardial Infarction" International Journal of Molecular Sciences 21, no. 10: 3519. https://doi.org/10.3390/ijms21103519