Maternal Tryptophan Supplementation Protects Adult Rat Offspring against Hypertension Programmed by Maternal Chronic Kidney Disease: Implication of Tryptophan-Metabolizing Microbiome and Aryl Hydrocarbon Receptor
Abstract
:1. Introduction
2. Results
2.1. Blood Pressure and Renal Function
2.2. Nitric Oxide Pathway
2.3. Aryl Hydrocarbon Receptor (AHR) Pathway
2.4. Renin-Antiotensin System
2.5. Gut Microbiota Compositions
3. Discussion
4. Materials and Methods
4.1. Animals and Experimental Design
4.2. High Performance Liquid Chromatography (HPLC)
4.3. Quantitative Real-Time PCR Analysis
4.4. Metagenomics Analysis of Gut Microbiota
4.5. Statistical Analysis
5. Conclusions
Author Contributions
Funding
Conflicts of Interest
Abbreviations
ACE | Angiotensin converting enzyme |
ACE2 | Angiotensin converting enzyme 2 |
ADMA | Asymmetric dimethylarginine |
AHR | Aryl hydrocarbon receptor |
ANOSIM | Analysis of Similarities |
AT1R | Angiotensin II type 1 receptor |
AT2R | Angiotensin II type 2 receptor |
CKD | Chronic kidney disease |
LDA | Linear discriminant analysis |
LEfSe | Linear discriminant analysis effect size |
MAS | Angiotensin (1-7) receptor |
PLS-DA | Partial Least Squares Discriminant Analysis |
RAS | Renin–angiotensin system |
SD | Sprague–Dawley |
SDMA | Symmetric dimethylarginine |
References
- Luyckx, V.A.; Bertram, J.F.; Brenner, B.M.; Fall, C.; Hoy, W.E.; Ozanne, S.E.; Vikse, B.E. Effect of fetal and child health on kidney development and long-term risk of hypertension and kidney disease. Lancet 2013, 382, 273–283. [Google Scholar] [CrossRef] [Green Version]
- Chong, E.; Yosypiv, I.V. Developmental programming of hypertension and kidney disease. Int. J. Nephrol. 2012, 2012, 760580. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Tain, Y.L.; Hsu, C.N. Developmental origins of chronic kidney disease: Should we focus on early life? Int. J. Mol. Sci. 2017, 18, 381. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Hladunewich, M.A. Chronic kidney disease and pregnancy. Semin. Nephrol. 2017, 37, 337–346. [Google Scholar] [CrossRef] [PubMed]
- Roager, H.M.; Licht, T.R. Microbial tryptophan catabolites in health and disease. Nat. Commun. 2018, 9, 3294. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Castillo-Rodriguez, E.; Fernandez-Prado, R.; Esteras, R.; Perez-Gomez, M.V.; Gracia-Iguacel, C.; Fernandez-Fernandez, B.; Kanbay, M.; Tejedor, A.; Lazaro, A.; Ruiz-Ortega, M.; et al. Impact of altered intestinal microbiota on chronic kidney disease progression. Toxins (Basel) 2018, 10, 300. [Google Scholar] [CrossRef] [Green Version]
- Friedman, M. Analysis, nutrition, and health benefits of tryptophan. Int. J. Tryptophan Res. 2018, 11. [Google Scholar] [CrossRef] [Green Version]
- Le Floc’h, N.; Otten, W.; Merlot, E. Tryptophan metabolism, from nutrition to potential therapeutic applications. Amino Acids 2011, 41, 1195–1205. [Google Scholar] [CrossRef]
- Zhang, N. The role of endogenous aryl hydrocarbon receptor signaling in cardiovascular physiology. J. Cardiovasc. Dis. Res. 2011, 2, 91–95. [Google Scholar] [CrossRef] [Green Version]
- Hsu, C.N.; Lin, Y.J.; Lu, P.C.; Tain, Y.L. Maternal resveratrol therapy protects male rat offspring against programmed hypertension induced by TCDD and dexamethasone exposures: Is it relevant to aryl hydrocarbon receptor? Int. J. Mol. Sci. 2018, 19, 2459. [Google Scholar] [CrossRef] [Green Version]
- Hsu, C.N.; Lin, Y.J.; Tain, Y.L. Maternal exposure to bisphenol a combined with high-fat diet-induced programmed hypertension in adult male rat offspring: Effects of resveratrol. Int. J. Mol. Sci. 2019, 20, 4382. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Chang, C.C.; Hsu, Y.H.; Chou, H.C.; Lee, Y.G.; Juan, S.H. 3-Methylcholanthrene/Aryl-hydrocarbon receptor-mediated hypertension through eNOS inactivation. J. Cell Physiol. 2017, 232, 1020–1029. [Google Scholar] [CrossRef] [PubMed]
- Zhang, N.; Agbor, L.N.; Scott, J.A.; Zalobowski, T.; Elased, K.M.; Trujillo, A.; Duke, M.S.; Wolf, V.; Walsh, M.T.; Born, J.L.; et al. An activated renin-angiotensin system maintains normal blood pressure in aryl hydrocarbon receptor heterozygous mice but not in null mice. Biochem. Pharmacol. 2010, 80, 197–204. [Google Scholar] [CrossRef] [Green Version]
- Meijersa, B.; Jouretc, F.; Evenepoel, P. Linking gut microbiota to cardiovascular disease and hypertension: Lessons from chronic kidney disease. Pharmacol. Res. 2018, 133, 101–107. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Yokozawa, T.; Zheng, P.D.; Oura, H.; Koizumi, F. Animal model of adenine-induced chronic renal failure in rats. Nephron 1986, 44, 230–234. [Google Scholar] [CrossRef]
- Hsu, C.N.; Tain, Y.L. Regulation of nitric oxide production in the developmental programming of hypertension and kidney disease. Int. J. Mol. Sci. 2019, 20, 681. [Google Scholar] [CrossRef] [Green Version]
- Te Riet, L.; van Esch, J.H.; Roks, A.J.; van den Meiracker, A.H.; Danser, A.H. Hypertension: Renin-angiotensin aldosterone system alterations. Circ. Res. 2015, 116, 960–975. [Google Scholar] [CrossRef]
- Goodrich, J.K.; Di Rienzi, S.C.; Poole, A.C.; Koren, O.; Walters, W.A.; Caporaso, J.G.; Knight, R.; Ley, R.E. Conducting a microbiome study. Cell 2014, 158, 250–262. [Google Scholar] [CrossRef] [Green Version]
- Morris, E.K.; Caruso, T.; Buscot, F.; Fischer, M.; Hancock, C.; Maier, T.S.; Meiners, T.; Müller, C.; Obermaier, E.; Prati, D.; et al. Choosing and using diversity indices: Insights for ecological applications from the German Biodiversity. Exploratories. Ecol. Evol. 2014, 4, 3514–3524. [Google Scholar] [CrossRef] [Green Version]
- Clarke, K.R.; Green, R.H. Statistical design and analysis for a ‘biological effects’ study. Marine Ecol. Prog. Series 1988, 46, 213–226. [Google Scholar] [CrossRef]
- Wagner, B.D.; Grunwald, G.K.; Zerbe, G.O.; Mikulich-Gilbertson, S.K.; Robertson, C.E.; Zemanick, E.T.; Harris, J.K. On the use of diversity measures in longitudinal sequencing studies of microbial communities. Front. Microbiol. 2018, 9, 1037. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Yang, T.; Richards, E.M.; Pepine, C.J.; Raizada, M.K. The gut microbiota and the brain-gut-kidney axis in hypertension and chronic kidney disease. Nat. Rev. Nephrol. 2018, 14, 442–456. [Google Scholar] [CrossRef] [PubMed]
- Diwan, V.; Brown, L.; Gobe, G.C. Adenine-induced chronic kidney disease in rats. Nephrology (Carlton) 2018, 23, 5–11. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Claramunt, D.; Gil-Pena, H.; Fuente, R.; García-López, E.; Loredo, V.; Hernández-Frías, O.; Ordoñez, F.A.; Rodríguez-Suárez, J.; Santos, F. Chronic kidney disease induced by adenine: A suitable model of growth retardation in uremia. Am. J. Physiol. Renal Physiol. 2015, 309, F57–F62. [Google Scholar] [CrossRef] [Green Version]
- Wang, Y.; Liu, H.; McKenzie, G.; Witting, P.K.; Stasch, J.P.; Hahn, M.; Changsirivathanathamrong, D.; Wu, B.J.; Ball, H.J.; Thomas, S.R.; et al. Kynurenine is an endothelium-derived relaxing factor produced during inflammation. Nat. Med. 2010, 16, 279–285. [Google Scholar] [CrossRef] [Green Version]
- Vaziri, N.D.; Wong, J.; Pahl, M.; Piceno, Y.M.; Yuan, J.; Desantis, T.Z.; Ni, Z.; Nguyen, F.H.; Andersen, G.L. Chronic kidney disease alters intestinal microbial flora. Kidney Int. 2013, 83, 308–315. [Google Scholar] [CrossRef] [Green Version]
- Chen, L.; Chen, D.Q.; Liu, J.R.; Zhang, J.; Vaziri, N.D.; Zhuang, S.; Chen, H.; Feng, Y.L.; Guo, Y.; Zhao, Y.Y. Unilateral ureteral obstruction causes gut microbial dysbiosis and metabolome disorders contributing to tubulointerstitial fibrosis. Exp. Mol. Med. 2019, 51, 1–18. [Google Scholar] [CrossRef] [Green Version]
- Tain, Y.L.; Lee, C.T.; Chan, J.Y.; Hsu, C.N. Maternal melatonin or N-acetylcysteine therapy regulates hydrogen sulfide-generating pathway and renal transcriptome to prevent prenatal N(G)-Nitro-L-argininemethyl ester (L-NAME)-induced fetal programming of hypertension in adult male offspring. Am. J. Obstet. Gynecol. 2016, 215, 636. [Google Scholar] [CrossRef]
- Tain, Y.Y.; Lee, W.C.; Hsu, C.N.; Lee, W.C.; Huang, L.T.; Lee, C.T.; Lin, C.Y. Asymmetric dimethylarginine is associated with developmental programming of adult kidney disease and hypertension in offspring of streptozotocin-treated mothers. PLoS ONE 2013, 8, e55420. [Google Scholar] [CrossRef]
- O’Mahony, S.M.; Clarke, G.; Borre, Y.E.; Dinan, T.G.; Cryan, J.F. Serotonin, tryptophan metabolism and the brain-gut-microbiome axis. Behav. Brain Res. 2015, 277, 32–48. [Google Scholar] [CrossRef]
- Liang, H.; Dai, Z.; Kou, J.; Sun, K.; Chen, J.; Yang, Y.; Wu, G.; Wu, Z. Dietary l-Tryptophan supplementation enhances the intestinal mucosal barrier function in weaned piglets: Implication of Tryptophan-metabolizing microbiota. Int. J. Mol. Sci. 2019, 20, 20. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Walter, J. Ecological role of lactobacilli in the gastrointestinal tract: Implications for fundamental and biomedical research. Appl. Environ. Microbiol. 2008, 74, 4985–4996. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Zuo, K.; Li, J.; Xu, Q.; Hu, C.; Gao, Y.; Chen, M.; Hu, R.; Liu, Y.; Chi, H.; Yin, Q.; et al. Dysbiotic gut microbes may contribute to hypertension by limiting vitamin D production. Clin. Cardiol. 2019, 42, 710–719. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Sun, S.; Lulla, A.; Sioda, M.; Winglee, K.; Wu, M.C.; Jacobs, D.R., Jr.; Shikany, J.M.; Lloyd-Jones, D.M.; Launer, L.J.; Anthony, A.F. Gut microbiota composition and blood pressure. Hypertension 2019, 73, 998–1006. [Google Scholar] [CrossRef] [PubMed]
- Yang, T.; Santisteban, M.M.; Rodriguez, V.; Li, E.; Ahmari, N.; Carvajal, J.M.; Zadeh, M.; Gong, M.; Qi, Y.; Zubcevic, J.; et al. Gut dysbiosis is linked to hypertension. Hypertension 2015, 65, 1331–1340. [Google Scholar] [CrossRef] [Green Version]
- Mulero-Navarro, S.; Fernandez-Salguero, P.M. New trends in aryl hydrocarbon receptor biology. Front. Cell Dev. Biol. 2016, 4, 45. [Google Scholar] [CrossRef] [Green Version]
- Hubbard, T.D.; Murray, I.A.; Perdew, G.H. Indole and Tryptophan metabolism: Endogenous and dietary routes to ah receptor activation. Drug Metab. Dispos. 2015, 43, 1522–1535. [Google Scholar] [CrossRef] [Green Version]
- Zelante, T.; Iannitti, R.G.; Cunha, C.; de Luca, A.; Giovannini, G.; Pieraccini, G.; Zecchi, R.; D’Angelo, C.; Massi-Benedetti, C.; Fallarino, F.; et al. Tryptophan catabolites from microbiota engage aryl hydrocarbon receptor and balance mucosal reactivity via interleukin-22. Immunity 2013, 39, 372–385. [Google Scholar] [CrossRef] [Green Version]
- Tain, Y.L.; Huang, L.T.; Hsu, C.N. Developmental programming of adult disease: Reprogramming by melatonin? Int. J. Mol. Sci. 2017, 18, 426. [Google Scholar] [CrossRef] [Green Version]
- Shin, J.H.; Lee, Y.K.; Shon, W.J.; Kim, B.; Jeon, C.O.; Cho, J.Y.; Morse, H.C., 3rd; Choi, E.Y.; Shin, D.M. Gut microorganisms and their metabolites modulate the severity of acute colitis in a tryptophan metabolism-dependent manner. Eur. J. Nutr. 2020. [Google Scholar] [CrossRef]
- Kaur, H.; Bose, C.; Mande, S.S. Tryptophan metabolism by gut microbiome and gut-brain-axis: An in silico analysis. Front. Neurosci. 2019, 13, 1365. [Google Scholar] [CrossRef] [PubMed]
- Tain, Y.L.; Lin, Y.J.; Sheen, J.M.; Yu, H.R.; Tiao, M.M.; Chen, C.C.; Tsai, C.C.; Huang, L.T.; Hsu, C.N. High fat diets sex-specifically affect the renal transcriptome and program obesity, kidney injury, and hypertension in the offspring. Nutrients 2017, 9, 357. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Ruan, Z.; Yang, Y.; Wen, Y.; Zhou, Y.; Fu, X.; Ding, S.; Liu, G.; Yao, K.; Wu, X.; Deng, Z.; et al. Metabolomic analysis of amino acid and fat metabolism in rats with L-tryptophan supplementation. Amino Acids 2014, 46, 2681–2691. [Google Scholar] [CrossRef] [PubMed]
- Gerdts, E.; Regitz-Zagrosek, V. Sex differences in cardiometabolic disorders. Nat. Med. 2019, 25, 1657–1666. [Google Scholar] [CrossRef] [PubMed]
- Bairey Merz, C.N.; Dember, L.M.; Ingelfinger, J.R.; Vinson, A.; Neugarten, J.; Sandberg, K.L.; Sullivan, J.C.; Maric-Bilkan, C.; Rankin, T.L.; Kimmel, P.L. Participants of the national institute of diabetes and digestive and kidney diseases workshop on “Sex and the Kidneys”. Sex and the kidneys: Current understanding and research opportunities. Nat. Rev. Nephrol. 2019, 15, 776–783. [Google Scholar] [CrossRef]
- Hsu, C.N.; Chang-Chien, G.P.; Lin, S.; Hou, C.Y.; Tain, Y.L. Targeting on gut microbial metabolite trimethylamine-N-oxide and short-chain fatty acid to prevent maternal high-fructose-diet-induced developmental programming of hypertension in adult male offspring. Mol. Nutr. Food Res. 2019, 63, e1900073. [Google Scholar] [CrossRef]
Group | CN | CKD | Trp | CKDTrp | p Value | ||
---|---|---|---|---|---|---|---|
Factor | CKD | Trp | CKD × Trp | ||||
Mortality | 0% | 0% | 0% | 0% | |||
Body weight (BW) (g) | 349 ± 9 | 369 ± 15 | 350 ± 6 | 360 ± 10 | NS | NS | NS |
Left kidney weight (g) | 1.43 ± 0.04 | 1.64 ± 0.07 * | 1.55 ± 0.03 | 1.67 ± 0.04 * | 0.001 | NS | NS |
Left kidney weight/100g BW | 0.41 ± 0.01 | 0.45 ± 0.01 * | 0.44 ± 0.01 * | 0.47 ± 0.01 * | 0.004 | 0.01 | NS |
Systolic BP (mmHg) | 136 ± 1 | 153 ± 1 * | 136 ± 1 # | 140 ± 1 # | <0.001 | <0.001 | <0.001 |
Diastolic BP (mmHg) | 70 ± 3 | 70 ± 2 | 70 ± 3 | 70 ± 3 | NS | NS | NS |
MAP (mmHg) | 92 ± 2 | 97 ± 1 * | 92 ± 1 # | 93 ± 2 # | 0.045 | NS | NS |
Creatinine (μM) | 12 ± 0.3 | 12.7 ± 0.3 | 10 ± 0.2 *,# | 9.9 ± 0.1 *,# | NS | 0.001 | NS |
Group | CN | CKD | Trp | CKDTrp | p Value | ||
---|---|---|---|---|---|---|---|
Factor | CKD | Trp | CKD × Trp | ||||
l-citrulline (μM) | 77.4 ± 3.4 | 78.1 ± 1.5 | 64.1 ± 1 *,# | 59.3 ± 1.8 *,# | NS | 0.011 | NS |
l-arginine (μM) | 154 ± 6 | 145 ± 4 | 145 ± 4 | 178 ± 5 | NS | NS | NS |
ADMA (μM) | 2.38 ± 0.13 | 5.92 ± 0.2 * | 2.85 ± 0.18 # | 5.52 ± 0.18 * | <0.001 | NS | NS |
SDMA (μM) | 2.45 ± 0.09 | 2.24 ± 0.03 | 1.84 ± 0.04 *,# | 1.99 ± 0.04 *,# | NS | 0.011 | NS |
AAR (μM/μM) | 72 ± 3 | 26 ± 1 * | 63 ± 5 # | 35 ± 2 * | <0.001 | NS | NS |
Gene | Forward (5′–3′) | Reverse (5′–3′) |
---|---|---|
Ahrr | cagcaacatggcttctttca | tgaagcactgcattccagac |
Cyp1a1 | gcactctggacaaacacctg | atatccaccttctcgcctgg |
Arnt | gtctccctcccagatgatga | gctggtagccaacagtagcc |
Tiparp | gttgagggccaattaccaga | gctcctggcacataatccat |
Ren | aacattaccagggcaactttcact | acccccttcatggtgatctg |
Atp6ap2 | gaggcagtgaccctcaacat | ccctcctcacacaacaaggt |
Agt | gcccaggtcgcgatgat | tgtacaagatgctgagtgaggcaa |
Ace1 | caccggcaaggtctgctt | cttggcatagtttcgtgaggaa |
Ace2 | acccttcttacatcagccctactg | tgtccaaaacctaccccacatat |
At1r | gctgggcaacgagtttgtct | cagtccttcagctggatcttca |
At2r | caatctggctgtggctgactt | tgcacatcacaggtccaaaga |
Mas | catctctcctctcggctttgtg | cctcatccggaagcaaagg |
Rn18S | gccgcggtaattccagctcca | cccgcccgctcccaagatc |
© 2020 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (http://creativecommons.org/licenses/by/4.0/).
Share and Cite
Hsu, C.-N.; Lin, I.-C.; Yu, H.-R.; Huang, L.-T.; Tiao, M.-M.; Tain, Y.-L. Maternal Tryptophan Supplementation Protects Adult Rat Offspring against Hypertension Programmed by Maternal Chronic Kidney Disease: Implication of Tryptophan-Metabolizing Microbiome and Aryl Hydrocarbon Receptor. Int. J. Mol. Sci. 2020, 21, 4552. https://doi.org/10.3390/ijms21124552
Hsu C-N, Lin I-C, Yu H-R, Huang L-T, Tiao M-M, Tain Y-L. Maternal Tryptophan Supplementation Protects Adult Rat Offspring against Hypertension Programmed by Maternal Chronic Kidney Disease: Implication of Tryptophan-Metabolizing Microbiome and Aryl Hydrocarbon Receptor. International Journal of Molecular Sciences. 2020; 21(12):4552. https://doi.org/10.3390/ijms21124552
Chicago/Turabian StyleHsu, Chien-Ning, I-Chun Lin, Hong-Ren Yu, Li-Tung Huang, Mao-Meng Tiao, and You-Lin Tain. 2020. "Maternal Tryptophan Supplementation Protects Adult Rat Offspring against Hypertension Programmed by Maternal Chronic Kidney Disease: Implication of Tryptophan-Metabolizing Microbiome and Aryl Hydrocarbon Receptor" International Journal of Molecular Sciences 21, no. 12: 4552. https://doi.org/10.3390/ijms21124552