Local and Systemic Changes in Photosynthetic Parameters and Antioxidant Activity in Cucumber Challenged with Pseudomonas syringae pv lachrymans
Abstract
:1. Introduction
2. Results
2.1. Chlorophyll Fluorescence
2.2. Gas Exchange
2.3. SOD and CAT Activities
2.4. The Ascorbate–Glutathione Cycle Activity
2.5. Tocopherol Content
2.6. Gene Expression Analysis
3. Discussion
3.1. Differential Local and Systemic Responses of Photosynthesis to Psl Infection
3.2. Infection-Induced Local Changes in the Antioxidant System
3.3. Systemic Antioxidant Response to Local Infection
4. Material and Methods
4.1. Biological Material
4.2. Infrared Thermography and Fluorescence Microscopy
4.3. Chlorophyll Fluorescence and Gas Exchange Analyses
4.4. Chloroplasts Isolation
4.5. Determination of SOD Activity and SOD Native PAGE Electrophoresis
4.6. Determination of CAT and the Ascorbate–Glutathione Cycle Enzymes Activities
4.7. Determination of Protein Content
4.8. Determination of Ascorbate and Glutathione Contents
4.9. Gene Expression Analysis by Quantitative Real-Time PCR
4.10. Determination of Tocopherols by GC-MS
4.11. Statistical Analysis
5. Conclusions
Author Contributions
Funding
Conflicts of Interest
Abbreviations
1O2 | Singlet molecular oxygen |
AA | Ascorbic acid reduced |
APX | Ascorbate peroxidase |
CAT | Catalase |
Ci | Intracellular carbon dioxide concentration |
DHA | Dehydroascorbic acid |
DHAR | Dehydroascorbic acid reductase |
E | Transpiration rate |
ETI | Effector-triggered immunity |
Fv/Fm | Maximal PSII quantum yield |
GR | Glutathione reductase |
Gs | Stomatal conductance |
GSH | Glutathione reduced |
GSSG | Glutathione disulfide |
HR | Hypersensitive response |
MAPK | Mitogen-activated protein kinase |
MDHAR | Monodehydroascorbic acid reductase |
NPQ | Non-photochemical quenching |
NPR1 | non-expressor of pathogenesis-related gene 1 |
O2− | Superoxide anion radical |
PN | Net photosynthesis rate |
PSII | Photosystem II |
PTI | Pathogen-associated molecular patterns (PAMP)-triggered immunity |
QP | Photochemical quenching |
ROS | Reactive oxygen species |
SOD | Superoxide dismutase |
Appendix A
Time after Inoculation [days] | Isoform | L3 | L3 + Psl | L5 | L5 + Psl |
---|---|---|---|---|---|
0 | MnSOD-1 | 1.31 ± 0.23 (a) | 1.25 ± 0.18 (a) | ||
MnSOD-2 | 0.38 ± 0.04 (a) | 0.19 ± 0.06 (b) | |||
MnSOD-3 | 0.44 ± 0.02 (a) | 0.22 ± 0.01 (b) | |||
MnSOD-4 | 0.63 ± 0.03 (a) | 0.16 ± 0.03 (b) | |||
FeSOD | 1.16 ± 0.12 (a) | 0.88 ± 0.07 (a) | |||
CuZnSOD-1 | 1.28 ± 0.07 (a) | 1.22 ± 0.06 (a) | |||
CuZnSOD-2 | 1.00 ± 0.09 (a) | 0.88 ± 0.13 (a) | |||
2 | MnSOD-1 | 1.26 ± 0.22 (a) | 1.46 ± 0.11 (a) | 1.31 ± 0.04 (a) | 1.34 ± 0.22 (a) |
MnSOD-2 | 1.03 ± 0.07 (b) | 1.40 ± 0.03 (a) | 1.06 ± 0.07 (b) | 1.00 ± 0.04 (b) | |
MnSOD-3 | 0.83 ± 0.06 (b) | 1.34 ± 0.08 (a) | 0.89 ± 0.06 (b) | 0.80 ± 0.06 (b) | |
MnSOD-4 | 0.54 ± 0.01 (b) | 1.34 ± 0.23 (a) | 0.60 ± 0.07 (b) | 0.63 ± 0.11 (b) | |
FeSOD | 1.86 ± 0.02 (a) | 1.51 ± 0.04 (b) | 2.06 ± 0.11 (a) | 1.97 ± 0.08 (a) | |
CuZnSOD-1 | 1.23 ± 0.18 (b) | 1.37 ± 0.19 (b) | 2.46 ± 0.13 (a) | 2.34 ± 0.18 (a) | |
CuZnSOD-2 | 1.00 ± 0.04 (b) | 1.06 ± 0.03 (b) | 1.51 ± 0.07 (a) | 1.49 ± 0.15 (a) | |
7 | MnSOD-1 | 1.45 ± 0.03 (a) | 1.41 ± 0.23 (a) | 1.48 ± 0.05 (a) | 1.41 ± 0.03 (a) |
MnSOD-2 | 1.28 ± 0.14 (a) | 1.38 ± 0.04 (a) | 1.24 ± 0.11 (a) | 1.10 ± 0.11 (a) | |
MnSOD-3 | 1.21 ± 0.06 (a) | 1.41 ± 0.16 (a) | 1.17 ± 0.03 (a) | 0.83 ± 0.05 (b) | |
MnSOD-4 | 1.17 ± 0.11 (a) | 1.45 ± 0.11 (a) | 1.10 ± 0.07 (a) | 0.38 ± 0.01 (b) | |
FeSOD | 1.69 ± 0.07 (b) | 3.86 ± 0.09 (a) | 1.76 ± 0.22 (b) | 0.59 ± 0.06 (c) | |
CuZnSOD-1 | 1.10 ± 0.09 (b) | 3.14 ± 0.16 (a) | 1.41 ± 0.14 (b) | 1.34 ± 0.03 (b) | |
CuZnSOD-2 | 1.00 ± 0.15 (b) | 2.48 ± 0.06 (a) | 0.97 ± 0.02 (b) | 0.97 ± 0.07 (b) |
Redox Ratio | Time after Inoculation [days] | L3 | L3 + Psl | L5 | L5 + Psl |
---|---|---|---|---|---|
[AA]tot/[DHA]tot | 0 | 5.5 ± 0.2 (b) | 8.8 ± 0.4 (a) | ||
1 | 5.4 ± 0.1 (b) | 9.2 ± 0.6 (a) | 11.6 ± 0.3 (a) | 6.9 ± 0.5 (b) | |
2 | 6.2 ± 0.3 (a) | 9.3 ± 0.2 (a) | 8.8 ± 0.8 (a) | 7.6 ± 0.1 (a) | |
5 | .0 ± 0.6 (b) | 20.3 ± 0.5 (a) | 8.1 ± 0.4 (b) | 9.7 ± 0.9 (b) | |
7 | 8.7 ± 0.3 (b) | 23.4 ± 0.8 (a) | 6.5 ± 0.9 (b) | 10.8 ± 1.0 (b) | |
[GSH]tot/[GSSG]tot | 0 | 8.8 ± 0.5 (b) | 15.4 ± 0.3 (a) | ||
1 | 10.2 ± 1.2 (a) | 10.9 ± 0.5 (a) | 13.5 ± 0.8 (a) | 14.9 ± 1.0 (a) | |
2 | 7.9 ± 0.6 (b) | 14.2 ± 0.4 (a) | 11.9 ± 0.2 (a) | 13.7 ± 0.3 (a) | |
5 | 10.8 ± 0.4 (b) | 8.0 ± 0.8 (b) | 7.7 ± 0.7 (b) | 18.8 ± 0.9 (a) | |
7 | 13.4 ± 0.6 (a) | 8.8 ± 0.3 (b) | 5.7 ± 0.3 (c) | 15.0 ± 0.7 (a) | |
[AA]chl/[DHA]chl | 0 | 4.2 ± 0.6 (b) | 10.8 ± 0.2 (a) | ||
1 | 3.2 ± 0.3 (b) | 13.4 ± 0.9 (a) | 10.7 ± 0.7 (a) | 9.1 ± 0.3 (a) | |
2 | 3.2 ± 0.1 (b) | 14.0 ± 0.8 (a) | 11.1 ± 0.1 (a) | 14.3 ± 0.5 (a) | |
5 | 3.8 ± 0.8 (c) | 5.6 ± 0.6 (c) | 13.3 ± 0.3 (b) | 25.7 ± 0.5 (a) | |
7 | 3.0 ± 0.2(d) | 6.3 ± 0.3 (c) | 13.0 ± 0.8 (b) | 23.9 ± 0.7 (a) | |
[GSH]chl/[GSSG]chl | 0 | 5.3 ± 0.7 (b) | 8.9 ± 0.3 (a) | ||
1 | 5.4 ± 0.3 (b) | 7.4 ± 0.2 (b) | 9.3 ± 0.1 (a) | 7.2 ± 0.2 (b) | |
2 | 5.2 ± 0.7 (b) | 7.0 ± 0.8 (b) | 9.7 ± 0.2 (a) | 7.7 ± 0.3 (b) | |
5 | 4.7 ± 0.1 (c) | 19.1 ± 0.3 (a) | 8.2 ± 0.1 (b) | 9.6 ± 0.8 (b) | |
7 | 4.5 ± 0.6 (c) | 26.5 ± 1.2 (a) | 6.5 ± 0.9 (c) | 10.8 ± 1.1 (b) |
NCBI Accesion Number | Forward Primer | Reverse Primer |
---|---|---|
GU248529 (CAT) | TTCCAATCAATTACCGTCACAT | ATTCTAATAGCCTCCTCTTCCA |
XM_011654801 (FeSOD) | GAACTGAAGCCTCCTCCATA | CTCTATCTGTCTGTTAAGGTTGTC |
D88649 (cytAPX) | GCAAGGATTCCAAGACTG | GTAACCTCAACAGCAACAA |
XM_004146902 (chlGR) | TAGTGCTGTTCCTTGTGCTGTT | GCCGAAAGTTTGCTGTGTAGATG |
AJ715498 (-TUB) | GCACTGGTCTTCAAGGAT | GTAAGGCTCAACGACAGA |
AY372537.1 (UBI-ep) | ACCTTGTGCTCCGTCTCAG | CCTTCTTGTGCTTGTGCTTGAT |
References
- Baxter, A.; Mittler, R.; Suzuki, N. ROS as key players in plant stress signalling. J. Exp. Bot. 2014, 65, 1229–1240. [Google Scholar] [CrossRef] [PubMed]
- Noctor, G. Metabolic signalling in defence and stress: The central roles of soluble redox couples. Plant Cell Environ. 2006, 29, 409–425. [Google Scholar] [CrossRef] [PubMed]
- Foyer, C.H.; Noctor, G. Redox regulation in photosynthetic organisms. Antioxid. Redox Signal. 2009, 11, 861–905. [Google Scholar] [CrossRef] [PubMed]
- Vaahtera, L.; Brosché, M.; Wrzaczek, M.; Kangasjärvi, J. Specificity in ROS signaling and transcript signatures. Antioxid. Redox Signal. 2014, 21, 1422–1441. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Camejo, D.; Guzmán-Cedeño, Á.; Moreno, A. Reactive oxygen species, essential molecules, during plant-pathogen interactions. Plant Physiol. Biochem. 2016, 103, 10–23. [Google Scholar] [CrossRef] [PubMed]
- Chojak-Koźniewska, J.; Linkiewicz, A.; Sowa, S.; Radzioch, M.A.; Kuźniak, E. Interactive effects of salt stress and Pseudomonas syringae pv. lachrymans infection in cucumber: Involvement of antioxidant enzymes, abscisic acid and salicylic acid. Environ. Exp. Bot. 2017, 136, 9–20. [Google Scholar] [CrossRef]
- Kuźniak, E.; Kornas, A.; Gabara, B.; Ullrich, C.; Skłodowska, M.; Miszalski, Z. Interaction of Botrytis cinerea with the intermediate C3-CAM plant Mesembryanthemum crystallinum. Environ. Exp. Bot. 2010, 69, 137–147. [Google Scholar] [CrossRef]
- Petrov, V.D.; Van Breusegem, F. Hydrogen peroxide-a central hub for information flow in plant cells. AoB Plants 2012, 12, 1–13. [Google Scholar] [CrossRef] [Green Version]
- Saxena, I.; Srikanth, S.; Chen, Z. Cross talk between H2O2 and interacting signal molecules under plant stress response. Front. Plant. Sci. 2016, 7, 570. [Google Scholar] [CrossRef] [Green Version]
- Kuźniak, E.; Kopczewski, T.; Chojak-Koźniewska, J. Ascorbate-glutathione cycle and biotic stress tolerance in plants. In Ascorbic Acid in Plant Growth, Development and Stress Tolerance; Hossain, M.A., Munné-Bosch, S., Burritt, D.J., Diaz-Vivancos, P., Fujita, M., Lorence, A., Eds.; Springer International Publishing: Cham, Switzerland, 2017; pp. 201–231. ISBN 978-3-319-74057-7. [Google Scholar]
- Libik-Konieczny, M.; Kuźniak, E.; Surówka, E.; Ślesak, I.; Michał, N.; Miszalski, Z. Crassulacean acid metabolism and its role in plant acclimatization to abiotic stresses and defence against pathogens. In Progress in Botany Vol. 81; Cánovas, F.M., Lüttge, U., Leuschner, C., Risueño, M.-C., Eds.; Springer International Publishing: Cham, Switzerland, 2020; pp. 277–306. ISBN 978-3-030-36327-7. [Google Scholar]
- Kuźniak, E.; Sklodowska, M. The effect of Botrytis cinerea infection on ascorbate-glutathione cycle in tomato leaves. Plant. Sci. 1999, 148, 69–76. [Google Scholar] [CrossRef]
- Pandey, P.; Singh, J.; Achary, V.M.M.; Mallireddy Reddy, K. Redox homeostasis via gene families of ascorbate-glutathione pathway. Front. Environ. Sci. 2015, 3, 25. [Google Scholar] [CrossRef] [Green Version]
- Kuźniak, E.; Skłodowska, M. Compartment-specific role of the ascorbate-glutathione cycle in the response of tomato leaf cells to Botrytis cinerea infection. J. Exp. Bot. 2005, 56, 921–933. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Großkinsky, D.K.; Koffler, B.E.; Roitsch, T.; Maier, R.; Zechmann, B. Compartment-specific antioxidative defense in Arabidopsis against virulent and avirulent Pseudomonas syringae. Phytopathology 2012, 102, 662–673. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Sewelam, N.; Jaspert, N.; Van Der Kelen, K.; Tognetti, V.B.; Schmitz, J.; Frerigmann, H.; Stahl, E.; Zeier, J.; Van Breusegem, F.; Maurino, V.G. Spatial H2O2 signaling specificity: H2O2 from chloroplasts and peroxisomes modulates the plant transcriptome differentially. Mol. Plant. 2014, 7, 1191–1210. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Noctor, G.; Foyer, C.H. Intracellular redox compartmentation and ROS-related communication in regulation and signaling. Plant Physiol. 2016, 171, 1581–1592. [Google Scholar] [CrossRef] [Green Version]
- Stael, S.; Kmiecik, P.; Willems, P.; Van Der Kelen, K.; Coll, N.S.; Teige, M.; Van Breusegem, F. Plant innate immunity—Sunny side up? Trends Plant Sci. 2016, 20, 3–11. [Google Scholar] [CrossRef] [Green Version]
- Berger, S.; Sinha, A.K.; Roitsch, T. Plant physiology meets phytopathology: Plant primary metabolism and plant-pathogen interactions. J. Exp. Bot. 2007, 58, 4019–4026. [Google Scholar] [CrossRef]
- Ishiga, Y.; Uppalapati, S.R.; Ishiga, T.; Elavarthi, S.; Martin, B.; Bender, C.L. The phytotoxin coronatine induces light-dependent reactive oxygen species in tomato seedlings. New Phytol. 2009, 181, 147–160. [Google Scholar] [CrossRef]
- Shapiguzov, A.; Vainonen, J.P.; Wrzaczek, M.; Kangasjärvi, J. ROS-talk-how the apoplast, the chloroplast, and the nucleus get the message through. Front. Plant. Sci. 2012, 3, 292. [Google Scholar] [CrossRef] [Green Version]
- Göhre, V.; Jones, A.M.E.; Sklenář, J.; Robatzek, S.; Weber, A.P.M. Molecular crosstalk between PAMP-triggered immunity and photosynthesis. Mol. Plant.-Microbe Interact. 2012, 25, 1083–1092. [Google Scholar] [CrossRef]
- Caplan, J.L.; Kumar, A.S.; Park, E.; Padmanabhan, M.S.; Hoban, K.; Modla, S.; Czymmek, K.; Dinesh-Kumar, S.P. Chloroplast stromules function during innate immunity. Dev. Cell 2015, 34, 45–57. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Bobik, K.; Burch-Smith, T.M. Chloroplast signaling within, between and beyond cells. Front. Plant. Sci. 2015, 6, 781. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Sowden, R.G.; Watson, S.J.; Jarvis, P. The role of chloroplasts in plant pathology. Essays Biochem. 2018, 62, 21–39. [Google Scholar] [CrossRef] [PubMed]
- Trotta, A.; Rahikainen, M.; Konert, G.; Finazzi, G.; Kangasjärvi, S. Signalling crosstalk in light stress and immune reactions in plants. Philos. Trans. R. Soc. B Biol. Sci. 2014, 369, 20130235. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Unal, D.; García-Caparrós, P.; Kumar, V.; Dietz, K.-J. Chloroplast-associated molecular patterns as concept for fine-tuned operational retrograde signalling. Philos. Trans. R. Soc. B Biol. Sci. 2020, 375, 20190443. [Google Scholar] [CrossRef]
- Nomura, H.; Komori, T.; Uemura, S.; Kanda, Y.; Shimotani, K.; Nakai, K.; Furuichi, T.; Takebayashi, K.; Sugimoto, T.; Sano, S.; et al. Chloroplast-mediated activation of plant immune signalling in Arabidopsis. Nat. Commun. 2012, 3. [Google Scholar] [CrossRef] [Green Version]
- Fobert, P.R.; Després, C. Redox control of systemic acquired resistance. Curr. Opin. Plant. Biol. 2005, 8, 378–382. [Google Scholar] [CrossRef]
- Park, E.; Nedo, A.; Caplan, J.L.; Dinesh-Kumar, S.P. Plant–microbe interactions: Organelles and the cytoskeleton in action. New Phytol. 2018, 217, 1012–1028. [Google Scholar] [CrossRef] [Green Version]
- Xu, Q.; Tang, C.; Wang, X.; Sun, S.; Zhao, J.; Kang, Z.; Wang, X. An effector protein of the wheat stripe rust fungus targets chloroplasts and suppresses chloroplast function. Nat. Commun. 2019, 10. [Google Scholar] [CrossRef] [Green Version]
- Schwachtje, J.; Whitcomb, S.J.; Firmino, A.A.P.; Zuther, E.; Hincha, D.K.; Kopka, J. Induced, imprinted, and primed responses to changing environments: Does metabolism store and process information? Front. Plant. Sci. 2019, 10, 106. [Google Scholar] [CrossRef]
- Foyer, C.H.; Noctor, G. Redox homeostasis and antioxidant signaling: A metabolic interface between stress perception and physiological responses. Plant Cell 2005, 17, 1866–1875. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Zandalinas, S.I.; Mittler, R. ROS-induced ROS release in plant and animal cells. Free Radic. Biol. Med. 2018, 122, 21–27. [Google Scholar] [CrossRef] [PubMed]
- Potters, G.; Horemans, N.; Jansen, M.A.K. The cellular redox state in plant stress biology-A charging concept. Plant Physiol. Biochem. 2010, 48, 292–300. [Google Scholar] [CrossRef]
- Słomnicka, R.; Olczak-Woltman, H.; Bartoszewski, G.; Niemirowicz-Szczytt, K. Genetic and pathogenic diversity of Pseudomonas syringae strains isolated from cucurbits. Eur. J. Plant. Pathol. 2014, 141, 1–14. [Google Scholar] [CrossRef] [Green Version]
- Sekulska-Nalewajko, J.; Kornaś, A.; Gocławski, J.; Miszalski, Z.; Kuźniak, E. Spatial referencing of chlorophyll fluorescence images for quantitative assessment of infection propagation in leaves demonstrated on the ice plant: Botrytis cinerea pathosystem. Plant. Methods 2019, 15, 18. [Google Scholar] [CrossRef] [Green Version]
- Gabara, B.; Kuźniak, E.; Skłodowska, M.; Surówka, E.; Miszalski, Z. Ultrastructural and metabolic modifications at the plant-pathogen interface in Mesembryanthemum crystallinum leaves infected by Botrytis cinerea. Environ. Exp. Bot. 2012, 77. [Google Scholar] [CrossRef]
- Strange, R.N. Phytotoxins produced by microbial plant pathogens. Nat. Prod. Rep. 2007, 24, 127–144. [Google Scholar] [CrossRef]
- Bilgin, D.D.; Zavala, J.; Zhu, J.; Clough, S.J.; Ort, D.R.; DeLucia, E.H. Biotic stress globally downregulates photosynthesis genes. Plant Cell Environ. 2010, 33, 1597–1613. [Google Scholar] [CrossRef] [Green Version]
- Garavaglia, B.S.; Thomas, L.; Gottig, N.; Dunger, G.; Garofalo, C.G.; Daurelio, L.D.; Ndimba, B.; Orellano, E.G.; Gehring, C.; Ottado, J. A eukaryotic-acquired gene by a biotrophic phytopathogen allows prolonged survival on the host by counteracting the shut-down of plant photosynthesis. PLoS ONE 2010, 5, e8950. [Google Scholar] [CrossRef] [Green Version]
- Scharte, J.; Schön, H.; Weis, E. Photosynthesis and carbohydrate metabolism in tobacco leaves during an incompatible interaction with Phytophthora nicotianae. Plant Cell Environ. 2005, 28, 1421–1435. [Google Scholar] [CrossRef]
- Haigh, G.R.; Carver, T.L.W.; Gay, A.P.; Farrar, J.F. Respiration and photosynthesis in oats exhibiting different levels of partial resistance to Erysiphe graminis D.c. ex Merat f. sp. avenae Marchal. New Phytol. 1991, 119, 129–136. [Google Scholar] [CrossRef]
- Häffner, E.; Konietzki, S.; Diederichsen, E. Keeping control: The role of senescence and development in plant pathogenesis and defense. Plants 2015, 4, 449–488. [Google Scholar] [CrossRef] [PubMed]
- Biemelt, S.; Sonnewald, U. Plant-microbe interactions to probe regulation of plant carbon metabolism. J. Plant Physiol. 2006, 163, 307–318. [Google Scholar] [CrossRef] [PubMed]
- Swarbrick, P.J.; Schulze-Lefert, P.; Scholes, J.D. Metabolic consequences of susceptibility and resistance (race-specific and broad-spectrum) in barley leaves challenged with powdery mildew. Plant Cell Environ. 2006, 29, 1061–1076. [Google Scholar] [CrossRef]
- Gilroy, S.; Białasek, M.; Suzuki, N.; Górecka, M.; Devireddy, A.R.; Karpiński, S.; Mittler, R. ROS, calcium, and electric signals: Key mediators of rapid systemic signaling in plants. Plant Physiol. 2016, 171, 1606–1615. [Google Scholar] [CrossRef]
- Hideg, É.; Kós, P.B.; Schreiber, U. Imaging of NPQ and ROS formation in tobacco leaves: Heat inactivation of the water-water cycle prevents down-regulation of PSII. Plant Cell Physiol. 2008, 49, 1879–1886. [Google Scholar] [CrossRef] [Green Version]
- Zhou, J.; Zeng, L.; Liu, J.; Xing, D. Manipulation of the xanthophyll cycle increases plant susceptibility to Sclerotinia sclerotiorum. PLoS Pathog. 2015, 11, 1–25. [Google Scholar] [CrossRef] [Green Version]
- Bonfig, K.B.; Schreiber, U.; Gabler, A.; Roitsch, T.; Berger, S. Infection with virulent and avirulent P. syringae strains differentially affects photosynthesis and sink metabolism in Arabidopsis leaves. Planta 2006, 225, 1–12. [Google Scholar] [CrossRef]
- de Torres Zabala, M.; Littlejohn, G.; Jayaraman, S.; Studholme, D.; Bailey, T.; Lawson, T.; Tillich, M.; Licht, D.; Bölter, B.; Delfino, L.; et al. Chloroplasts play a central role in plant defence and are targeted by pathogen effectors. Nat. Plants 2015, 1, 15074. [Google Scholar] [CrossRef]
- Karpiński, S.; Szechyńska-Hebda, M.; Wituszyńska, W.; Burdiak, P. Light acclimation, retrograde signalling, cell death and immune defences in plants. Plant Cell Environ. 2013, 36, 736–744. [Google Scholar] [CrossRef]
- Davletova, S. Cytosolic ascorbate peroxidase 1 is a central component of the reactive oxygen gene network of Arabidopsis. Plant Cell 2005, 17, 268–281. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Baier, M.; Dietz, K.J. Chloroplasts as source and target of cellular redox regulation: A discussion on chloroplast redox signals in the context of plant physiology. J. Exp. Bot. 2005, 56, 1449–1462. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Das, K.; Roychoudhury, A. Reactive oxygen species (ROS) and response of antioxidants as ROS-scavengers during environmental stress in plants. Front. Environ. Sci. 2014, 2, 53. [Google Scholar] [CrossRef] [Green Version]
- Gadjev, I.; Vanderauwera, S.; Gechev, T.S.; Laloi, C.; Minkov, I.N.; Shulaev, V.; Apel, K.; Inzé, D.; Mittler, R.; Van Breusegem, F. Transcriptomic footprints disclose specificity of reactive oxygen species signaling in Arabidopsis. Plant Physiol. 2006, 141, 436–445. [Google Scholar] [CrossRef] [Green Version]
- Schmidt, A.; Mächtel, R.; Ammon, A.; Engelsdorf, T.; Schmitz, J.; Maurino, V.G.; Voll, L.M. Reactive oxygen species dosage in Arabidopsis chloroplasts can improve resistance towards Colletotrichum higginsianum by the induction of WRKY33. New Phytol. 2020, 226, 189–204. [Google Scholar] [CrossRef] [Green Version]
- Zurbriggen, M.D.; Carrillo, N.; Tognetti, V.B.; Melzer, M.; Peisker, M.; Hause, B.; Hajirezaei, M.R. Chloroplast-generated reactive oxygen species play a major role in localized cell death during the non-host interaction between tobacco and Xanthomonas campestris pv. vesicatoria. Plant. J. 2009, 60, 962–973. [Google Scholar] [CrossRef]
- Munné-Bosch, S.; Queval, G.; Foyer, C.H. The impact of global change factors on redox signaling underpinning stress tolerance. Plant Physiol. 2013, 161, 5–19. [Google Scholar] [CrossRef] [Green Version]
- Cela, J.; Tweed, J.K.S.; Sivakumaran, A.; Lee, M.R.F.; Mur, L.A.J.; Munné-Bosch, S. An altered tocopherol composition in chloroplasts reduces plant resistance to Botrytis cinerea. Plant Physiol. Biochem. 2018, 127, 200–210. [Google Scholar] [CrossRef] [Green Version]
- Munné-Bosch, S. The role of α-tocopherol in plant stress tolerance. J. Plant Physiol. 2005, 162, 743–748. [Google Scholar] [CrossRef]
- Szarka, A.; Tomasskovics, B.; Bánhegyi, G. The ascorbate-glutathione-α-tocopherol triad in abiotic stress response. Int. J. Mol. Sci. 2012, 13, 4458–4483. [Google Scholar] [CrossRef] [Green Version]
- Yabuta, Y.; Mieda, T.; Rapolu, M.; Nakamura, A.; Motoki, T.; Maruta, T.; Yoshimura, K.; Ishikawa, T.; Shigeoka, S. Light regulation of ascorbate biosynthesis is dependent on the photosynthetic electron transport chain but independent of sugars in Arabidopsis. J. Exp. Bot. 2007, 58, 2661–2671. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Foyer, C.H.; Noctor, G. Ascorbate and glutathione: The heart of the redox hub. Plant Physiol. 2011, 155, 2–18. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Demmig-Adams, B.; Adams, W. 3rd Harvesting sunlight safely. Nature 2000, 403, 371–374. [Google Scholar] [CrossRef] [PubMed]
- Hilleary, R.; Gilroy, S. Systemic signaling in response to wounding and pathogens. Curr. Opin. Plant. Biol. 2018, 43, 57–62. [Google Scholar] [CrossRef]
- Szechyńska-Hebda, M.; Kruk, J.; Górecka, M.; Karpińska, B.; Karpiński, S. Evidence for light wavelength-specific photoelectrophysiological signaling and memory of excess light episodes in Arabidopsis. Plant Cell 2010, 22, 2201–2218. [Google Scholar] [CrossRef] [Green Version]
- Suzuki, N.; Miller, G.; Salazar, C.; Mondal, H.A.; Shulaev, E.; Cortes, D.F.; Shuman, J.L.; Luo, X.; Shah, J.; Schlauch, K.; et al. Temporal-spatial interaction between reactive oxygen species and abscisic acid regulates rapid systemic acclimation in plants. Plant Cell 2013, 25, 3553–3569. [Google Scholar] [CrossRef] [Green Version]
- Mhamdi, A.; Mauve, C.; Gouia, H.; Saindrenan, P.; Hodges, M.; Noctor, G. Cytosolic NADP-dependent isocitrate dehydrogenase contributes to redox homeostasis and the regulation of pathogen responses in Arabidopsis leaves. Plant Cell Environ. 2010, 33, 1112–1123. [Google Scholar] [CrossRef]
- Zechmann, B.; Stumpe, M.; Mauch, F. Immunocytochemical determination of the subcellular distribution of ascorbate in plants. Planta 2011, 233, 1–12. [Google Scholar] [CrossRef] [Green Version]
- Noctor, G.; Mhamdi, A.; Chaouch, S.; Han, Y.; Neukermans, J.; Marquez-Garcia, B.; Queval, G.; Foyer, C.H. Glutathione in plants: An integrated overview. Plant Cell Environ. 2012, 35, 454–484. [Google Scholar] [CrossRef]
- Van Breusegem, F.; Bailey-Serres, J.; Mittler, R. Unraveling the tapestry of networks involving reactive oxygen species in plants. Plant Physiol. 2008, 147, 978–984. [Google Scholar] [CrossRef] [Green Version]
- Irihimovitch, V.; Shapira, M. Glutathione redox potential modulated by reactive oxygen species regulates translation of Rubisco large subunit in the chloroplast. J. Biol. Chem. 2000, 275, 16289–16295. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- van Butselaar, T.; Van den Ackerveken, G. Salicylic acid steers the growth–immunity tradeoff. Trends Plant Sci. 2020, 1–11. [Google Scholar] [CrossRef] [PubMed]
- Schwachtje, J.; Fischer, A.; Erban, A.; Kopka, J. Primed primary metabolism in systemic leaves: A functional systems analysis. Sci. Rep. 2018, 8, 216. [Google Scholar] [CrossRef] [PubMed]
- Nosek, M.; Kornaś, A.; Kuźniak, E.; Miszalski, Z. Plastoquinone redox state modifies plant response to pathogen. Plant Physiol. Biochem. 2015, 96, 163–170. [Google Scholar] [CrossRef] [PubMed]
- Heber, U.; Santarius, K.A. Direct and indirect transfer of ATP and ADP across the chloroplast envelope. Z. Nat. Sect. B 1970, 25b, 718–728. [Google Scholar] [CrossRef] [Green Version]
- López-Millán, A.F.; Morales, F.; Abadía, A.; Abadía, J. Changes induced by Fe deficiency and Fe resupply in the organic acid metabolism of sugar beet (Beta vulgaris) leaves. Physiol. Plant. 2001, 112, 31–38. [Google Scholar] [CrossRef] [Green Version]
- Hatch, M.D. A simple spectrophotometric assay for fumarate hydratase in crude tissue extracts. Anal. Biochem. 1978, 85, 271–275. [Google Scholar] [CrossRef]
- Dhindsa, R.S.; Plumb-Dhindsa, P.; Thorpe, T.A. Leaf senescence: Correlated with increased levels of membrane permeability and lipid peroxidation, and decreased levels of superoxide dismutase and catalase. J. Exp. Bot. 1981, 32, 93–101. [Google Scholar] [CrossRef]
- Beauchamp, C.; Fridovich, I. Superoxide dismutase: Improved assays and an assay applicable to acrylamide gels. Anal. Biochem. 1971, 44, 276–287. [Google Scholar] [CrossRef]
- Lee, D.H.; Lee, C.B. Chilling stress-induced changes of antioxidant enzymes in the leaves of cucumber: In gel enzyme activity assays. Plant Sci. 2000, 159, 75–85. [Google Scholar] [CrossRef]
- Bradford, M.M. A rapid and sensitive method for the quantitation of microgram quantities of protein utilizing the principle of protein-dye binding. Anal. Biochem. 1976, 72, 248–254. [Google Scholar] [CrossRef]
- Kampfenkel, K.; Van Montagu, M.; Inzé, D. Extraction and determination of ascorbate and dehydroascorbate from plant tissue. Anal. Biochem. 1995, 225, 165–167. [Google Scholar] [CrossRef] [PubMed]
- Brehe, J.E.; Burch, H.B. Enzymatic assay for glutathione. Anal. Biochem. 1976, 74, 189–197. [Google Scholar] [CrossRef]
- Szczepaniak, L.; Walejko, P.; Isidorov, V.A. Gas Chromatographic and Mass Spectrometric Characterization of Trimethylsilyl Derivatives of Some Terpene Alcohol Phenylpropenoids. Anal. Sci. 2013, 29, 643–647. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Van den Dool, H.; Kratz, P.D. A generalization of the retention index system including linear temperature programmed gas–liquid partition chromatography. J. Chromatogr. A 1963, 11, 463–471. [Google Scholar] [CrossRef]
Time after Inoculation [days] | 0 | 2 | 7 | |||||||
---|---|---|---|---|---|---|---|---|---|---|
Tocopherol | L3 | L5 | L3 | L3 + Psl | L5 | L5 + Psl | L3 | L3 + Psl | L5 | L5 + Psl |
α-tocopherol | 208.9 ± 53.9 (a) | 115.1 ± 69.5 (a) | 94.2 ± 10.9 (b) | 199.4 ± 15.4 (a) | 101.7 ± 25.3 (b) | 138.3 ± 41.5 (ab) | 222.5 ± 17.4 (b) | 152.0 ± 1.1 (c) | 373.7 ± 86.1 (a) | 100.6 ± 11.2 (d) |
ɣ-tocopherol | 147.5 ± 48.8 (a) | 17.9 ± 8.6 (b) | 50.2 ± 5.6 (b) | 171.9 ± 12.8 (a) | 23.2 ± 7.6 (c) | 18.9 ± 1.1 (c) | 205.0 ± 14.0 (a) | 165.7 ± 18.8 (b) | 100.2 ± 28.9 (b) | 14.6 ± 8.5 (c) |
δ-tocopherol | 13.7 ± 4.0 (a) | - | 8.2 ± 4.0 (b) | 33.0 ± 10.2 (a) | - | 2.8 ± 1.2 (b) | 59.3 ± 3.8 (a) | 66.4 ± 3.1 (a) | 2.8 ± 4.0 (b) | - |
Total | 370.1 ± 27.5 (a) | 133.0 ± 31.8 (b) | 152.6 ± 6.1 (b) | 404.3 ± 11.8 (a) | 124.9 ± 10.7 (b) | 160.0 ± 18.6 (b) | 486.8 ± 10.9 (a) | 384.1 ± 12.7 (b) | 476.7 ± 74.3 (a) | 115.2 ± 9.7 (c) |
© 2020 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (http://creativecommons.org/licenses/by/4.0/).
Share and Cite
Kopczewski, T.; Kuźniak, E.; Kornaś, A.; Rut, G.; Nosek, M.; Ciereszko, I.; Szczepaniak, L. Local and Systemic Changes in Photosynthetic Parameters and Antioxidant Activity in Cucumber Challenged with Pseudomonas syringae pv lachrymans. Int. J. Mol. Sci. 2020, 21, 6378. https://doi.org/10.3390/ijms21176378
Kopczewski T, Kuźniak E, Kornaś A, Rut G, Nosek M, Ciereszko I, Szczepaniak L. Local and Systemic Changes in Photosynthetic Parameters and Antioxidant Activity in Cucumber Challenged with Pseudomonas syringae pv lachrymans. International Journal of Molecular Sciences. 2020; 21(17):6378. https://doi.org/10.3390/ijms21176378
Chicago/Turabian StyleKopczewski, Tomasz, Elżbieta Kuźniak, Andrzej Kornaś, Grzegorz Rut, Michał Nosek, Iwona Ciereszko, and Lech Szczepaniak. 2020. "Local and Systemic Changes in Photosynthetic Parameters and Antioxidant Activity in Cucumber Challenged with Pseudomonas syringae pv lachrymans" International Journal of Molecular Sciences 21, no. 17: 6378. https://doi.org/10.3390/ijms21176378