Heterologous Expression of Nitrate Assimilation Related-Protein DsNAR2.1/NRT3.1 Affects Uptake of Nitrate and Ammonium in Nitrogen-Starved Arabidopsis

Abstract

Nitrogen (N) is an essential macronutrient for plant growth. Plants absorb and utilize N mainly in the form of nitrate (NO₃⁻) or ammonium (NH₄⁺). In this study, the nitrate transporter DsNRT3.1 (also known as the nitrate assimilation-related protein DsNAR2.1) was characterized from Dianthus spiculifolius. A quantitative PCR (qPCR) analysis showed that the DsNRT3.1 expression was induced by NO₃⁻. Under N-starvation conditions, the transformed Arabidopsis seedlings expressing DsNRT3.1 had longer roots and a greater fresh weight than the wild type. Subcellular localization showed that DsNRT3.1 was mainly localized to the plasma membrane in Arabidopsis root hair cells. Non-invasive micro-test (NMT) monitoring showed that the root hairs of N-starved transformed Arabidopsis seedlings had a stronger NO₃⁻ and NH₄⁺ influx than the wild-type seedlings, using with NO₃⁻ or NH₄⁺ as the sole N source; contrastingly, transformed seedlings only had a stronger NO₃⁻ influx when NO₃⁻ and NH₄⁺ were present simultaneously. In addition, the qPCR analysis showed that the expression of AtNRT2 genes (AtNRT2.1–2.6), and particularly of AtNRT2.5, in the transformed Arabidopsis differed from that in the wild type. Overall, our results suggest that the heterologous expression of DsNRT3.1 affects seedlings’ growth by enhancing the NO₃⁻ and NH₄⁺ uptake in N-starved Arabidopsis. This may be related to the differential expression of AtNRT2 genes.

1. Introduction

Nitrogen (N) is an essential macronutrient for plant growth and crop productivity [1]. Plants acquire inorganic N from the soil, mainly in the form of nitrate (NO₃⁻) and ammonium (NH₄⁺) [2]. Under aerobic conditions, NO₃⁻ is usually the most abundant N source in soil, and it is the predominant form of N absorbed by most plants [3]. For some species, such as rice (Oryza sativa) and Camellia sinensis, NH₄⁺ is the preferred N source [4,5]. The NO₃⁻ uptake system in higher plants includes a low-affinity transport system (LATS) and a high-affinity transport system (HATS) to accommodate changes in NO₃⁻ concentrations in the soil [6].

The root uptake of NO₃⁻ and transport to the whole plant are regulated by NO₃⁻ transporters (NRTs) [6,7]. NRTs consists of three gene families, NRT1 (also named NPF, nitrate transporter 1 (NRT1)/peptide transporter (PTR) gene family), NRT2, and NRT3 (also named NAR, nitrate assimilation-related protein) [3]. The NRT1 family comprises many genes—53 members in Arabidopsis and 93 members in the rice genome [8,9]. It is suggested that most members of the NRT1 family function as the main components of the LATS at high concentrations of NO₃⁻ [6]. Under low NO₃⁻ concentrations, NRT2 and NRT3/NAR families can function as the major components of the HATS for the root NO₃⁻ influx [6,7,10]. The NRT2 family has seven members (AtNRT2.1–2.7) in Arabidopsis [11], and five members (OsNRT2.1, 2.2, 2.3a, 2.3b, and OsNRT2.4) in the rice genome [12]. The many members of the NRT2 family are unable to transport NO₃⁻ alone; they require a partner protein, NRT3/NAR2. The first NRT3/NAR2 gene was identified in Chlamydomonas reinhardtii; it functions with CrNRT2 members in the NO₃⁻ influx [13]. In both Arabidopsis and rice, the NRT3/NAR2 families have two members, AtNRT3.1 and AtNRT3.2 and OsNAR2.1 and OsNAR2.2 [10,11,12]. Arabidopsis NRT2 members (AtNRT2.1–2.6) require AtNRT3.1 for NO₃⁻ uptake [14,15]. In atnrt 3.1 mutant plants, the high-affinity NO₃⁻-inducible influx was reduced [16]. Except for AtNRT2.7, the other six AtNRT2 transporters interact with AtNRT3.1 [15]. Furthermore, the plasma membrane complex of AtNRT3.1 and AtNRT2.5 has been found to be a major contributor to constitutive high-affinity NO₃⁻ influx in Arabidopsis [17]. Similarly, the rice OsNRT2 members (OsNRT2.1, 2.2 and 2.3a) require OsNAR2.1 for their NO₃⁻ uptake [12,18]. Both high- and low-affinity NO₃⁻ transport were greatly impaired by OsNAR2.1 knockdown. Yeast two hybrid screening showed that OsNAR2.1 interacted with OsNRT2.1, OsNRT2.2, and OsNRT2.3a [18]. Furthermore, the arginine 100 and aspartic acid 109 of OsNAR2.1 were found to be key amino acids in their interaction with OsNRT2.3a, and their interaction occurs in the plasma membrane [19]. These studies demonstrate that NRT3 is essential for high-affinity NRT2 in NO₃⁻ uptake in Arabidopsis and rice.

Dianthus spiculifolius Schur (Caryophyllaceae), a perennial herbaceous flowering plant, is a high-economic value ornamental crop with a high economic value that has strong resistance to cold, drought, and barren conditions. Studying its tolerance toward barren soil contributes to expanding its application and production in barren soils. The NRT genes play key roles in N absorption and utilization by plants. In this study, the DsNRT3.1 gene was identified from the transcriptome of D. spiculifolius [20]. Its expression in response to different N sources was investigated using qPCR. The subcellular localization of DsNRT3.1 in plant cells was observed using green fluorescent protein (GFP) as a marker. We compared the phenotypes of the transformed Arabidopsis seedlings expressing DsNRT3.1 and wild-type seedlings with different N sources (NO₃⁻ or NH₄⁺). We monitored the net fluxes of NO₃⁻ and NH₄⁺ in transformed Arabidopsis root hairs with different N sources using non-invasive micro-test (NMT) technology.

2. Results

2.1. Expression Analysis of DsNRT3.1

The complete cDNA sequence of DsNRT3.1 was isolated from the D. spiculifolius transcriptome, which contains a 585 bp open reading frame that encodes 194 amino acids and has a predicted molecular mass of 21.07 kDa. The sequence and phylogenetic tree analysis revealed that the DsNRT3.1 protein was similar to AtNRT3.1 (42.86% amino acid sequence identity) and NRT3.1 from Arabidopsis and other species (Figure 1A,B). Two transmembrane domains of the DsNRT3.1 protein were predicted using HMMTOP software (Figure 1C).

The expression of DsNRT3.1 in seedlings supplied with different N sources was investigated. The qPCR analysis revealed that the addition of exogenous KNO₃ (1 mM), KCl (1 mM), or NH₄NO₃ (1 mM) significantly induced the DsNRT3.1 expression (Figure 2A,B). By 3 h of treatment, KNO₃ and KCl induced the upregulation of DsNRT3.1 expression by six-fold and two-fold, respectively. By 6–24 h, both KNO₃ and KCl induced the upregulation of DsNRT3.1 expression by 4–6-fold. By 3–24 h, the addition of NH₄NO₃ (1 mM) induced the upregulation of DsNRT3.1 expression by 4–8-fold. However, (NH₄)₂SO₄ (0.5 mM) did not significantly affect the DsNRT3.1 expression (Figure 2B). This indicates that the DsNRT3.1 expression was affected by NO₃⁻ and K⁺.

2.2. Effect of Heterologous Expression of DsNRT3.1 on Arabidopsis Seedings Growth

Transformed Arabidopsis seedlings expressing DsNRT3.1, generated using the 35S promoter, were used to investigate the role of DsNRT3.1 in plant growth. The expression of DsNRT3.1 in the transformed Arabidopsis lines was confirmed using a semi-quantitative RT-PCR (Figure 3A). After 10 days on N-free 1/2 strength Murashige and Skoog (MS) medium, wild-type and transformed seedlings showed the N-starvation phenotype, but there was no significant difference in the primary root length. On N-free 1/2 MS medium supplemented with NO₃⁻ or NH₄⁺ (0.01 or 0.02 mM) as the sole N source, the primary roots of the transformed seedlings were significantly longer than those of the wild-type seedlings. At NO₃⁻ or NH₄⁺ concentrations over 1 mM, there was no significant difference in primary root length between the wild-type and transformed seedlings (Figure 3B–D). Furthermore, the fresh weight of the transformed seedlings was generally higher than that of the wild-type seedlings after 20 days on N-free 1/2 MS medium supplemented with NO₃⁻ (0.05 to 0.5 mM) or NH₄⁺ (0.1 mM) (Figure 4A–C). These results show that with low-concentration NO₃⁻ or NH₄⁺ as the sole N source, the transformed seedlings grew better than the wild-type seedlings.

2.3. Effect of Heterologous Expression of DsNRT3.1 on the NO₃⁻ and NH₄⁺ Fluxes in Arabidopsis Root Hairs

It is thought that DsNRT3.1 is a membrane protein (Figure 1C); therefore, we examined the DsNRT3.1 localization in Arabidopsis using GFP as a marker. In the root hair cells of Arabidopsis stably expressing DsNRT3.1-GFP, the DsNRT3.1-GFP signals were localized mainly to the cell periphery, which is similar to the plasma membrane. However, as a control, the GFP signal was generally distributed throughout the root hair cells of Arabidopsis stably expressing GFP (Figure 5A). Root hairs are a primary site for nutrient uptake in plants [21]. The net NO₃⁻ and NH₄⁺ fluxes in the root hairs of wild-type and transformed Arabidopsis were monitored and compared using NMT (Figure 5B).

Seedlings grown on the 1/2 MS medium or N-free 1/2 MS medium (N-starvation treatment) for 10 days were transferred to a test solution containing KNO₃ (0.1 mM), NH₄Cl (0.1 mM), or NO₃NH₄ (0.5 mM) as the sole N source. With KNO₃ or NH₄Cl as the sole N source, the root hairs of the wild-type and transformed seedlings cultured on the 1/2 MS medium displayed a marked NO₃⁻ or NH₄⁺ efflux, with no significant difference in the efflux rates between the transformed and wild-type seedlings (Figure 6A–D). However, there was marked NO₃⁻ or NH₄⁺ influx displayed in the root hairs of the N-starved wild-type and transformed seedlings (Figure 6E,G); the mean influx rate in the transformed seedlings was significantly higher than in the wild-type seedlings (Figure 6F,H).

With NO₃NH₄ as the sole N source, the root hairs of N-starved transformed seedlings showed a higher NO₃⁻ influx rate than those of the wild type (Figure 7E,F), whereas the NH₄⁺ influx rate was similar to that of the wild type (Figure 7G,H). Moreover, the NO₃⁻ and NH₄⁺ efflux from the root hairs of the wild-type or transformed seedlings cultured on 1/2 MS medium was not marked and showed no significant difference among the lines (Figure 7A–D). This indicates that the root hairs of N-starved transformed seedlings have a stronger NO₃⁻ uptake ability than those of wild-type seedlings; they also have a stronger NH₄⁺ uptake ability in the absence of NO₃⁻, suggesting that the heterologous expression of DsNRT3.1 affects the NO₃⁻ and NH₄⁺ uptake in N-starved Arabidopsis seedlings.

2.4. Effect of Heterologous Expression of DsNRT3.1 on Arabidopsis NRT2 Genes Expression

NRT3, as a partner protein to the NTR2 family, is important for NRT2 function [15]. The expression levels of AtNRT2 genes in the wild-type and transformed Arabidopsis seedlings were compared. The qPCR analysis revealed that the expression levels of six of the seven NRT2 family members differed between the transformed Arabidopsis and wild-type seedlings; NRT2.1, 2.2, 2.4, and 2.6 were down-regulated and NRT2.5 was up-regulated. However, the expression of AtNRT3.1 and AtNRT2.7 in transformed Arabidopsis was similar to that in the wild type, with no significant difference (Figure 8). This suggests that the heterologous expression of DsNRT3.1 affects the expression of members of the AtNRT2 gene family in transformed Arabidopsis seedlings.

3. Discussion

The first NRT3.1 was identified from Chlamydomonas [13], and its orthologous proteins were subsequently identified in barley (HvNRT3.1/HvNAR2.1) [22], Arabidopsis (AtNRT3.1) [16], rice (OsNRT3.1/OsNAR2.1) [18], and chrysanthemums (CmNRT3/CmNAR2) [23]. A sequence analysis showed that DsNRT3.1 was highly similar to AtNRT3.1, HvNRT3.1, and OsNRT3.1/OsNAR2.1 (Figure 1A,B). NRT3.1 was considered to be a high-affinity transporter; it was induced at low concentrations of N sources, whereas its expression was largely unaffected at high concentrations or using saturated N sources. Therefore, we performed a gene expression analysis after N-starvation. In N-starved seedlings, DsNRT3.1 was also induced by NO₃⁻ (Figure 2). Similarly, the expression of AtNRT3.1, OsNRT3.1/OsNAR2.1, and CmNRT3/CmNAR2 was also induced by NO₃⁻ in N-starved seedlings [16,18,23]. However, the expression of OsNRT3.1/OsNAR2.1 was almost unaffected by NH₄⁺ [18]. We found that DsNRT3.1 expression was not induced by NH₄⁺ (Figure 2B). In addition, K⁺ affected the DsNRT3.1 expression (Figure 2A). NRT1.5 from the NRT family serves as a proton-coupled H⁺/K⁺ antiporter for K⁺ loading in Arabidopsis [24].

The roots of N-starved transformed DsNRT3.1 seedlings were longer than those of the wild type under low N conditions, with NO₃⁻ or NH₄⁺ as the sole N source (Figure 3). After longer periods of culture, the fresh weight of the transformed DsNRT3.1 seedlings was generally higher than that of the wild type (Figure 4). With KNO₃ as the sole N source, the transformed seedlings had longer roots and higher root NO₃⁻ influx rates than the wild type (Figure 3C and Figure 6E,F). Likewise, with NH₄NO₃ as the sole N source, the transformed seedling roots had higher NO₃⁻ influx rates than the wild type (Figure 7E,F). These results suggest that longer root growth in transformed seedlings may be associated with a stronger NO₃⁻ uptake. A confocal observation using GFP as a marker revealed that DsNRT3.1 was mainly localized to the plasma membrane in Arabidopsis root hair cells (Figure 5A). Furthermore, NMT monitoring showed that the root hairs of N-starved transformed seedlings had a stronger NO₃⁻ and NH₄⁺ influx than those of the wild-type seedlings (Figure 6A–D). Several studies have shown that NRT3.1 regulates NO₃⁻ uptake via interaction with NRT2 members on the plasma membrane [15,18,19,23]. Thus, we hypothesized that the heterologous expression of DsNRT3.1 might affect the NO₃⁻ uptake in N-starved seedlings via interaction with AtNRT2 members on the plasma membrane. We compared the expression levels of AtNRT2 genes in the transformed and wild-type seedlings. The qPCR analysis revealed that the expression of multiple NRT2 members (AtNRT2.1–2.6), and particularly of AtNRT2.5, was altered in transformed Arabidopsis-expressing DsNRT3.1 (Figure 8). Arabidopsis AtNRT2.5 is a high-affinity NO₃⁻ transporter localized on the plasma membrane and is expressed in the root hair zone [25]. Under long-term N-starvation, AtNRT2.5 becomes the most abundant transcript amongst the seven AtNRT2 members in Arabidopsis shoots and roots [25]. Subsequent studies have revealed that AtNRT3.1 and AtNRT2.5 form a complex on the plasma membrane; this complex is a major contributor to high-affinity NO₃⁻ influx in Arabidopsis [17]. However, in our study, the AtNRT3.1 expression in transformed seedlings was not altered (Figure 8). Thus, our results suggest that the heterologous expression of DsNRT3.1 may enhance the NO₃⁻ uptake by affecting AtNRT2.5 function, thereby affecting the seedling growth in Arabidopsis under N-starvation. To further elucidate the role and function of DsNRT3.1, future research should address the following aspects: (i) whether the heterologous expression of DsNRT3.1 complements the function of the atnrt3.1 mutant; and (ii) whether DsNRT3.1 interacts with AtNRT2 members, and particularly with AtNRT2.5, on the plasma membrane. Furthermore, we found that in the absence of NO₃⁻, the root hairs of N-starved transformed Arabidopsis seedlings showed a stronger NH₄⁺ influx than those of the wild type (Figure 6G,H and Figure 7G,H), suggesting that the heterologous expression of DsNRT3.1 may directly or indirectly affect the NH₄⁺ uptake under N-starvation. However, this requires further study. Recent studies have shown that AtNRT1.1 participates in the NH₄⁺ uptake by affecting the NH₄⁺ transporter expression [26].

4. Materials and Methods

4.1. Sequence Analysis of DsNRT3.1

The amino acid sequence of DsNRT3.1 (GenBank accession No. MN334698) and its homologs were aligned using BioEdit (https://bioedit.software.informer.com/). The phylogenetic tree was constructed using molecular evolutionary genetics analysis (MEGA) 4.1 software (available online: http://www.megasoftware.net/). The transmembrane domains prediction of DsNRT3.1 was performed using the HMMTOP (http://www.sacs.ucsf.edu/cgi-bin/hmmtop.py/) software.

4.2. Plant Materials and Growth Conditions

Seeds of D. spiculifolius and A. thaliana (Columbia-0) were surface sterilized using 30% (v/v) bleach solution for 6 min and rinsed five times with sterile water. The sterilized seeds were grown on 1/2 strength Murashige and Skoog (MS) medium (10.3 mM NH₄NO₃, 9.4 mM KNO₃, 0.6 mM KH₂PO₄, 0.8 mM MgSO₄, 1.5 mM CaCl₂, 2.5 µM KI, 50 µM MnSO₄, 50 µM H₃BO₃, 15 µM ZnSO₄, 0.5 µM Na₂MoO₄, 0.05 µM CuSO₄, 0.06 µM CoCl₂, 0.1 mM FeSO₄, 0.1 mM Na₂-EDTA) medium supplemented with 1% agar and 3% sucrose (pH 5.8) under a 12 h light/12 h dark photoperiod (100 μmol m⁻² s⁻¹ light intensity) at 22 °C.

For the different N-source treatments, D. spiculifolius seedings were N-starved for 1 week, then transferred to N-free 1/2 MS medium (3% sucrose, 1% agar, pH 5.8) supplemented with 1 mM KNO₃, 1 mM KCl, 1 mM NH₄NO₃, or 0.5 mM (NH₄)₂SO₄ as the sole N source. At least 10 seedlings from each treatment were harvested and pooled at different time points (0, 3, 6, 12, or 24 h after treatments), frozen immediately in liquid N, and stored at −80 °C for RNA preparation.

4.3. RNA Preparation and Expression Analysis

The total RNA (1.2 µg) was extracted using an RNeasy^® Mini Kit (Qiagen, Valencia, CA, USA), and cDNA (20 µL) was synthesized using an M-MLV RTase cDNA Synthesis Kit (TaKaRa, Shiga, Japan), according to the manufacturers’ instructions. The qPCR analysis was performed using Bio-Rad CFX Manager Software Version 3.1 (Bio-Rad, Hercules, CA, USA) using the appropriate pairs of species-specific primers (Supplementary Materials Table S1). The reaction components per 20 µL were as follows: 7 µL H₂O, 10 µL Hieff qPCR SYBR Green Master Mix (YEASEN, Shanghai, China), 1 µL 10 µM of each primer and 1 µL cDNA. The thermal cycling program was as follows: initial denaturation at 95 °C for 60 s, and 40 cycles at 95 °C for 10 s, 60 °C for 30 s, and 72 °C for 30 s. DsActin or AtActin was used as an internal reference gene. The relative quantification of gene expression was evaluated using the delta-delta-Ct method. Three biological replicates and three technical replicates were performed for each analysis.

4.4. Vector Construction and Plant Transformation

The open reading frame of DsNRT3.1 was constructed into the pBI121 vector driven by 35S promoter, using the following restriction sites: 121DsNRT3.1(X)-F (TCTAGAATGGCGGTGCGAGG ATTAAC; the XbaI site is underlined) and 121DsNRT3.1(S)-R (GAGCTCGTAGCTAGCTTCGACTT CTTC; the SacI site is underlined). To construct the DsNRT3.1-GFP fusion gene, the open reading frame of DsNRT3.1 without a stop codon was constructed into a pBI121-GFP vector using the 121DsNRT3.1(X)-F and 121DsNRT3.1(K)-R (GGTACCGTAGCTAGCTTCGACTTCTTC; the KpnI site is underlined) restriction sites. These pBI121-GFP constructs have been described elsewhere [27]. These constructs were transformed into the Agrobacterium tumefaciens strain EHA105 for plant transformation; Arabidopsis was transformed using the floral dip method [28]. The transformed plants were placed on 1/2 MS medium containing 30 μg mL⁻¹ kanamycin. The primers used in this study are shown in Supplementary Materials Table S1.

4.5. Subcellular Localization of DsNRT3.1

Four-day-old seedlings grown on vertical 1/2 MS medium plates (0.5% sucrose, pH 5.8) were placed at room temperature. The roots of transformed Arabidopsis seedlings were re-washed using liquid 1/2 MS medium immediately before confocal laser scanning microscopy (CLSM) (Nikon, A1, Tokyo, Japan).

4.6. Phenotypic Analysis of Transformed Arabidopsis

The sterilized wild-type and transformed Arabidopsis seeds were stratified for 3 days at 4 °C. The seedlings were then transferred to N-free 1/2 MS medium (3% sucrose, 1% agar, pH 5.8) supplemented with different concentrations of KNO₃ or NH₄Cl (0, 0.01, 0.02, 0.05, 0.1, 0.3, 0.5, 1, or 2.5 mM) for 10 days before measuring root length, or 20 days before measuring the seedlings fresh weight. After examining seedling growth phenotypes, the plants were photographed using a Canon EOS 80D camera (Canon, Tokyo, Japan). Images were processed using Adobe Photoshop CS. Seedling root length was measured using Image Pro Plus 6.0 software (Media Cybernetics, Silver Spring, MD, USA). The fresh weight of the aerial parts of the seedlings was measured using an analytical balance with an accuracy of ± 0.1 mg.

4.7. NMT Measurement of Net NO₃⁻ and NH₄⁺ Fluxes in Arabidopsis Root Hairs

The net fluxes of NO₃⁻ and NH₄⁺ in the root hairs of the wild-type and transformed Arabidopsis seedlings were measured using NMT (NMT100 Series, YoungerUSA LLC, Amherst, MA, USA) as previously described [29]. The wild-type and transformed Arabidopsis seeds were surface sterilized and kept at 4 °C for 3 days in the dark. After germination, the seedlings were transferred into N-free 1/2 MS medium for 7 days, after which the roots of the seedlings were immediately equilibrated in a measuring solution containing 0.1 mM KNO₃, 0.1 mM NH₄Cl, or 0.1 mM NH₄NO₃ for 10 min. The roots were fixed to the bottom of the plate using resin blocks and filter paper strips. To take flux measurements, the ion-selective electrodes were calibrated using NO₃⁻ or NH₄⁺ at concentrations of 0.05 and 0.5 mM, respectively. The net fluxes of NO₃⁻ or NH₄⁺ in the root hairs were measured. Each sample was measured continuously for 10 min. The KNO₃ and NH₄NO₃ measuring solution contained 0.1 mM KNO₃, 0.1 mM CaCl₂, 0.1 mM KCl, and 0.3 mM MES (pH 6.0). The NH₄Cl measuring solution contained 0.1 mM NH₄Cl, 0.1 mM CaCl₂, and 0.3 mM MES (pH 6.0). The KNO₃ calibration solution contained 0.5mM KNO₃, 0.1 mM KCl, 0.1 mM CaCl₂ and 0.3 mM MES (pH 6.0); 0.05 mM KNO₃, 0.1 mM KCl, 0.1 mM CaCl₂, and 0.3 mM MES (pH 6.0). The NH₄Cl calibration solution contained 0.5 mM NH₄Cl, 0.1 mM CaCl₂, and 0.3 mM MES (pH 6.0); 0.05 mM NH₄Cl, 0.1 mM CaCl₂, and 0.3 mM MES (pH 6.0). The NH₄NO₃ calibration solution contained 0.5 mM NH₄NO₃, 0.1 mM CaCl₂, and 0.3 mM MES (pH 6.0); 0.05 mM NH₄NO₃, 0.1 mM CaCl₂, and 0.3 mM MES (pH 6.0). The calibration slopes for NO₃⁻ and NH₄⁺ were −55.61 and 56.19 mV/decade, respectively. Six biological repeats were performed for each analysis.

4.8. Statistical Analysis

The data were analyzed using a one-way analysis of variance in SPSS (SPSS, Inc., Chicago, IL, USA), and statistically significant differences were calculated using the Student’s t-test, with p < 0.05 as the threshold for significance.

5. Conclusions

In this study, the nitrate assimilation-related protein DsNAR2.1/DsNRT3.1 was characterized from D. spiculifolius. DsNRT3.1 was localized mainly in the plasma membrane of Arabidopsis root hair cells. The findings reveal that the heterologous expression of DsNRT3.1 in Arabidopsis affects seedling root growth and NO₃⁻ and NH₄⁺ uptake under N-starvation, as well as the expression of AtNRT2 family members. Overall, our results suggest that DsNRT3.1 may affect the seedling growth in N-starved Arabidopsis by enhancing the NO₃⁻ and NH₄⁺ uptake, which may be associated with altered AtNRT2 family expression. Our study also suggests that DsNRT3.1 functions as a positive regulator of plant N uptake and could be utilized for the genetic improvement of N-efficient plants.