The Cell-Free Expression of MiR200 Family Members Correlates with Estrogen Sensitivity in Human Epithelial Ovarian Cells
Abstract
:1. Introduction
2. Results
2.1. Estradiol, Zearalenone and Bisphenol A Induce Comparable Phenotypic Changes in Ovarian Cells
2.2. Estradiol, Zearalenone and Bisphenol A Induce Comparable Changes in Gene Expression
2.3. Estradiol, Zearalenone and Bisphenol A Alter the Expression of MiR200s and MiR203a in a Time-Dependent Manner in ERα-Expressing Cells
2.4. Cell-Free MiRNA Expression Correlates Well with Intracellular MiRNA Expression
2.5. ERα is Involved in the Regulation of MiR200s and MiR203a Expression
3. Discussion
4. Materials and Methods
4.1. Culturing Conditions
4.2. Migration Assay
4.3. Apoptosis Assay
4.4. Determination of Cytotoxicity
4.5. Co-Culture Assay
4.6. MRNA Isolation and Quantification
4.7. Intracellular and Cell-Free MiRNA Isolation and Quantification
4.8. Analysis of Chip-Seq Data
4.9. Statistical Analysis
5. Conclusions
Supplementary Materials
Author Contributions
Funding
Acknowledgments
Conflicts of Interest
Abbreviations
E2 | Estradiol |
ZEA | Zearalenone |
BPA | Bisphenol A |
ER | Estrogen receptor |
EMT | Epithelial to mesenchymal transition |
MiRNA | microRNA |
MPP | methyl-piperidino-pyrazole |
Chip-seq | Chrompatin immunoprecipitation followed by sequencing |
References
- Siegel, R.L.; Miller, K.D.; Jemal, A. Cancer statistics, 2018. Cancer J. Clin. 2018, 68, 7–30. [Google Scholar] [CrossRef] [PubMed]
- Mungenast, F.; Thalhammer, T. Estrogen biosynthesis and action in ovarian cancer. Front. Endocrinol. 2014, 5, 192. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Yager, J.D.; Davidson, N.E. Estrogen carcinogenesis in breast cancer. N. Engl. J. Med. 2006, 354, 270–282. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Greiser, C.M.; Greiser, E.M.; Dören, M. Menopausal hormone therapy and risk of ovarian cancer: Systematic review and meta-analysis. Hum. Reprod. Update 2007, 13, 453–463. [Google Scholar] [CrossRef] [Green Version]
- Tomao, F.; Russo, G.L.; Spinelli, G.P.; Stati, V.; Prete, A.A.; Prinzi, N.; Sinjari, M.; Vici, P.; Papa, A.; Chiotti, M.S.; et al. Fertility drugs, reproductive strategies and ovarian cancer risk. J. Ovarian Res. 2014, 7, 51. [Google Scholar] [CrossRef] [Green Version]
- Balendres, M.A.O.; Karlovsky, P.; Cumagun, C.J.R. Mycotoxigenic fungi and mycotoxins in agricultural crop commodities in the philippines: A review. Foods 2019, 8, 249. [Google Scholar] [CrossRef] [Green Version]
- Metzler, M.; Pfeiffer, E.; Hildebrand, A. Zearalenone and its metabolites as endocrine disrupting chemicals. World Mycotoxin J. 2010, 3, 385–401. [Google Scholar] [CrossRef]
- Munkvold, G.P. Fusarium Species and Their Associated Mycotoxins. In Mycotoxigenic Fungi; Humana Press: New York, NY, USA, 2017; Volume 1542, pp. 51–106. [Google Scholar]
- Gao, H.; Yang, B.J.; Li, N.; Feng, L.M.; Shi, X.Y.; Zhao, W.H.; Liu, S.J. Bisphenol A and hormone-associated cancers: Current progress and perspectives. Medicine 2015, 94, e211. [Google Scholar] [CrossRef]
- LaMerrill, M.A.; Vandenberg, L.N.; Smith, M.T.; Goodson, W.; Browne, P.; Patisaul, H.B.; Guyton, K.Z.; Kortenkamp, A.; Cogliano, V.J.; Woodruff, T.J.; et al. Consensus on the key characteristics of endocrine-disrupting chemicals as a basis for hazard identification. Nat. Rev. Endocrinol. 2020, 16, 45–57. [Google Scholar] [CrossRef] [Green Version]
- Rai, A.; Das, M.; Tripathi, A. Occurrence and toxicity of a fusarium mycotoxin, zearalenone. Crit. Rev. Food Sci. Nutr. 2019, 26, 1–20. [Google Scholar] [CrossRef]
- Kowalska, K.; Górczyńska, D.E.H.; Ciesielska, A.W.P. Zearalenone as an endocrine disruptor in humans. Environ. Toxicol. Pharmacol. 2016, 48, 141–149. [Google Scholar] [CrossRef] [PubMed]
- Zhang, G.L.; Feng, Y.L.; Song, J.L.; Zhou, X.S. Zearalenone: A mycotoxin with different toxic effect in domestic and laboratory animals’ granulosa cells. Front. Genet. 2018, 9, 667. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Yeung, K.T.; Yang, J. Epithelial-mesenchymal transition in tumor metastasis. Mol. Oncol. 2017, 11, 28–39. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Hewitt, S.C.; Korach, K.S. Estrogen receptors: New directions in the new millennium. Endocr. Rev. 2018, 39, 664–675. [Google Scholar] [CrossRef] [Green Version]
- Voutsadakis, I.A. Hormone receptors in serous ovarian carcinoma: Prognosis, pathogenesis, and treatment considerations. Clin. Med. Insights Oncol. 2016, 10, 17–25. [Google Scholar] [CrossRef] [Green Version]
- Langdon, S.P.; Herrington, C.S.; Hollis, R.L.; Gourley, C. Estrogen signaling and its potential as a target for therapy in ovarian cancer. Cancers 2020, 12, 1647. [Google Scholar] [CrossRef]
- Pinton, G.; Nilsson, S.; Moro, L. Targeting estrogen receptor beta (ERβ) for treatment of ovarian cancer: Importance of KDM6B and SIRT1 for ERβ expression and functionality. Oncogenesis 2018, 7, 1–11. [Google Scholar] [CrossRef]
- Chen, X.; Uzuner, U.; Li, M.; Shi, W.; Yuan, J.S.; Dai, S.Y. Phytoestrogens and mycoestrogens induce signature structure dynamics changes on estrogen receptor α. Int. J. Environ. Res. Public Health 2016, 13, 869. [Google Scholar] [CrossRef] [Green Version]
- Klinge, C.M. miRNAs regulated by estrogens, tamoxifen, and endocrine disruptors and their downstream gene targets. Mol. Cell. Endocrinol. 2015, 418, 273–297. [Google Scholar] [CrossRef] [Green Version]
- Larrea, E.; Sole, C.; Manterola, L.; Goicoechea, I.; Armesto, M.; Arestin, M.; Caffarel, M.M.; Araujo, A.M.; Araiz, M.; Mercado, M.F.; et al. New concepts in cancer biomarkers: Circulating miRNAs in liquid biopsies. Int. J. Mol. Sci. 2016, 17, 627. [Google Scholar] [CrossRef] [Green Version]
- Bayraktar, R.; Van Roosbroeck, K.; Calin, G.A. Cell-to-cell communication: MicroRNAs as hormones. Mol. Oncol. 2017, 11, 1673–1686. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Zhao, C.; Sun, X.; Li, L. Biogenesis and function of extracellular miRNAs. ExRNA 2019, 1, 1–9. [Google Scholar] [CrossRef] [Green Version]
- Márton, É.; Lukács, J.; Penyige, A.; Janka, E.; Hegedüs, L.; Soltész, B.; Méhes, G.; Póka, R.; Nagy, B.; Szilágyi, M. Circulating epithelial-mesenchymal transition-associated miRNAs are promising biomarkers in ovarian cancer. J. Biotechnol. 2019, 297, 58–65. [Google Scholar] [CrossRef] [PubMed]
- Penyige, A.; Márton, É.; Soltész, B.; Szilágyi, B.M.; Póka, R.; Lukács, J.; Széles, L.; Nagy, B. Circulating mirna profiling in plasma samples of ovarian cancer patients. Int. J. Mol. Sci. 2019, 20, 4533. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- O’Donnell, A.J.; Macleod, K.G.; Burns, D.J.; Smyth, J.F.; Langdon, S.P. Estrogen receptor-α mediates gene expression changes and growth response in ovarian cancer cells exposed to estrogen. Endocr. Relat. Cancer 2005, 12, 851–866. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Andersen, C.L.; Sikora, M.J.; Boisen, M.M.; Ma, T.; Christie, A.; Tseng, G.; Park, Y.; Luthra, S.; Chandran, U.; Haluska, P.; et al. Active estrogen receptor-alpha signaling in ovarian cancer models and clinical specimens. Clin. Cancer Res. 2017, 23, 3802–3812. [Google Scholar] [CrossRef] [Green Version]
- Rae, J.M.; Johnson, M.D.; Scheys, J.O.; Cordero, K.E.; Larios, J.M.; Lippman, M.E. GREB1 is a critical regulator of hormone dependent breast cancer growth. Breast Cancer Res. Treat. 2005, 92, 141–149. [Google Scholar] [CrossRef]
- Cuesta, R.; Gritsenko, M.A.; Petyuk, V.A.; Shukla, A.K.; Tsai, C.F.; Liu, T.; McDermott, J.E.; Holz, M.K. Phosphoproteome analysis reveals estrogen-ER pathway as a modulator of mTOR activity via DEPTOR. Mol. Cell. Proteom. 2019, 18, 1607–1618. [Google Scholar] [CrossRef]
- Barnett, D.H.; Sheng, S.; Charn, T.H.; Waheed, A.; Sly, W.S.; Lin, C.Y.; Liu, E.T.; Katzenellenbogen, B.S. Estrogen receptor regulation of carbonic anhydrase XII through a distal enhancer in breast cancer. Cancer Res. 2008, 68, 3505–3515. [Google Scholar] [CrossRef] [Green Version]
- Bretones, I.S.; Sáez, C.; Borrego, M.R.; Japón, M.A.; Huertas, P. Prognostic value of Ct IP/RBBP 8 expression in breast cancer. Cancer Med. 2013, 2, 774–783. [Google Scholar] [CrossRef] [Green Version]
- Hodgkinson, K.; Forrest, L.A.; Vuong, N.; Garson, K.; Djordjevic, B.; Vanderhyden, B.C. GREB1 is an estrogen receptor-regulated tumour promoter that is frequently expressed in ovarian cancer. Oncogene 2018, 37, 5873–5886. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Foster, H.; Coley, H.M.; Goumenou, A.; Pados, G.; Harvey, A.; Karteris, E. Differential expression of mTOR signalling components in drug resistance in ovarian cancer. Anticancer. Res. 2010, 30, 3529–3534. [Google Scholar] [PubMed]
- Hynninen, P.; Vaskivuo, L.; Saarnio, J.; Haapasalo, H.; Kivelä, J.; Pastorekova, S.; Pastorek, J.; Waheed, A.; Sly, W.S.; Puistola, U.; et al. Expression of transmembrane carbonic anhydrases IX and XII in ovarian tumours. Histopathology 2006, 49, 594–602. [Google Scholar] [CrossRef] [PubMed]
- Petrova, Y.I.; Schecterson, L.; Gumbiner, B.M. Roles for E-cadherin cell surface regulation in cancer. Mol. Biol. Cell 2016, 27, 3233–3244. [Google Scholar] [CrossRef]
- Koutsaki, M.; Spandidos, D.A.; Zaravinos, A. Epithelial–mesenchymal transition-associated miRNAs in ovarian carcinoma, with highlight on the miR-200 family: Prognostic value and prospective role in ovarian cancer therapeutics. Cancer Lett. 2014, 351, 173–181. [Google Scholar] [CrossRef]
- Slabáková, E.; Culig, Z.; Remšík, J.; Souček, K. Alternative mechanisms of miR-34a regulation in cancer. Cell Death Dis. 2017, 8, e3100. [Google Scholar] [CrossRef]
- Zhao, G.; Guo, Y.; Chen, Z.; Wang, Y.; Yang, C.; Dudas, A.; Du, Z.; Liu, W.; Zou, Y.; Szabo, E.; et al. miR-203 functions as a tumor suppressor by inhibiting epithelial to mesenchymal transition in ovarian cancer. J. Cancer Sci. Ther. 2015, 7, 34. [Google Scholar]
- Turchinovich, A.; Weiz, L.; Langheinz, A.; Burwinkel, B. Characterization of extracellular circulating microRNA. Nucleic Acids Res. 2011, 39, 7223–7233. [Google Scholar] [CrossRef]
- Sun, J.; Huang, Y.R.; Harrington, W.R.; Sheng, S.; Katzenellenbogen, J.A.; Katzenellenbogen, B.S. Antagonists selective for estrogen receptor α. Endocrinology 2002, 143, 941–947. [Google Scholar] [CrossRef]
- Vahrenkamp, J.M.; Yang, C.H.; Rodriguez, A.C.; Almomen, A.; Berrett, K.C.; Trujillo, A.N.; Guillen, K.P.; Welm, B.E.; Jarboe, E.A.; Amsbury, M.M.J.; et al. Clinical and Genomic Crosstalk between Glucocorticoid Receptor and Estrogen Receptor α In Endometrial Cancer. Cell Rep. 2018, 22, 2995–3005. [Google Scholar] [CrossRef] [Green Version]
- Barta, E. Command line analysis of ChIP-seq results. EMBnet J. 2011, 17, 13–17. [Google Scholar] [CrossRef] [Green Version]
- Li, Y.; Wang, J.P.; Santen, R.J.; Kim, T.H.; Park, H.; Fan, P.; Yue, W. Estrogen stimulation of cell migration involves multiple signaling pathway interactions. Endocrinology 2010, 151, 5146–5156. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Park, S.H.; Cheung, L.W.; Wong, A.S.; Leung, P.C. Estrogen regulates Snail and Slug in the down-regulation of E-cadherin and induces metastatic potential of ovarian cancer cells through estrogen receptor α. Mol. Endocrinol. 2008, 22, 2085–2098. [Google Scholar] [CrossRef] [PubMed]
- Ptak, A.; Hoffmann, M.; Gruca, I.; Barć, J. Bisphenol A induce ovarian cancer cell migration via the MAPK and PI3K/Akt signalling pathways. Toxicol. Lett. 2014, 229, 357–365. [Google Scholar] [CrossRef]
- Kowalska, K.; Górczyńska, D.E.H.; Urbanek, K.A.; Domińska, K.; Ciesielska, A.W.P. Estrogen receptor α is crucial in zearalenone-induced invasion and migration of prostate cancer cells. Toxins 2018, 10, 98. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Wang, H.; Zhao, X.; Ni, C.; Dai, Y.; Guo, Y. Zearalenone regulates endometrial stromal cell apoptosis and migration via the promotion of mitochondrial fission by activation of the JNK/Drp1 pathway. Mol. Med. Rep. 2018, 17, 7797–7806. [Google Scholar] [CrossRef] [Green Version]
- Zhang, G.L.; Song, J.L.; Ji, C.L.; Feng, Y.L.; Yu, J.; Nyachoti, C.M.; Yang, G.S. Zearalenone exposure enhanced the expression of tumorigenesis genes in donkey granulosa cells via the PTEN/PI3K/AKT signaling pathway. Front. Genet. 2018, 9, 293. [Google Scholar] [CrossRef] [Green Version]
- Park, M.A.; Choi, K.C. Effects of 4-nonylphenol and bisphenol A on stimulation of cell growth via disruption of the transforming growth factor-β signaling pathway in ovarian cancer models. Chem. Res. Toxicol. 2014, 27, 119–128. [Google Scholar] [CrossRef]
- Shi, X.Y.; Wang, Z.; Liu, L.; Feng, L.M.; Li, N.; Liu, S.; Gao, H. Low concentrations of bisphenol A promote human ovarian cancer cell proliferation and glycolysis-based metabolism through the estrogen receptor-α pathway. Chemosphere 2017, 185, 361–367. [Google Scholar] [CrossRef]
- Takeuchi, T.; Tsutsumi, O. Serum bisphenol A concentrations showed gender differences, possibly linked to androgen levels. Biochem. Biophys. Res. Commun. 2002, 291, 76–78. [Google Scholar] [CrossRef]
- Pajewska, M.; Łojko, M.; Cendrowski, K.; Sawicki, W.; Kowalkowski, T.; Buszewski, B.; Kopciuch, R.G. The determination of zearalenone and its major metabolites in endometrial cancer tissues. Anal. Bioanal. Chem. 2018, 410, 1571–1582. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Ren, X.; Wu, X.; Hillier, S.G.; Fegan, K.S.; Critchley, H.O.D.; Mason, J.I.; Sarvi, S.; Harlow, C.R. Local estrogen metabolism in epithelial ovarian cancer suggests novel targets for therapy. J. Steroid Biochem. Mol. Biol. 2015, 150, 54–63. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Choi, P.W.; Ng, S.W. The functions of microRNA-200 family in ovarian cancer: Beyond epithelial-mesenchymal transition. Int. J. Mol. Sci. 2017, 18, 1207. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Zhang, L.; Liao, Y.; Tang, L. MicroRNA-34 family: A potential tumor suppressor and therapeutic candidate in cancer. J. Exp. Clin. Cancer Res. 2019, 38, 1–13. [Google Scholar] [CrossRef] [Green Version]
- Park, S.M.; Gaur, A.B.; Lengyel, E.; Peter, M.E. The miR-200 family determines the epithelial phenotype of cancer cells by targeting the E-cadherin repressors ZEB1 and ZEB2. Genes Dev. 2008, 22, 894–907. [Google Scholar] [CrossRef] [Green Version]
- Zhao, G.; Guo, J.; Li, D.; Jia, C.; Yin, W.; Sun, R.; Lv, Z.; Cong, X. MicroRNA-34a suppresses cell proliferation by targeting LMTK3 in human breast cancer mcf-7 cell line. DNA Cell Biol. 2013, 32, 699–707. [Google Scholar] [CrossRef] [Green Version]
- Nakshatri, P.B.; Wang, G.; Collins, N.R.; Thomson, M.J.; Geistlinger, T.R.; Carroll, J.S.; Brown, M.; Hammond, S.; Srour, E.F.; Liu, Y.; et al. Estradiol-regulated microRNAs control estradiol response in breast cancer cells. Nucleic Acids Res. 2009, 37, 4850–4861. [Google Scholar] [CrossRef] [Green Version]
- Du, Y.; Zhang, Z.; Xiong, W.; Li, N.; Liu, H.; He, H.; Li, Q.; Liu, Y.; Zhang, L. Estradiol promotes EMT in endometriosis via MALAT1/miR200s sponge function. Reproduction 2019, 157, 179–188. [Google Scholar] [CrossRef] [Green Version]
- Wang, M.; Wu, W.; Li, L.; He, J.; Huang, S.; Chen, S.; Chen, J.; Long, M.; Yang, S.; Li, P. Analysis of the miRNA expression profiles in the zearalenone-exposed TM3 Leydig cell line. Int. J. Mol. Sci. 2019, 20, 635. [Google Scholar] [CrossRef] [Green Version]
- Whiting, M.A.; Veiga, K.R.; Uhl, K.M.; Maccani, M.A.; Gagne, L.A.; Moen, E.L.; Marsit, C.J. Bisphenol A exposure leads to specific microRNA alterations in placental cells. Reprod. Toxicol. 2010, 29, 401–406. [Google Scholar] [CrossRef] [Green Version]
- Reed, B.G.; Babayev, S.N.; Chen, L.X.; Carr, B.R.; Word, R.A.; Jimenez, P.T. Estrogen-regulated miRNA-27b is altered by bisphenol A in human endometrial stromal cells. Reproduction 2018, 156, 559–567. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Sabry, R.; Yamate, J.; Favetta, L.; LaMarre, J. MicroRNAs: Potential targets and agents of endocrine disruption in female reproduction. J. Toxicol. Pathol. 2019, 32, 213–221. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Manavalan, T.T.; Teng, Y.; Litchfield, L.M.; Muluhngwi, P.; Rayyan, N.A.; Klinge, C.M. Reduced expression of miR-200 family members contributes to antiestrogen resistance in LY2 human breast cancer cells. PLoS ONE 2013, 8, e62334. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Gao, Y.; Zhang, W.; Liu, C.; Li, G. miR-200 affects tamoxifen resistance in breast cancer cells through regulation of MYB. Sci. Rep. 2019, 9, 18844. [Google Scholar] [CrossRef] [PubMed]
- Bai, J.X.; Yan, B.; Zhao, Z.N.; Xiao, X.; Qin, W.W.; Zhang, R.; Jia, L.T.; Meng, Y.L.; Jin, B.Q.; Fan, D.M.; et al. Tamoxifen represses miR-200 microRNAs and promotes epithelial-to-mesenchymal transition by up-regulating c-Myc in endometrial carcinoma cell lines. Endocrinology 2013, 154, 635–645. [Google Scholar] [CrossRef] [Green Version]
- Mei, S.; Xin, J.; Liu, Y.; Zhang, Y.; Liang, X.; Su, X.; Yan, H.; Huang, Y.; Yang, R. MicroRNA-200c promotes suppressive potential of myeloid-derived suppressor cells by modulating PTEN and FOG2 expression. PLoS ONE 2015, 10, e0135867. [Google Scholar] [CrossRef] [PubMed]
- Yi, M.; Xu, L.; Jiao, Y.; Luo, S.; Li, A.; Wu, K. The role of cancer-derived microRNAs in cancer immune escape. J. Hematol. Oncol. 2020, 13, 1–14. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Gomarasca, M.; Maroni, P.; Banfi, G.; Lombardi, G. microRNAs in the Antitumor Immune Response and in Bone Metastasis of Breast Cancer: From Biological Mechanisms to Therapeutics. Int. J. Mol. Sci. 2020, 21, 2805. [Google Scholar] [CrossRef] [Green Version]
- Eichmüller, S.B.; Osen, W.; Mandelboim, O.; Seliger, B. Immune modulatory microRNAs involved in tumor attack and tumor immune escape. J. Natl. Cancer Inst. 2017, 109, djx034. [Google Scholar] [CrossRef] [Green Version]
- Wang, K.; Zhang, S.; Weber, J.; Baxter, D.; Galas, D.J. Export of microRNAs and microRNA-protective protein by mammalian cells. Nucleic Acids Res. 2010, 38, 7248–7259. [Google Scholar] [CrossRef] [Green Version]
- Gebäck, T.; Schulz, M.M.P.; Koumoutsakos, P.; Detmar, M.T. Scratch: A novel and simple software tool for automated analysis of monolayer wound healing assays: Short Technical Reports. Biotechniques 2009, 46, 265–274. [Google Scholar] [CrossRef] [PubMed]
- Grada, A.; Vinas, M.O.; Castrillo, F.P.; Obagi, Z.; Falanga, V. Research techniques made simple: Analysis of collective cell migration using the wound healing assay. J. Investig. Dermatol. 2017, 137, e11–e16. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Markovics, A.; Tóth, K.F.; Sós, K.E.; Magi, J.; Gyöngyösi, A.; Benyó, Z.; Zouboulis, C.; Bíró, T.; Oláh, A. Nicotinic acid suppresses sebaceous lipogenesis of human sebocytes via activating hydroxycarboxylic acid receptor 2 (HCA2). J. Cell. Mol. Med. 2019, 23, 6203–6214. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Hergenreider, E.; Heydt, S.; Tréguer, K.; Boettger, T.; Horrevoets, A.J.G.; Zeiher, A.M.; Scheffer, M.P.; Frangakis, A.S.; Yin, X.; Mayr, M.; et al. Atheroprotective communication between endothelial cells and smooth muscle cells through miRNAs. Nat. Cell Biol. 2012, 14, 249–256. [Google Scholar] [CrossRef] [PubMed]
- Kan, C.W.; Hahn, M.A.; Gard, G.B.; Maidens, J.; Huh, J.Y.; Marsh, D.J.; Howell, V.M. Elevated levels of circulating microRNA-200 family members correlate with serous epithelial ovarian cancer. BMC Cancer 2012, 12, 627. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Li, H.; Durbin, R. Fast and accurate short read alignment with Burrows–Wheeler transform. Bioinformatics 2009, 25, 1754–1760. [Google Scholar] [CrossRef] [Green Version]
- Zhang, Y.; Liu, T.; Meyer, C.A.; Eeckhoute, J.; Johnson, D.S.; Bernstein, B.E.; Nussbaum, C.; Myers, R.M.; Brown, M.; Li, W.; et al. Model-based analysis of ChIP-Seq (MACS). Genome Biol. 2008, 9, 1–9. [Google Scholar] [CrossRef] [Green Version]
- Thorvaldsdóttir, H.; Robinson, J.T.; Mesirov, J.P. Integrative Genomics Viewer (IGV): High-performance genomics data visualization and exploration. Brief. Bioinform. 2013, 14, 178–192. [Google Scholar] [CrossRef] [Green Version]
- Szilágyi, M.; Pös, O.; Márton, É.; Buglyó, G.; Soltész, B.; Keserű, J.; Penyige, A.; Szemes, T.; Nagy, B. Circulating Cell-Free Nucleic Acids: Main Characteristics and Clinical Application. Int. J. Mol. Sci. 2020, 21, 6827. [Google Scholar] [CrossRef]
E2 | ZEA | BPA | ||||
---|---|---|---|---|---|---|
PEO1 | A2780 | PEO1 | A2780 | PEO1 | A2780 | |
GREB1 | 263.19 *** | 0.76 | 233.94 *** | 0.79 | 20.53 ** | 0.58 |
DEPTOR | 5.39 * | 0.97 | 15.03 * | 0.84 | 3.03 * | 0.52 |
CA12 | 37.01 ** | 0.72 | 13.45 * | 0.61 | 2.79 * | 0.69 |
RBBP8 | 9.58 * | 0.71 | 5.21 * | 0.81 | 2.13 * | 0.76 |
CDH1 | 0.42 * | n.d. | 0.18 * | n.d. | 0.44 * | n.d. |
ZEB1 | n.d. | 1.18 | n.d. | 1.01 | n.d. | 0.75 |
miR200a | miR200b | miR200c | miR141 | miR429 | miR203a | ||
---|---|---|---|---|---|---|---|
E2 | 12 h | 1.52 * | 2.9 * | 3.28 * | 3.32 * | 1.14 | 1.73 * |
24 h | 0.56 | 0.28 * | 0.43 * | 0.95 | 1.09 | 0.82 | |
ZEA | 12 h | 1.29 | 0.99 | 1.71 * | 1.16 | 0.97 | 1.27 |
24 h | 0.22 * | 0.42 * | 0.74 | 0.71 | 0.64 | 0.68 | |
BPA | 12 h | 1.89 * | 2.91 * | 2.12 * | 1.75 * | 1.85 * | 1.27 |
24 h | 0.22 * | 0.67 | 1.34 | 1.29 | 1.47 | 0.95 |
miR200a | miR200b | miR200c | miR429 | miR203a | ||
---|---|---|---|---|---|---|
E2 | 12 h | 0.058 * | 1.95 * | 1.38 | 1.51 | 0.49 * |
24 h | 0.042 * | 1.57 * | 1.57 * | 1.01 | 1.8 * | |
ZEA | 12 h | 3.29 * | 1.59 * | 1.16 | 1.18 | 1.19 |
24 h | 0.08 * | 0.38 * | 0.34 * | 0.44 * | 0.56 | |
BPA | 12 h | 1.89 * | 1.71 * | 1.94 * | 1.19 | 1.64 * |
24 h | 0.09 * | 0.36 * | 0.68 | 0.69 | 1.06 |
Forward | Reverse | |
---|---|---|
ESR1 | GTGACTTCAATGGCGAAGG | TTCCCTTGTCATTGGTACTGG |
GREB1 | TCTTGCACAATTCCATCGAG | GTCCACTCGGCTACCACCT |
DEPTOR | TCATGGCATCTGAATTCCTG | ATGGGTGCTTGTTGGACAC |
CA12 | GTTTCTCCTGACCAACAATGG | CGTGGCACTGTAGCGAGAC |
RBBP8 | CACTCAGACTTGTATGGAAAGAGG | TCCTTCTGTTTCTGTTTCAACG |
CDH1 | TCTGTGAGAGGAATCCAAAGC | TGGGAGGATCACTAGGTTCAA |
ZEB1 | AGGATGACCTGCCAACAGAC | ATTTCTTGCCCTTCCTTTCC |
GAPDH | CACCCACTCCTCCACCTTT | GCCAAATTCGTTGTCATACCA |
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations. |
© 2020 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (http://creativecommons.org/licenses/by/4.0/).
Share and Cite
Márton, É.; Varga, A.; Széles, L.; Göczi, L.; Penyige, A.; Nagy, B.; Szilágyi, M. The Cell-Free Expression of MiR200 Family Members Correlates with Estrogen Sensitivity in Human Epithelial Ovarian Cells. Int. J. Mol. Sci. 2020, 21, 9725. https://doi.org/10.3390/ijms21249725
Márton É, Varga A, Széles L, Göczi L, Penyige A, Nagy B, Szilágyi M. The Cell-Free Expression of MiR200 Family Members Correlates with Estrogen Sensitivity in Human Epithelial Ovarian Cells. International Journal of Molecular Sciences. 2020; 21(24):9725. https://doi.org/10.3390/ijms21249725
Chicago/Turabian StyleMárton, Éva, Alexandra Varga, Lajos Széles, Lóránd Göczi, András Penyige, Bálint Nagy, and Melinda Szilágyi. 2020. "The Cell-Free Expression of MiR200 Family Members Correlates with Estrogen Sensitivity in Human Epithelial Ovarian Cells" International Journal of Molecular Sciences 21, no. 24: 9725. https://doi.org/10.3390/ijms21249725