Simulated Microgravity Influences VEGF, MAPK, and PAM Signaling in Prostate Cancer Cells
Abstract
:1. Introduction
2. Results
2.1. Morphology and Cell Growth
2.2. VEGF, MAPK, and PAM Signaling Pathways
2.3. Cytoskeleton
2.4. Extracellular Matrix
2.5. Altered Expression of Genes of the Focal Adhesion Complex
2.6. Interaction of Genes Investigated by Pathway Analysis
3. Discussion
3.1. Signaling Pathways Involved in Three-Dimensional Growth
3.1.1. VEGF Signaling
3.1.2. MAPK Signaling
3.1.3. PI3K/AKT/mTOR (PAM) Signaling
3.2. Changes in the Cytoskeleton and the Extracellular Matrix
3.3. Interaction Network of Selected Genes Evaluated by Pathway Analysis
4. Materials and Methods
4.1. Cell Culturing and Microgravity Simulation on the RPM
4.2. Sample Collection
4.3. RNA Isolation
4.4. Quantitative Real-Time Polymerase Chain Reaction
4.5. Immunofluorescence
4.6. Histochemical Staining
4.7. Microscopy
4.8. Time-Resolved Immunofluorometric Assay
4.9. Pathway Analysis
4.10. Statistical Analysis
5. Conclusions
Author Contributions
Funding
Acknowledgments
Conflicts of Interest
Abbreviations
AD | Adherent cell(s) |
BME | β-mercaptoethanol |
BSA | Bovine serum albumin |
DAPI | 4′,6-diamidino-2-phenylindole |
ECM | Extracellular matrix |
EMT | Epithelial–mesenchymal transition |
ERK | Extracellular signal regulated kinase |
FA | Focal adhesion |
FAK | Focal adhesion kinase |
FLK1 | Fms-related tyrosine kinase 1 |
FLT1 | Fetal liver kinase 1 |
FBS | Fetal bovine albumin |
HE | Hematoxylin–eosin |
HRP | Horseradish peroxidase |
IF | Immunofluorescence |
MAPK | Mitogen-activated protein kinase |
MCS | Multicellular spheroid(s) |
MEK1 | Mitogen-activated protein kinase kinase 1 |
mTOR | Mammalian target of rapamycin |
mTORC2 | mTOR complex 2 |
µg | Microgravity |
NGAL (LCN2) | Neutrophil gelatinase-associated lipocalin (lipocalin 2) |
NTC | No-template control |
1 g | Normal gravity |
PAM | PI3K/AKT/mTOR |
PBS | Phosphate-buffered saline |
PBST | Phosphate-buffered saline with Tween |
PFA | Paraformaldehyde |
PI3K | Phosphoinositide 3-kinase |
PKB | Protein kinase B |
qPCR | Quantitative real-time polymerase chain reaction |
RAF | Rapidly accelerated fibrosarcoma |
RICTOR | Rapamycin-insensitive companion of mTOR |
RIPA | Radioimmunoprecipitation assay |
RPM | Random positioning machine |
rpm | Rounds per minute |
RWV | Rotating wall vessel |
SR | Sirius red |
SRC (Src) | Steroid receptor coactivator (proto-oncogene, non-receptor tyrosine kinase) |
S-µg | Simulated microgravity |
TBST | Tris-buffered saline with Tween |
VEGF | Vascular endothelial growth factor |
VEGFR | Vascular endothelial growth factor receptor |
WHO | World Health Organization |
TRIFMA | Time-resolved immunofluorometric assay |
2D | Two-dimensional |
3D | Three-dimensional |
References
- Nassef, M.Z.; Kopp, S.; Melnik, D.; Corydon, T.J.; Sahana, J.; Krüger, M.; Wehland, M.; Bauer, T.J.; Liemersdorf, C.; Hemmersbach, R.; et al. Short-Term Microgravity Influences Cell Adhesion in Human Breast Cancer Cells. Int. J. Mol. Sci. 2019, 20, 5730. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Fukazawa, T.; Tanimoto, K.; Shrestha, L.; Imura, T.; Takahashi, S.; Sueda, T.; Hirohashi, N.; Hiyama, E.; Yuge, L. Simulated microgravity enhances CDDP-induced apoptosis signal via p53-independent mechanisms in cancer cells. PLoS ONE 2019, 14, e0219363. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Camberos, V.; Baio, J.; Bailey, L.; Hasaniya, N.; Lopez, L.V.; Kearns-Jonker, M. Effects of Spaceflight and Simulated Microgravity on YAP1 Expression in Cardiovascular Progenitors: Implications for Cell-Based Repair. Int. J. Mol. Sci. 2019, 20, 2742. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Qin, W.; Liu, L.; Wang, Y.; Wang, Z.; Yang, A.; Wang, T. Mir-494 inhibits osteoblast differentiation by regulating BMP signaling in simulated microgravity. Endocrine 2019, 65, 426–439. [Google Scholar] [CrossRef] [PubMed]
- Deng, B.; Liu, R.; Tian, X.; Han, Z.; Chen, J. Simulated microgravity inhibits the viability and migration of glioma via FAK/RhoA/Rock and FAK/Nek2 signaling. In Vitro Cell. Dev. Biol. Anim. 2019, 55, 260–271. [Google Scholar] [CrossRef] [PubMed]
- Bray, F.; Ferlay, J.; Soerjomataram, I.; Siegel, R.L.; Torre, L.A.; Jemal, A. Global cancer statistics 2018: GLOBOCAN estimates of incidence and mortality worldwide for 36 cancers in 185 countries. CA Cancer J. Clin. 2018, 68, 394–424. [Google Scholar] [CrossRef] [Green Version]
- Humphrey, P.A.; Moch, H.; Cubilla, A.L.; Ulbright, T.M.; Reuter, V.E. The 2016 WHO Classification of Tumours of the Urinary System and Male Genital Organs-Part B: Prostate and Bladder Tumours. Eur. Urol. 2016, 70, 106–119. [Google Scholar] [CrossRef] [Green Version]
- Humphrey, P.A. Histological variants of prostatic carcinoma and their significance. Histopathology 2012, 60, 59–74. [Google Scholar] [CrossRef]
- Abate-Shen, C.; Shen, M.M. Molecular genetics of prostate cancer. Genes. Dev. 2000, 14, 2410–2434. [Google Scholar] [CrossRef] [Green Version]
- Feng, M.; Peng, J.; Song, C.; Wang, Y. Mammalian cell cultivation in space. Microgravity Sci. Technol. 1994, 7, 207–210. [Google Scholar]
- Grimm, D.; Bauer, J.; Kossmehl, P.; Shakibaei, M.; Schoberger, J.; Pickenhahn, H.; Schulze-Tanzil, G.; Vetter, R.; Eilles, C.; Paul, M.; et al. Simulated microgravity alters differentiation and increases apoptosis in human follicular thyroid carcinoma cells. FASEB J. 2002, 16, 604–606. [Google Scholar] [CrossRef]
- Grimm, D.; Wise, P.; Lebert, M.; Richter, P.; Baatout, S. How and why does the proteome respond to microgravity? Expert Rev. Proteom. 2011, 8, 13–27. [Google Scholar] [CrossRef] [PubMed]
- Aleshcheva, G.; Bauer, J.; Hemmersbach, R.; Slumstrup, L.; Wehland, M.; Infanger, M.; Grimm, D. Scaffold-free Tissue Formation Under Real and Simulated Microgravity Conditions. Basic Clin. Pharmacol. Toxicol. 2016, 119 (Suppl. 3), 26–33. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Ingram, M.; Techy, G.B.; Saroufeem, R.; Yazan, O.; Narayan, K.S.; Goodwin, T.J.; Spaulding, G.F. Three-dimensional growth patterns of various human tumor cell lines in simulated microgravity of a NASA bioreactor. In Vitro Cell. Dev. Biol. Anim. 1997, 33, 459–466. [Google Scholar] [CrossRef] [PubMed]
- Dittrich, A.; Grimm, D.; Sahana, J.; Bauer, J.; Kruger, M.; Infanger, M.; Magnusson, N.E. Key Proteins Involved in Spheroid Formation and Angiogenesis in Endothelial Cells After Long-Term Exposure to Simulated Microgravity. Cell. Physiol. Biochem. 2018, 45, 429–445. [Google Scholar] [CrossRef]
- Grimm, D.; Wehland, M.; Pietsch, J.; Aleshcheva, G.; Wise, P.; van Loon, J.; Ulbrich, C.; Magnusson, N.E.; Infanger, M.; Bauer, J. Growing tissues in real and simulated microgravity: New methods for tissue engineering. Tissue Eng. Part B Rev. 2014, 20, 555–566. [Google Scholar] [CrossRef] [Green Version]
- Mehta, G.; Hsiao, A.Y.; Ingram, M.; Luker, G.D.; Takayama, S. Opportunities and challenges for use of tumor spheroids as models to test drug delivery and efficacy. J. Control. Release 2012, 164, 192–204. [Google Scholar] [CrossRef] [Green Version]
- Herranz, R.; Anken, R.; Boonstra, J.; Braun, M.; Christianen, P.C.; de Geest, M.; Hauslage, J.; Hilbig, R.; Hill, R.J.; Lebert, M.; et al. Ground-based facilities for simulation of microgravity: Organism-specific recommendations for their use, and recommended terminology. Astrobiology 2013, 13, 1–17. [Google Scholar] [CrossRef] [Green Version]
- Hoson, T.; Kamisaka, S.; Masuda, Y.; Yamashita, M.; Buchen, B. Evaluation of the three-dimensional clinostat as a simulator of weightlessness. Planta 1997, 203, S187–S197. [Google Scholar] [CrossRef]
- Warnke, E.; Pietsch, J.; Wehland, M.; Bauer, J.; Infanger, M.; Gorog, M.; Hemmersbach, R.; Braun, M.; Ma, X.; Sahana, J.; et al. Spheroid formation of human thyroid cancer cells under simulated microgravity: A possible role of CTGF and CAV1. Cell. Commun. Signal. 2014, 12, 32. [Google Scholar] [CrossRef] [Green Version]
- Kopp, S.; Sahana, J.; Islam, T.; Petersen, A.G.; Bauer, J.; Corydon, T.J.; Schulz, H.; Saar, K.; Huebner, N.; Slumstrup, L.; et al. The role of NFkappaB in spheroid formation of human breast cancer cells cultured on the Random Positioning Machine. Sci. Rep. 2018, 8, 921. [Google Scholar] [CrossRef] [PubMed]
- Kruger, M.; Melnik, D.; Kopp, S.; Buken, C.; Sahana, J.; Bauer, J.; Wehland, M.; Hemmersbach, R.; Corydon, T.J.; Infanger, M.; et al. Fighting Thyroid Cancer with Microgravity Research. Int. J. Mol. Sci. 2019, 20, 2553. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Kopp, S.; Warnke, E.; Wehland, M.; Aleshcheva, G.; Magnusson, N.E.; Hemmersbach, R.; Corydon, T.J.; Bauer, J.; Infanger, M.; Grimm, D. Mechanisms of three-dimensional growth of thyroid cells during long-term simulated microgravity. Sci. Rep. 2015, 5, 16691. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Grimm, D.; Infanger, M.; Westphal, K.; Ulbrich, C.; Pietsch, J.; Kossmehl, P.; Vadrucci, S.; Baatout, S.; Flick, B.; Paul, M.; et al. A delayed type of three-dimensional growth of human endothelial cells under simulated weightlessness. Tissue Eng. Part A 2009, 15, 2267–2275. [Google Scholar] [CrossRef]
- Svejgaard, B.; Wehland, M.; Ma, X.; Kopp, S.; Sahana, J.; Warnke, E.; Aleshcheva, G.; Hemmersbach, R.; Hauslage, J.; Grosse, J.; et al. Common Effects on Cancer Cells Exerted by a Random Positioning Machine and a 2D Clinostat. PLoS ONE 2015, 10, e0135157. [Google Scholar] [CrossRef] [Green Version]
- Soranzo, C.; Della Torre, G.; Ingrosso, A. Formation, growth and morphology of multicellular tumor spheroids from a human colon carcinoma cell line (LoVo). Tumori 1986, 72, 459–467. [Google Scholar] [CrossRef]
- Cui, X.; Hartanto, Y.; Zhang, H. Advances in multicellular spheroids formation. J. R. Soc. Interface 2017, 14. [Google Scholar] [CrossRef]
- Kunz-Schughart, L.A. Multicellular tumor spheroids: Intermediates between monolayer culture and in vivo tumor. Cell. Biol. Int. 1999, 23, 157–161. [Google Scholar] [CrossRef]
- Mueller-Klieser, W. Method for the determination of oxygen consumption rates and diffusion coefficients in multicellular spheroids. Biophys. J. 1984, 46, 343–348. [Google Scholar] [CrossRef]
- Kunz-Schughart, L.A.; Freyer, J.P.; Hofstaedter, F.; Ebner, R. The use of 3-D cultures for high-throughput screening: The multicellular spheroid model. J. Biomol. Screen. 2004, 9, 273–285. [Google Scholar] [CrossRef] [Green Version]
- Corydon, T.J.; Mann, V.; Slumstrup, L.; Kopp, S.; Sahana, J.; Askou, A.L.; Magnusson, N.E.; Echegoyen, D.; Bek, T.; Sundaresan, A.; et al. Reduced Expression of Cytoskeletal and Extracellular Matrix Genes in Human Adult Retinal Pigment Epithelium Cells Exposed to Simulated Microgravity. Cell. Physiol. Biochem. 2016, 40, 1–17. [Google Scholar] [CrossRef]
- Nagy, J.A.; Dvorak, A.M.; Dvorak, H.F. VEGF-A and the induction of pathological angiogenesis. Annu. Rev. Pathol. 2007, 2, 251–275. [Google Scholar] [CrossRef]
- Goel, S.; Duda, D.G.; Xu, L.; Munn, L.L.; Boucher, Y.; Fukumura, D.; Jain, R.K. Normalization of the vasculature for treatment of cancer and other diseases. Physiol. Rev. 2011, 91, 1071–1121. [Google Scholar] [CrossRef]
- Carmeliet, P.; Jain, R.K. Molecular mechanisms and clinical applications of angiogenesis. Nature 2011, 473, 298–307. [Google Scholar] [CrossRef] [Green Version]
- Peach, C.J.; Mignone, V.W.; Arruda, M.A.; Alcobia, D.C.; Hill, S.J.; Kilpatrick, L.E.; Woolard, J. Molecular Pharmacology of VEGF-A Isoforms: Binding and Signalling at VEGFR2. Int. J. Mol. Sci. 2018, 19, 1264. [Google Scholar] [CrossRef] [Green Version]
- Takahashi, T.; Ueno, H.; Shibuya, M. VEGF activates protein kinase C-dependent, but Ras-independent Raf-MEK-MAP kinase pathway for DNA synthesis in primary endothelial cells. Oncogene 1999, 18, 2221–2230. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Gerber, H.P.; McMurtrey, A.; Kowalski, J.; Yan, M.; Keyt, B.A.; Dixit, V.; Ferrara, N. Vascular endothelial growth factor regulates endothelial cell survival through the phosphatidylinositol 3′-kinase/Akt signal transduction pathway. Requirement for Flk-1/KDR activation. J. Biol. Chem. 1998, 273, 30336–30343. [Google Scholar] [CrossRef] [Green Version]
- Conciatori, F.; Bazzichetto, C.; Falcone, I.; Pilotto, S.; Bria, E.; Cognetti, F.; Milella, M.; Ciuffreda, L. Role of mTOR Signaling in Tumor Microenvironment: An Overview. Int. J. Mol. Sci. 2018, 19, 2453. [Google Scholar] [CrossRef] [Green Version]
- Chen, X.L.; Nam, J.O.; Jean, C.; Lawson, C.; Walsh, C.T.; Goka, E.; Lim, S.T.; Tomar, A.; Tancioni, I.; Uryu, S.; et al. VEGF-induced vascular permeability is mediated by FAK. Dev. Cell. 2012, 22, 146–157. [Google Scholar] [CrossRef] [Green Version]
- Abu-Ghazaleh, R.; Kabir, J.; Jia, H.; Lobo, M.; Zachary, I. Src mediates stimulation by vascular endothelial growth factor of the phosphorylation of focal adhesion kinase at tyrosine 861, and migration and anti-apoptosis in endothelial cells. Biochem. J. 2001, 360, 255–264. [Google Scholar] [CrossRef]
- Koch, S.; Claesson-Welsh, L. Signal transduction by vascular endothelial growth factor receptors. Cold Spring Harb. Perspect. Med. 2012, 2, a006502. [Google Scholar] [CrossRef]
- Tchaikovski, V.; Fellbrich, G.; Waltenberger, J. The molecular basis of VEGFR-1 signal transduction pathways in primary human monocytes. Arterioscler. Thromb. Vasc. Biol. 2008, 28, 322–328. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Zhau, H.E.; Goodwin, T.J.; Chang, S.M.; Baker, T.L.; Chung, L.W. Establishment of a three-dimensional human prostate organoid coculture under microgravity-simulated conditions: Evaluation of androgen-induced growth and PSA expression. In Vitro Cell. Dev. Biol. Anim. 1997, 33, 375–380. [Google Scholar] [CrossRef] [PubMed]
- Clejan, S.; O’Connor, K.; Rosensweig, N. Tri-dimensional prostate cell cultures in simulated microgravity and induced changes in lipid second messengers and signal transduction. J. Cell. Mol. Med. 2001, 5, 60–73. [Google Scholar] [CrossRef]
- Margolis, L.; Hatfill, S.; Chuaqui, R.; Vocke, C.; Emmert-Buck, M.; Linehan, W.M.; Duray, P.H. Long term organ culture of human prostate tissue in a NASA-designed rotating wall bioreactor. J. Urol. 1999, 161, 290–297. [Google Scholar] [CrossRef]
- Leguy, C.A.D.; Delfos, R.; Pourquié, M.; Poelma, C.; Krooneman, J.; Westerweel, J.; van Loon, J.J.W.A. Fluid motion for microgravity simulations in a random positioning machine. Gravit. Space Biol. 2011, 25, 36–39. [Google Scholar]
- Ma, X.; Pietsch, J.; Wehland, M.; Schulz, H.; Saar, K.; Hubner, N.; Bauer, J.; Braun, M.; Schwarzwalder, A.; Segerer, J.; et al. Differential gene expression profile and altered cytokine secretion of thyroid cancer cells in space. FASEB J. 2014, 28, 813–835. [Google Scholar] [CrossRef] [PubMed]
- Viallard, C.; Larrivee, B. Tumor angiogenesis and vascular normalization: Alternative therapeutic targets. Angiogenesis 2017, 20, 409–426. [Google Scholar] [CrossRef]
- Yang, J.; Moses, M.A. Abstract 1293: Neutrophil gelatinase-associated lipocalin regulates the expression of angiogenic cytokines and VEGF in human breast and ovarian cancer cells. Cancer Res. 2010, 70, 1293. [Google Scholar] [CrossRef]
- Iannetti, A.; Pacifico, F.; Acquaviva, R.; Lavorgna, A.; Crescenzi, E.; Vascotto, C.; Tell, G.; Salzano, A.M.; Scaloni, A.; Vuttariello, E.; et al. The neutrophil gelatinase-associated lipocalin (NGAL), a NF-kappaB-regulated gene, is a survival factor for thyroid neoplastic cells. Proc. Natl. Acad. Sci. USA 2008, 105, 14058–14063. [Google Scholar] [CrossRef] [Green Version]
- Sun, Y.; Yokoi, K.; Li, H.; Gao, J.; Hu, L.; Liu, B.; Chen, K.; Hamilton, S.R.; Fan, D.; Sun, B.; et al. NGAL expression is elevated in both colorectal adenoma-carcinoma sequence and cancer progression and enhances tumorigenesis in xenograft mouse models. Clin. Cancer Res. 2011, 17, 4331–4340. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Zhang, X.F.; Zhang, Y.; Zhang, X.H.; Zhou, S.M.; Yang, G.G.; Wang, O.C.; Guo, G.L.; Yang, G.Y.; Hu, X.Q. Clinical significance of Neutrophil gelatinase-associated lipocalin(NGAL) expression in primary rectal cancer. BMC Cancer 2009, 9, 134. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Olea-Flores, M.; Zuniga-Eulogio, M.D.; Mendoza-Catalan, M.A.; Rodriguez-Ruiz, H.A.; Castaneda-Saucedo, E.; Ortuno-Pineda, C.; Padilla-Benavides, T.; Navarro-Tito, N. Extracellular-Signal Regulated Kinase: A Central Molecule Driving Epithelial-Mesenchymal Transition in Cancer. Int. J. Mol. Sci. 2019, 20, 2885. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Eblen, S.T. Extracellular-Regulated Kinases: Signaling From Ras to ERK Substrates to Control Biological Outcomes. Adv. Cancer Res. 2018, 138, 99–142. [Google Scholar] [CrossRef] [PubMed]
- Tee, S.S.; Suster, I.; Truong, S.; Jeong, S.; Eskandari, R.; DiGialleonardo, V.; Alvarez, J.A.; Aldeborgh, H.N.; Keshari, K.R. Targeted AKT Inhibition in Prostate Cancer Cells and Spheroids Reduces Aerobic Glycolysis and Generation of Hyperpolarized [1-(13)C] Lactate. Mol. Cancer Res. 2018, 16, 453–460. [Google Scholar] [CrossRef] [Green Version]
- Cully, M.; You, H.; Levine, A.J.; Mak, T.W. Beyond PTEN mutations: The PI3K pathway as an integrator of multiple inputs during tumorigenesis. Nat. Rev. Cancer 2006, 6, 184–192. [Google Scholar] [CrossRef]
- Available online: https://clinicaltrials.gov/ (accessed on 13 February 2020).
- Magani, F.; Peacock, S.O.; Rice, M.A.; Martinez, M.J.; Greene, A.M.; Magani, P.S.; Lyles, R.; Weitz, J.R.; Burnstein, K.L. Targeting AR Variant-Coactivator Interactions to Exploit Prostate Cancer Vulnerabilities. Mol. Cancer Res. 2017, 15, 1469–1480. [Google Scholar] [CrossRef] [Green Version]
- Jain, N.; Zhang, T.; Fong, S.L.; Lim, C.P.; Cao, X. Repression of Stat3 activity by activation of mitogen-activated protein kinase (MAPK). Oncogene 1998, 17, 3157–3167. [Google Scholar] [CrossRef] [Green Version]
- Shen, B.Q.; Lee, D.Y.; Gerber, H.P.; Keyt, B.A.; Ferrara, N.; Zioncheck, T.F. Homologous up-regulation of KDR/Flk-1 receptor expression by vascular endothelial growth factor in vitro. J. Biol. Chem. 1998, 273, 29979–29985. [Google Scholar] [CrossRef] [Green Version]
- Fan, P.; Agboke, F.A.; McDaniel, R.E.; Sweeney, E.E.; Zou, X.; Creswell, K.; Jordan, V.C. Inhibition of c-Src blocks oestrogen-induced apoptosis and restores oestrogen-stimulated growth in long-term oestrogen-deprived breast cancer cells. Eur. J. Cancer 2014, 50, 457–468. [Google Scholar] [CrossRef] [Green Version]
- Calalb, M.B.; Polte, T.R.; Hanks, S.K. Tyrosine phosphorylation of focal adhesion kinase at sites in the catalytic domain regulates kinase activity: A role for Src family kinases. Mol. Cell. Biol. 1995, 15, 954–963. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Dumbauld, D.W.; Shin, H.; Gallant, N.D.; Michael, K.E.; Radhakrishna, H.; Garcia, A.J. Contractility modulates cell adhesion strengthening through focal adhesion kinase and assembly of vinculin-containing focal adhesions. J. Cell. Physiol. 2010, 223, 746–756. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Bauer, T.J.; Gombocz, E.; Kruger, M.; Sahana, J.; Corydon, T.J.; Bauer, J.; Infanger, M.; Grimm, D. Augmenting cancer cell proteomics with cellular images—A semantic approach to understand focal adhesion. J. Biomed. Inform. 2019, 100, 103320. [Google Scholar] [CrossRef] [PubMed]
- Humphries, J.D.; Wang, P.; Streuli, C.; Geiger, B.; Humphries, M.J.; Ballestrem, C. Vinculin controls focal adhesion formation by direct interactions with talin and actin. J. Cell. Biol. 2007, 179, 1043–1057. [Google Scholar] [CrossRef] [Green Version]
- Chen, P.; Lei, L.; Wang, J.; Zou, X.; Zhang, D.; Deng, L.; Wu, D. Downregulation of Talin1 promotes hepatocellular carcinoma progression through activation of the ERK1/2 pathway. Cancer Sci. 2017, 108, 1157–1168. [Google Scholar] [CrossRef] [Green Version]
- Small, J.V.; Stradal, T.; Vignal, E.; Rottner, K. The lamellipodium: Where motility begins. Trends Cell. Biol. 2002, 12, 112–120. [Google Scholar] [CrossRef]
- Tojkander, S.; Gateva, G.; Lappalainen, P. Actin stress fibers--assembly, dynamics and biological roles. J. Cell. Sci. 2012, 125, 1855–1864. [Google Scholar] [CrossRef] [Green Version]
- Rijken, P.J.; de Groot, R.P.; Kruijer, W.; de Laat, S.W.; Verkleij, A.J.; Boonstra, J. Identification of specific gravity sensitive signal transduction pathways in human A431 carcinoma cells. Adv. Space Res. 1992, 12, 145–152. [Google Scholar] [CrossRef]
- Mann, V.; Grimm, D.; Corydon, T.J.; Kruger, M.; Wehland, M.; Riwaldt, S.; Sahana, J.; Kopp, S.; Bauer, J.; Reseland, J.E.; et al. Changes in Human Foetal Osteoblasts Exposed to the Random Positioning Machine and Bone Construct Tissue Engineering. Int. J. Mol. Sci. 2019, 20, 1357. [Google Scholar] [CrossRef] [Green Version]
- Nabavi, N.; Khandani, A.; Camirand, A.; Harrison, R.E. Effects of microgravity on osteoclast bone resorption and osteoblast cytoskeletal organization and adhesion. Bone 2011, 49, 965–974. [Google Scholar] [CrossRef]
- Ulbrich, C.; Pietsch, J.; Grosse, J.; Wehland, M.; Schulz, H.; Saar, K.; Hubner, N.; Hauslage, J.; Hemmersbach, R.; Braun, M.; et al. Differential gene regulation under altered gravity conditions in follicular thyroid cancer cells: Relationship between the extracellular matrix and the cytoskeleton. Cell. Physiol. Biochem. 2011, 28, 185–198. [Google Scholar] [CrossRef] [PubMed]
- Grosse, J.; Wehland, M.; Pietsch, J.; Ma, X.; Ulbrich, C.; Schulz, H.; Saar, K.; Hubner, N.; Hauslage, J.; Hemmersbach, R.; et al. Short-term weightlessness produced by parabolic flight maneuvers altered gene expression patterns in human endothelial cells. FASEB J. 2012, 26, 639–655. [Google Scholar] [CrossRef]
- Bonnans, C.; Chou, J.; Werb, Z. Remodelling the extracellular matrix in development and disease. Nat. Rev. Mol. Cell. Biol. 2014, 15, 786–801. [Google Scholar] [CrossRef] [PubMed]
- Kopp, S.; Kruger, M.; Bauer, J.; Wehland, M.; Corydon, T.J.; Sahana, J.; Nassef, M.Z.; Melnik, D.; Bauer, T.J.; Schulz, H.; et al. Microgravity Affects Thyroid Cancer Cells during the TEXUS-53 Mission Stronger than Hypergravity. Int. J. Mol. Sci. 2018, 19, 4001. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Birchmeier, W.; Behrens, J. Cadherin expression in carcinomas: Role in the formation of cell junctions and the prevention of invasiveness. Biochim. Biophys. Acta 1994, 1198, 11–26. [Google Scholar] [CrossRef]
- Semb, H.; Christofori, G. The tumor-suppressor function of E-cadherin. Am. J. Hum. Genet. 1998, 63, 1588–1593. [Google Scholar] [CrossRef] [Green Version]
- Infanger, M.; Kossmehl, P.; Shakibaei, M.; Bauer, J.; Kossmehl-Zorn, S.; Cogoli, A.; Curcio, F.; Oksche, A.; Wehland, M.; Kreutz, R.; et al. Simulated weightlessness changes the cytoskeleton and extracellular matrix proteins in papillary thyroid carcinoma cells. Cell. Tissue Res. 2006, 324, 267–277. [Google Scholar] [CrossRef]
- Sahana, J.; Nassef, M.Z.; Wehland, M.; Kopp, S.; Kruger, M.; Corydon, T.J.; Infanger, M.; Bauer, J.; Grimm, D. Decreased E-Cadherin in MCF7 Human Breast Cancer Cells Forming Multicellular Spheroids Exposed to Simulated Microgravity. Proteomics 2018, 18, e1800015. [Google Scholar] [CrossRef]
- Kliewe, F.; Kaling, S.; Lotzsch, H.; Artelt, N.; Schindler, M.; Rogge, H.; Schroder, S.; Scharf, C.; Amann, K.; Daniel, C.; et al. Fibronectin is up-regulated in podocytes by mechanical stress. FASEB J. 2019. [Google Scholar] [CrossRef] [Green Version]
- Garakani, K.; Shams, H.; Mofrad, M.R.K. Mechanosensitive Conformation of Vinculin Regulates Its Binding to MAPK1. Biophys. J. 2017, 112, 1885–1893. [Google Scholar] [CrossRef] [Green Version]
- Ghrebi, S.; Hamilton, D.W.; Douglas Waterfield, J.; Brunette, D.M. The effect of surface topography on cell shape and early ERK1/2 signaling in macrophages; linkage with FAK and Src. J. Biomed. Mater. Res. A 2013, 101, 2118–2128. [Google Scholar] [CrossRef]
- Wei, X.; Zhou, D.; Wang, H.; Ding, N.; Cui, X.X.; Wang, H.; Verano, M.; Zhang, K.; Conney, A.H.; Zheng, X.; et al. Effects of pyridine analogs of curcumin on growth, apoptosis and NF-kappaB activity in prostate cancer PC-3 cells. Anticancer Res. 2013, 33, 1343–1350. [Google Scholar] [PubMed]
- Wu, F.; Wu, S.; Gou, X. Identification of biomarkers and potential molecular mechanisms of clear cell renal cell carcinoma. Neoplasma 2018, 65, 242–252. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- von Au, A.; Vasel, M.; Kraft, S.; Sens, C.; Hackl, N.; Marx, A.; Stroebel, P.; Hennenlotter, J.; Todenhofer, T.; Stenzl, A.; et al. Circulating fibronectin controls tumor growth. Neoplasia 2013, 15, 925–938. [Google Scholar] [CrossRef] [PubMed]
- Irby, R.B.; Yeatman, T.J. Role of Src expression and activation in human cancer. Oncogene 2000, 19, 5636–5642. [Google Scholar] [CrossRef] [Green Version]
- Mori, T.; Ono, K.; Kariya, Y.; Ogawa, T.; Higashi, S.; Miyazaki, K. Laminin-3B11, a novel vascular-type laminin capable of inducing prominent lamellipodial protrusions in microvascular endothelial cells. J. Biol. Chem. 2010, 285, 35068–35078. [Google Scholar] [CrossRef] [Green Version]
- Chou, M.T.; Wang, J.; Fujita, D.J. Src kinase becomes preferentially associated with the VEGFR, KDR/Flk-1, following VEGF stimulation of vascular endothelial cells. BMC Biochem. 2002, 3, 32. [Google Scholar] [CrossRef]
- Fleming, R.Y.; Ellis, L.M.; Parikh, N.U.; Liu, W.; Staley, C.A.; Gallick, G.E. Regulation of vascular endothelial growth factor expression in human colon carcinoma cells by activity of src kinase. Surgery 1997, 122, 501–507. [Google Scholar] [CrossRef]
- Munshi, N.; Groopman, J.E.; Gill, P.S.; Ganju, R.K. c-Src mediates mitogenic signals and associates with cytoskeletal proteins upon vascular endothelial growth factor stimulation in Kaposi’s sarcoma cells. J. Immunol. 2000, 164, 1169–1174. [Google Scholar] [CrossRef]
- Albert, L.; Karsy, M.; Murali, R.; Jhanwar-Uniyal, M. Inhibition of mTOR Activates the MAPK Pathway in Glioblastoma Multiforme. Cancer Genom. Proteom. 2009, 6, 255–261. [Google Scholar]
- Kinkade, C.W.; Castillo-Martin, M.; Puzio-Kuter, A.; Yan, J.; Foster, T.H.; Gao, H.; Sun, Y.; Ouyang, X.; Gerald, W.L.; Cordon-Cardo, C.; et al. Targeting AKT/mTOR and ERK MAPK signaling inhibits hormone-refractory prostate cancer in a preclinical mouse model. J. Clin. Investig. 2008, 118, 3051–3064. [Google Scholar] [CrossRef] [Green Version]
- Engelman, J.A.; Chen, L.; Tan, X.; Crosby, K.; Guimaraes, A.R.; Upadhyay, R.; Maira, M.; McNamara, K.; Perera, S.A.; Song, Y.; et al. Effective use of PI3K and MEK inhibitors to treat mutant Kras G12D and PIK3CA H1047R murine lung cancers. Nat. Med. 2008, 14, 1351–1356. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Bendtsen, M.A.F.; Grimm, D.; Bauer, J.; Wehland, M.; Wise, P.; Magnusson, N.E.; Infanger, M.; Kruger, M. Hypertension Caused by Lenvatinib and Everolimus in the Treatment of Metastatic Renal Cell Carcinoma. Int. J. Mol. Sci. 2017, 18, 1736. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Nielsen, O.H.; Grimm, D.; Wehland, M.; Bauer, J.; Magnusson, N.E. Anti-Angiogenic Drugs in the Treatment of Metastatic Renal Cell Carcinoma: Advances in Clinical Application. Curr. Vasc. Pharm. 2015, 13, 381–391. [Google Scholar] [CrossRef] [PubMed]
- Kaighn, M.E.; Narayan, K.S.; Ohnuki, Y.; Lechner, J.F.; Jones, L.W. Establishment and characterization of a human prostatic carcinoma cell line (PC-3). Investig. Urol. 1979, 17, 16–23. [Google Scholar]
- Wuest, S.L.; Richard, S.; Kopp, S.; Grimm, D.; Egli, M. Simulated microgravity: Critical review on the use of random positioning machines for mammalian cell culture. Biomed. Res. Int. 2015, 2015, 971474. [Google Scholar] [CrossRef] [Green Version]
- Grimm, D.; Egli, M.; Kruger, M.; Riwaldt, S.; Corydon, T.J.; Kopp, S.; Wehland, M.; Wise, P.; Infanger, M.; Mann, V.; et al. Tissue Engineering Under Microgravity Conditions-Use of Stem Cells and Specialized Cells. Stem Cells Dev. 2018, 27, 787–804. [Google Scholar] [CrossRef]
- Kopp, S.; Slumstrup, L.; Corydon, T.J.; Sahana, J.; Aleshcheva, G.; Islam, T.; Magnusson, N.E.; Wehland, M.; Bauer, J.; Infanger, M.; et al. Identifications of novel mechanisms in breast cancer cells involving duct-like multicellular spheroid formation after exposure to the Random Positioning Machine. Sci. Rep. 2016, 6, 26887. [Google Scholar] [CrossRef]
- Grimm, D.; Jabusch, H.C.; Kossmehl, P.; Huber, M.; Fredersdorf, S.; Griese, D.P.; Kramer, B.K.; Kromer, E.P. Experimental diabetes and left ventricular hypertrophy: Effects of beta-receptor blockade. Cardiovasc. Pathol. 2002, 11, 229–237. [Google Scholar] [CrossRef]
- Grosse, J.; Warnke, E.; Pohl, F.; Magnusson, N.E.; Wehland, M.; Infanger, M.; Eilles, C.; Grimm, D. Impact of sunitinib on human thyroid cancer cells. Cell. Physiol. Biochem. 2013, 32, 154–170. [Google Scholar] [CrossRef]
- Magnusson, N.E.; Hornum, M.; Jorgensen, K.A.; Hansen, J.M.; Bistrup, C.; Feldt-Rasmussen, B.; Flyvbjerg, A. Plasma neutrophil gelatinase associated lipocalin (NGAL) is associated with kidney function in uraemic patients before and after kidney transplantation. BMC Nephrol. 2012, 13, 8. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Lützenberg, R.; Solano, K.; Buken, C.; Sahana, J.; Riwaldt, S.; Kopp, S.; Kruger, M.; Schulz, H.; Saar, K.; Huebner, N.; et al. Pathway Analysis Hints Towards Beneficial Effects of Long-Term Vibration on Human Chondrocytes. Cell. Physiol. Biochem. 2018, 47, 1729–1741. [Google Scholar] [CrossRef] [PubMed]
Factor | Primer Name | Sequence 5′–3′ |
---|---|---|
18S-rRNA | 18s-F | GGAGCCTGCGGCTTAATTT |
18s-R | CAACTAAGAACGGCCATGCA | |
Actin-beta (ACTB) | ACTB-F | TGCCGACAGGATGCAGAAG |
ACTB-R | GCCGATCCACACGGAGTACT | |
RAC-alpha Serine/threonine-protein kinase (AKT1) | Akt1-F | CTTCTATGGCGCTGAGATTGTG |
Akt1-R | CAGCATGAGGTTCTCCAGCT | |
Collagen 1 alpha 1 (COL1A1) | COL1A1-F | ACGAAGACATCCCACCAATCAC |
COL1A1-R | CGTTGTCGCAGACGCAGAT | |
Collagen 4 alpha 5 (COL4A5) | COL4A5-F | GGTACCTGTAACTACTATGCCAACTCCTA |
COL4A5-R | CGGCTAATTCGTGTCCTCAAG | |
E-cadherin (CDH1) | CDH1-F | GCTGGACCGAGAGAGTTTCC |
CDH1-R | CAGCTGTTGCTGTTGTGCTT | |
Extracellular signal-regulated kinase 1 (ERK1) | ERK1-F | ACCTGCGACCTTAAGATTTGTGA |
ERK1-R | AGCCACATACTCCGTCAGGAA | |
Extracellular signal-regulated kinase 2 (ERK2) | ERK2-F | TTCCAACCTGCTGCTCAACA |
ERK2-R | TCTGTCAGGAACCCTGTGTGAT | |
Focal adhesion kinase 1 (Protein-tyrosin kinase 2) (FAK1 (PTK2)) | FAK1-F | TGTGGGTAAACCAGATCCTGC |
FAK1-R | CTGAAGCTTGACACCCTCGT | |
Fibronectin (FN1) | FN1-F | TGAGGAGCATGGTTTTAGGAGAA |
FN1-R | TCCTCATTTACATTCGGCGTATAC | |
Laminin alpha 3 (LAMA3) | LAMA3-F | AAAGCAAGAAGTCAGTCCAGC |
LAMA3-R | TCCCATGAAGACCATCTCGG | |
Laminin β2 (LAMB2) | LAMB2-F | TGCTCATGGTCAATGCTAATCTG |
LAMB2-R | TCTATCAATCCTCTTCCTTGGACAA | |
Mitogen-activated protein kinase kinase 1 (MAP2K1) | MAP2K1-F | CGTTACCCGGGTCCAAAATG |
MAP2K1-R | TCCAAGTTGGTCTCCGCA | |
Mechanistic target of rapamycin kinase (MTOR) | MTOR-F | ATCTTGGCCATAGCTAGCCTC |
MTOR-R | ACAACTGGGTCATTGGAGGG | |
Neutrophil gelatinase-associated lipocalin (NGAL, LCN2) | LCN2-F | AGGGAGTACTTCAAGATCACCCTCTA |
LCN2-R | AGAGATTTGGAGAAGCGGATGA | |
Raf-1 proto-oncogene, serine/threonine kinase (RAF1) | RAF1-F | GGGAGCTTGGAAGACGATCAG |
RAF1-R | ACACGGATAGTGTTGCTTGTC | |
Rapamycin-insensitive companion of MTOR (RICTOR) | RICTOR-F | GGAAGCCTGTTGATGGTGAT |
RICTOR-R | GGCAGCCTGTTTTATGGTGT | |
Steroid receptor coactivator-1 (SRC1) | SRC1-F | CCACCTTTGTGGCCCTCTAT |
SRC1-R | CCTCTGTGTTGTTGACAATCTGG | |
Talin-1 (TLN1) | TLN1-F | GATGGCTATTACTCAGTACAGACAACTGA |
TLN1-R | CATAGTAGACTCCTCATCTCCTTCCA | |
Tubulin-beta (TUBB) | TUBB-F | CTGGACCGCATCTCTGTGTACTAC |
TUBB-R | GACCTGAGCGAACAGAGTCCAT | |
Vascular endothelial growth factor A (VEGFA) | VEGFA-F | GCGCTGATAGACATCCATGAAC |
VEGFA-R | CTACCTCCACCATGCCAAGTG | |
Vascular endothelial growth factor receptor 1 (FLT1) | FLT1-F | CCCTCGCCGGAAGTTGTAT |
FLT1-R | GATAATTAACGAGTAGCCACGAGTCAA | |
Vascular endothelial growth factor receptor 2 (FLK1) | FLK1-F | TCTTCTGGCTACTTCTTGTCATCATC |
FLK1-R | GATGGACAAGTAGCCTGTCTTCAGT | |
Vinculin (VCL) | VCL-F | GTCTCGGCTGCTCGTATCTT |
VCL-R | GTCCACCAGCCCTGTCATTT |
© 2020 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (http://creativecommons.org/licenses/by/4.0/).
Share and Cite
Hybel, T.E.; Dietrichs, D.; Sahana, J.; Corydon, T.J.; Nassef, M.Z.; Wehland, M.; Krüger, M.; Magnusson, N.E.; Bauer, J.; Utpatel, K.; et al. Simulated Microgravity Influences VEGF, MAPK, and PAM Signaling in Prostate Cancer Cells. Int. J. Mol. Sci. 2020, 21, 1263. https://doi.org/10.3390/ijms21041263
Hybel TE, Dietrichs D, Sahana J, Corydon TJ, Nassef MZ, Wehland M, Krüger M, Magnusson NE, Bauer J, Utpatel K, et al. Simulated Microgravity Influences VEGF, MAPK, and PAM Signaling in Prostate Cancer Cells. International Journal of Molecular Sciences. 2020; 21(4):1263. https://doi.org/10.3390/ijms21041263
Chicago/Turabian StyleHybel, Trine Engelbrecht, Dorothea Dietrichs, Jayashree Sahana, Thomas J. Corydon, Mohamed Z. Nassef, Markus Wehland, Marcus Krüger, Nils E. Magnusson, Johann Bauer, Kirsten Utpatel, and et al. 2020. "Simulated Microgravity Influences VEGF, MAPK, and PAM Signaling in Prostate Cancer Cells" International Journal of Molecular Sciences 21, no. 4: 1263. https://doi.org/10.3390/ijms21041263