METTL3 Modulates Osteoclast Differentiation and Function by Controlling RNA Stability and Nuclear Export
Abstract
:1. Introduction
2. Results
2.1. m6A Content and Expression of m6A Modification-Related Genes during Osteoclastogenesis
2.2. Mettl3 Knockdown Has No Effect on the Proliferation of Osteoclast Precursor Cells
2.3. Mettl3 Knockdown Regulates Osteoclastic Differentiation and Bone Resorption
2.4. Mettl3 and Ythdf2 Knockdown Increase Atp6v0d2 mRNA Stability during Osteoclast Differentiation
2.5. Mettl3 Knockdown Inactivates the RANKL-Induced MAPK, NF-κB and PI3K-AKT Signaling Pathways
2.6. Mettl3 Knockdown Promotes the Retention of Traf6 Transcripts in the Nucleus
3. Discussion
4. Materials and Methods
4.1. Cell Culture and Osteoclast Differentiation
4.2. TRAP Staining
4.3. Pit Formation Assay
4.4. Cell Proliferation Assay
4.5. Total m6A Measurement
4.6. Mettl3 Short Hairpin RNA (shRNA) Transfection
4.7. Ythdf2 Knockdown via siRNA Transfection
4.8. Real-time Quantitative Polymerase Chain Reaction (qRT-PCR)
4.9. RNA Stability Assay and mRNA Half-Life Calculation
4.10. Cytoplasmic and Nuclear RNA Fractionation
4.11. Western Blotting
4.12. Statistical Analysis
Supplementary Materials
Author Contributions
Funding
Acknowledgments
Conflicts of Interest
References
- Gilbert, W.V.; Bell, T.A.; Schaening, C. Messenger RNA modifications: Form, distribution and function. Science 2016, 352, 1408–1412. [Google Scholar] [CrossRef] [Green Version]
- Roignant, J.Y.; Soller, M. m(6)A in mRNA: An Ancient Mechanism for Fine-Tuning Gene Expression. Trends Genet. 2017, 33, 380–390. [Google Scholar] [CrossRef] [PubMed]
- Liu, J.; Yue, Y.; Han, D.; Wang, X.; Fu, Y.; Zhang, L.; Jia, G.; Yu, M.; Lu, Z.; Deng, X.; et al. A METTL3-METTL14 complex mediates mammalian nuclear RNA N6-adenosine methylation. Nat. Chem. Biol. 2014, 10, 93–95. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Ping, X.L.; Sun, B.F.; Wang, L.; Xiao, W.; Yang, X.; Wang, W.J.; Adhikari, S.; Shi, Y.; Lv, Y.; Chen, Y.S.; et al. Mammalian WTAP is a regulatory subunit of the RNA N6-methyladenosine methyltransferase. Cell Res. 2014, 24, 177–189. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Jia, G.; Fu, Y.; Zhao, X.; Dai, Q.; Zheng, G.; Yang, Y.; Yi, C.; Lindahl, T.; Pan, T.; Yang, Y.G.; et al. N6-methyladenosine in nuclear RNA is a major substrate of the obesity-associated FTO. Nat. Chem. Biol. 2011, 7, 885–887. [Google Scholar] [CrossRef] [PubMed]
- Zheng, G.; Dahl, J.A.; Niu, Y.; Fedorcsak, P.; Huang, C.M.; Li, C.J.; Vagbo, C.B.; Shi, Y.; Wang, W.L.; Song, S.H.; et al. ALKBH5 is a mammalian RNA demethylase that impacts RNA metabolism and mouse fertility. Mol. Cell 2013, 49, 18–29. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Liao, S.; Sun, H.; Xu, C. YTH Domain: A Family of N(6)-methyladenosine (m(6)A) Readers. Genom. Proteom. Bioinform. 2018, 16, 99–107. [Google Scholar] [CrossRef]
- Roundtree, I.A.; Luo, G.Z.; Zhang, Z.; Wang, X.; Zhou, T.; Cui, Y.; Sha, J.; Huang, X.; Guerrero, L.; Xie, P.; et al. YTHDC1 mediates nuclear export of N(6)-methyladenosine methylated mRNAs. Elife 2017, 6. [Google Scholar] [CrossRef]
- Wang, X.; Lu, Z.; Gomez, A.; Hon, G.C.; Yue, Y.; Han, D.; Fu, Y.; Parisien, M.; Dai, Q.; Jia, G.; et al. N6-methyladenosine-dependent regulation of messenger RNA stability. Nature 2014, 505, 117–120. [Google Scholar] [CrossRef]
- Wang, X.; Zhao, B.S.; Roundtree, I.A.; Lu, Z.; Han, D.; Ma, H.; Weng, X.; Chen, K.; Shi, H.; He, C. N(6)-methyladenosine Modulates Messenger RNA Translation Efficiency. Cell 2015, 161, 1388–1399. [Google Scholar] [CrossRef] [Green Version]
- Zhao, X.; Yang, Y.; Sun, B.F.; Shi, Y.; Yang, X.; Xiao, W.; Hao, Y.J.; Ping, X.L.; Chen, Y.S.; Wang, W.J.; et al. FTO-dependent demethylation of N6-methyladenosine regulates mRNA splicing and is required for adipogenesis. Cell Res. 2014, 24, 1403–1419. [Google Scholar] [CrossRef] [PubMed]
- Fustin, J.M.; Doi, M.; Yamaguchi, Y.; Hida, H.; Nishimura, S.; Yoshida, M.; Isagawa, T.; Morioka, M.S.; Kakeya, H.; Manabe, I.; et al. RNA-methylation-dependent RNA processing controls the speed of the circadian clock. Cell 2013, 155, 793–806. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Geula, S.; Moshitch-Moshkovitz, S.; Dominissini, D.; Mansour, A.A.; Kol, N.; Salmon-Divon, M.; Hershkovitz, V.; Peer, E.; Mor, N.; Manor, Y.S.; et al. Stem cells. m6A mRNA methylation facilitates resolution of naive pluripotency toward differentiation. Science 2015, 347, 1002–1006. [Google Scholar] [CrossRef] [PubMed]
- Sun, T.; Wu, R.; Ming, L. The role of m6A RNA methylation in cancer. Biomed. Pharm. 2019, 112, 108613. [Google Scholar] [CrossRef] [PubMed]
- Winkler, R.; Gillis, E.; Lasman, L.; Safra, M.; Geula, S.; Soyris, C.; Nachshon, A.; Tai-Schmiedel, J.; Friedman, N.; Le-Trilling, V.; et al. m(6)A modification controls the innate immune response to infection by targeting type I interferons. Nat. Immunol. 2019, 20, 173–182. [Google Scholar] [CrossRef]
- Florencio-Silva, R.; Sasso, G.R.; Sasso-Cerri, E.; Simoes, M.J.; Cerri, P.S. Biology of Bone Tissue: Structure, Function and Factors That Influence Bone Cells. Biomed. Res. Int. 2015, 2015, 421746. [Google Scholar] [CrossRef] [Green Version]
- Gonciulea, A.; de Beur, S.J. The dynamic skeleton. Rev. Endocr. Metab. Disord. 2015, 16, 79–91. [Google Scholar] [CrossRef]
- Chen, X.; Wang, Z.; Duan, N.; Zhu, G.; Schwarz, E.M.; Xie, C. Osteoblast-osteoclast interactions. Connect. Tissue Res. 2018, 59, 99–107. [Google Scholar] [CrossRef]
- Raggatt, L.J.; Partridge, N.C. Cellular and molecular mechanisms of bone remodeling. J. Biol. Chem. 2010, 285, 25103–25108. [Google Scholar] [CrossRef] [Green Version]
- Boyle, W.J.; Simonet, W.S.; Lacey, D.L. Osteoclast differentiation and activation. Nature 2003, 423, 337–342. [Google Scholar] [CrossRef]
- Amarasekara, D.S.; Yun, H.; Kim, S.; Lee, N.; Kim, H.; Rho, J. Regulation of Osteoclast Differentiation by Cytokine Networks. Immune Netw. 2018, 18, e8. [Google Scholar] [CrossRef] [PubMed]
- Kim, J.H.; Kim, N. Signaling Pathways in Osteoclast Differentiation. Chonnam. Med. J. 2016, 52, 12–17. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Ono, T.; Nakashima, T. Recent advances in osteoclast biology. Histochem. Cell Biol. 2018, 149, 325–341. [Google Scholar] [CrossRef] [PubMed]
- Park, J.H.; Lee, N.K.; Lee, S.Y. Current Understanding of RANK Signaling in Osteoclast Differentiation and Maturation. Mol. Cells 2017, 40, 706–713. [Google Scholar] [PubMed] [Green Version]
- Bi, H.; Chen, X.; Gao, S.; Yu, X.; Xiao, J.; Zhang, B.; Liu, X.; Dai, M. Key Triggers of Osteoclast-Related Diseases and Available Strategies for Targeted Therapies: A Review. Front. Med. (Lausanne) 2017, 4, 234. [Google Scholar] [CrossRef]
- Shim, J.H.; Stavre, Z.; Gravallese, E.M. Bone Loss in Rheumatoid Arthritis: Basic Mechanisms and Clinical Implications. Calcif. Tissue Int. 2018, 102, 533–546. [Google Scholar] [CrossRef]
- Soysa, N.S.; Alles, N. Osteoclast function and bone-resorbing activity: An overview. Biochem. Biophys Res. Commun. 2016, 476, 115–120. [Google Scholar] [CrossRef]
- Park-Min, K.H. Mechanisms involved in normal and pathological osteoclastogenesis. Cell Mol. Life Sci. 2018, 75, 2519–2528. [Google Scholar] [CrossRef]
- Vrtacnik, P.; Marc, J.; Ostanek, B. Epigenetic mechanisms in bone. Clin. Chem. Lab. Med. 2014, 52, 589–608. [Google Scholar] [CrossRef]
- Husain, A.; Jeffries, M.A. Epigenetics and Bone Remodeling. Curr. Osteoporos Rep. 2017, 15, 450–458. [Google Scholar] [CrossRef]
- Tian, C.; Huang, Y.; Li, Q.; Feng, Z.; Xu, Q. Mettl3 Regulates Osteogenic Differentiation and Alternative Splicing of Vegfa in Bone Marrow Mesenchymal Stem Cells. Int. J. Mol. Sci. 2019, 20, 551. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Wu, Y.; Xie, L.; Wang, M.; Xiong, Q.; Guo, Y.; Liang, Y.; Li, J.; Sheng, R.; Deng, P.; Wang, Y.; et al. Mettl3-mediated m(6)A RNA methylation regulates the fate of bone marrow mesenchymal stem cells and osteoporosis. Nat. Commun. 2018, 9, 4772. [Google Scholar] [CrossRef] [PubMed]
- Lee, S.H.; Rho, J.; Jeong, D.; Sul, J.Y.; Kim, T.; Kim, N.; Kang, J.S.; Miyamoto, T.; Suda, T.; Lee, S.K.; et al. v-ATPase V0 subunit d2-deficient mice exhibit impaired osteoclast fusion and increased bone formation. Nat. Med. 2006, 12, 1403–1409. [Google Scholar] [CrossRef] [PubMed]
- Du, H.; Zhao, Y.; He, J.; Zhang, Y.; Xi, H.; Liu, M.; Ma, J.; Wu, L. YTHDF2 destabilizes m(6)A-containing RNA through direct recruitment of the CCR4-NOT deadenylase complex. Nat. Commun. 2016, 7, 12626. [Google Scholar] [CrossRef]
- Desrosiers, R.; Friderici, K.; Rottman, F. Identification of methylated nucleosides in messenger RNA from Novikoff hepatoma cells. Proc. Natl. Acad. Sci. USA 1974, 71, 3971–3975. [Google Scholar] [CrossRef] [Green Version]
- Wei, C.M.; Moss, B. Nucleotide sequences at the N6-methyladenosine sites of HeLa cell messenger ribonucleic acid. Biochem. US 1977, 16, 1672–1676. [Google Scholar] [CrossRef]
- Bi, Z.; Liu, Y.; Zhao, Y.; Yao, Y.; Wu, R.; Liu, Q.; Wang, Y.; Wang, X. A dynamic reversible RNA N(6)—methyladenosine modification: Current status and perspectives. J. Cell Physiol. 2019, 234, 7948–7956. [Google Scholar] [CrossRef]
- Dominissini, D.; Moshitch-Moshkovitz, S.; Schwartz, S.; Salmon-Divon, M.; Ungar, L.; Osenberg, S.; Cesarkas, K.; Jacob-Hirsch, J.; Amariglio, N.; Kupiec, M.; et al. Topology of the human and mouse m6A RNA methylomes revealed by m6A-seq. Nature 2012, 485, 201–206. [Google Scholar] [CrossRef]
- Jia, G.; Fu, Y.; He, C. Reversible RNA adenosine methylation in biological regulation. Trends Genet. 2013, 29, 108–115. [Google Scholar] [CrossRef] [Green Version]
- Wei, W.; Ji, X.; Guo, X.; Ji, S. Regulatory Role of N(6)—methyladenosine (m(6) A) Methylation in RNA Processing and Human Diseases. J. Cell Biochem. 2017, 118, 2534–2543. [Google Scholar] [CrossRef]
- Wu, Y.; Zhou, C.; Yuan, Q. Role of DNA and RNA N6-Adenine Methylation in Regulating Stem Cell Fate. Curr. Stem. Cell Res. Ther. 2018, 13, 31–38. [Google Scholar] [CrossRef] [PubMed]
- Zhang, C.; Fu, J.; Zhou, Y. A Review in Research Progress Concerning m6A Methylation and Immunoregulation. Front. Immunol. 2019, 10, 922. [Google Scholar] [CrossRef] [PubMed]
- Yasui, T.; Hirose, J.; Aburatani, H.; Tanaka, S. Epigenetic regulation of osteoclast differentiation. Ann. N. Y. Acad. Sci. 2011, 1240, 7–13. [Google Scholar] [CrossRef] [PubMed]
- Nishikawa, K.; Iwamoto, Y.; Kobayashi, Y.; Katsuoka, F.; Kawaguchi, S.; Tsujita, T.; Nakamura, T.; Kato, S.; Yamamoto, M.; Takayanagi, H.; et al. DNA methyltransferase 3a regulates osteoclast differentiation by coupling to an S-adenosylmethionine-producing metabolic pathway. Nat. Med. 2015, 21, 281–287. [Google Scholar] [CrossRef] [PubMed]
- Gao, Y.; Ge, W. The histone methyltransferase DOT1L inhibits osteoclastogenesis and protects against osteoporosis. Cell Death. Dis. 2018, 9, 33. [Google Scholar] [CrossRef] [Green Version]
- Lee, H.; Bao, S.; Qian, Y.; Geula, S.; Leslie, J.; Zhang, C.; Hanna, J.H.; Ding, L. Stage-specific requirement for Mettl3-dependent m(6)A mRNA methylation during haematopoietic stem cell differentiation. Nat. Cell Biol. 2019, 21, 1–10. [Google Scholar] [CrossRef]
- Wang, X.; Zhu, L.; Chen, J.; Wang, Y. mRNA m(6)A methylation downregulates adipogenesis in porcine adipocytes. Biochem. Biophys Res. Commun. 2015, 459, 201–207. [Google Scholar] [CrossRef]
- Yang, D.H.; Yang, M.Y. The Role of Macrophage in the Pathogenesis of Osteoporosis. Int. J. Mol. Sci. 2019, 20, 2093. [Google Scholar] [CrossRef] [Green Version]
- Zhang, D.; Jing, J.; Lou, F.; Li, R.; Ping, Y.; Yu, F.; Wu, F.; Yang, X.; Xu, R.; Li, F.; et al. Evidence for excessive osteoclast activation in SIRT6 null mice. Sci Rep. 2018, 8, 10992. [Google Scholar] [CrossRef] [Green Version]
- Gritsaenko, T.; Pierrefite-Carle, V.; Lorivel, T.; Breuil, V.; Carle, G.F.; Santucci-Darmanin, S. Natural uranium impairs the differentiation and the resorbing function of osteoclasts. Biochim. Biophys Acta. Gen. Sub. 2017, 1861, 715–726. [Google Scholar] [CrossRef]
- Zarei, A.; Morovat, A.; Javaid, K.; Brown, C.P. Vtamin D receptor expression in human bone tissue and dose-dependent activation in resorbing osteoclasts. Bone Res. 2016, 4, 16030. [Google Scholar] [CrossRef] [PubMed]
- Menendez-Gutierrez, M.P.; Roszer, T.; Fuentes, L.; Nunez, V.; Escolano, A.; Redondo, J.M.; De Clerck, N.; Metzger, D.; Valledor, A.F.; Ricote, M. Retinoid X receptors orchestrate osteoclast differentiation and postnatal bone remodeling. J. Clin. Investig. 2015, 125, 809–823. [Google Scholar] [CrossRef] [PubMed]
- Xia, Y.; Liu, N.; Xie, X.; Bi, G.; Ba, H.; Li, L.; Zhang, J.; Deng, X.; Yao, Y.; Tang, Z.; et al. The macrophage-specific V-ATPase subunit ATP6V0D2 restricts inflammasome activation and bacterial infection by facilitating autophagosome-lysosome fusion. Autophagy 2019, 15, 960–975. [Google Scholar] [CrossRef] [PubMed]
- Jaber, F.A.; Khan, N.M.; Ansari, M.Y.; Al-Adlaan, A.A.; Hussein, N.J.; Safadi, F.F. Autophagy plays an essential role in bone homeostasis. J. Cell Physiol. 2019, 234, 12105–12115. [Google Scholar] [CrossRef]
- DeSelm, C.J.; Miller, B.C.; Zou, W.; Beatty, W.L.; van Meel, E.; Takahata, Y.; Klumperman, J.; Tooze, S.A.; Teitelbaum, S.L.; Virgin, H.W. Autophagy proteins regulate the secretory component of osteoclastic bone resorption. Dev. Cell 2011, 21, 966–974. [Google Scholar] [CrossRef] [Green Version]
- Sambandam, Y.; Townsend, M.T.; Pierce, J.J.; Lipman, C.M.; Haque, A.; Bateman, T.A.; Reddy, S.V. Microgravity control of autophagy modulates osteoclastogenesis. Bone 2014, 61, 125–131. [Google Scholar] [CrossRef] [Green Version]
- Feng, Z.; Li, Q.; Meng, R.; Yi, B.; Xu, Q. METTL3 regulates alternative splicing of MyD88 upon the lipopolysaccharide-induced inflammatory response in human dental pulp cells. J. Cell Mol. Med. 2018, 22, 2558–2568. [Google Scholar] [CrossRef]
- Lin, S.; Liu, J.; Jiang, W.; Wang, P.; Sun, C.; Wang, X.; Chen, Y.; Wang, H. METTL3 Promotes the Proliferation and Mobility of Gastric Cancer Cells. Open Med. (Wars) 2019, 14, 25–31. [Google Scholar] [CrossRef] [Green Version]
- Darnay, B.G.; Besse, A.; Poblenz, A.T.; Lamothe, B.; Jacoby, J.J. TRAFs in RANK signaling. Adv. Exp. Med. Biol. 2007, 597, 152–159. [Google Scholar]
- Naito, A.; Azuma, S.; Tanaka, S.; Miyazaki, T.; Takaki, S.; Takatsu, K.; Nakao, K.; Nakamura, K.; Katsuki, M.; Yamamoto, T.; et al. Severe osteopetrosis, defective interleukin-1 signalling and lymph node organogenesis in TRAF6-deficient mice. Genes Cells 1999, 4, 353–362. [Google Scholar] [CrossRef]
- Tanaka, S. Signaling axis in osteoclast biology and therapeutic targeting in the RANKL/RANK/OPG system. Am. J. Nephrol. 2007, 27, 466–478. [Google Scholar] [CrossRef] [PubMed]
- Zheng, Q.; Hou, J.; Zhou, Y.; Li, Z.; Cao, X. The RNA helicase DDX46 inhibits innate immunity by entrapping m(6)A-demethylated antiviral transcripts in the nucleus. Nat. Immunol. 2017, 18, 1094–1103. [Google Scholar] [CrossRef] [PubMed]
- Zong, X.; Zhao, J.; Wang, H.; Lu, Z.; Wang, F.; Du, H.; Wang, Y. Mettl3 Deficiency Sustains Long-Chain Fatty Acid Absorption through Suppressing Traf6-Dependent Inflammation Response. J. Immunol. 2019, 202, 567–578. [Google Scholar] [CrossRef] [PubMed]
shRNA No. | Target Sequences |
---|---|
Mettl3-sh1 | GCACCCGCAAGATTGAGTTAT |
Mettl3-sh2 | CGTCAGTATCTTGGGCAAATT |
Mettl3-sh3 | CCAGTCATAAACCAGATGAAA |
siRNA | Sequences (5′-3′) |
---|---|
#1 siRNA | CCAUGAUUGAUGGACAGUCAGCUUU |
AAAGCUGACUGUCCAUCAAUCAUGG | |
#2 siRNA | GGGUGGAUGGUAAUGGAGUAGGACA |
UGUCCUACUCCAUUACCAUCCACCC |
Forward Primer (5′-3′) | Reverse Primer (5′-3′) | |
---|---|---|
Mettl3 | CTTTCTACCCCATCTTGAGTG | CCAACCTTCCGTAGTGATAGTC |
Fto | GACTCGTCCTCACTTTCATCC | AAGAGCAGAGCAGCCTACAAC |
Alkbh5 | GTGGGACCTTTTGGGTTTCAG | GCATACGGCCTCAGGACATTA |
Ctsk | CACCCAGTGGGAGCTATGGAA | GCCTCCAGGTTATGGGCAGA |
Acp5 | ACCTTGGCAACGTCTCTGCAC | GTCCAGCATAAAGATGGCCACA |
Nfatc1 | CCCGTCACATTCTGGTCCAT | CAAGTAACCGTGTAGCTGCACAA |
c-Fos | CGGCATCATCTAGGCCCAG | TCTGCTGCATAGAAGGAACCG |
Dcstamp | TACGTGGAGAGAAGCAAGGAA | ACACTGAGACGTGGTTTAGGAAT |
Atp6v0d2 | CAGAGCTGTACTTCAATGTGGC | AGGTCTCACACTGCACTAGGT |
Traf6 | ATGCAGAGGAATCACTTGGCA | ACGGACGCAAAGCAAGGTT |
Ythdf2 | AGGCGGGTTCTGGATCTACT | ACCCGGCCATGTTTCAGATT |
U6 | CTCGCTTCGGCAGCACA | AACGCTTCACGAATTTGCGT |
Actb | CATACCCAAGAAGGAAGGCTGG | GCTATGTTGCTCTAGACTTCGAC |
Gadph | TGACCACAGTCCATGCCATC | GACGGACACATTGGGGGTAG |
© 2020 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (http://creativecommons.org/licenses/by/4.0/).
Share and Cite
Li, D.; Cai, L.; Meng, R.; Feng, Z.; Xu, Q. METTL3 Modulates Osteoclast Differentiation and Function by Controlling RNA Stability and Nuclear Export. Int. J. Mol. Sci. 2020, 21, 1660. https://doi.org/10.3390/ijms21051660
Li D, Cai L, Meng R, Feng Z, Xu Q. METTL3 Modulates Osteoclast Differentiation and Function by Controlling RNA Stability and Nuclear Export. International Journal of Molecular Sciences. 2020; 21(5):1660. https://doi.org/10.3390/ijms21051660
Chicago/Turabian StyleLi, Di, Luhui Cai, Runsha Meng, Zhihui Feng, and Qiong Xu. 2020. "METTL3 Modulates Osteoclast Differentiation and Function by Controlling RNA Stability and Nuclear Export" International Journal of Molecular Sciences 21, no. 5: 1660. https://doi.org/10.3390/ijms21051660