Insulin-Like Peptide Receptor-Mediated Signaling Pathways Orchestrate Regulation of Growth in the Pacific Oyster (Crassostrea gigas), as Revealed by Gene Expression Profiles
Abstract
:1. Introduction
2. Results
2.1. Identification of ILPR, IRS, IGFBP, and IGFALS in C. gigas
2.2. Comparison of the Expression Profiles of the IIS, PI3K-AKT, and RAS-MAPK Signaling Pathway Genes between “Haida No.1” and Wild Oysters
2.3. Effect of Nutrient Abundance on the IIS, PI3K-AKT, and RAS-MAPK Signaling Pathway Genes in C. gigas
2.4. Effect of Temperature on the IIS, PI3K-AKT, and RAS-MAPK Signaling Pathway Genes in C. gigas
3. Discussion
4. Materials and Methods
4.1. Sequence Analysis
4.2. Real-Time PCR and Statistical Analysis
4.3. Expression Profiles of the Major Genes in the IIS, PI3K-AKT, and RAS-MAPK Signaling Pathways
4.4. Fasting and Re-Feeding Culture Experiment
4.5. Low Temperature Culture Experiment
5. Conclusions
Supplementary Materials
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Conflicts of Interest
Abbreviations
IIS | Insulin/insulin-like growth factor (IIS) signaling |
IRS | Insulin receptor substrate |
IGFBPRP | Insulin-like growth factor-binding protein-related protein 1 |
IGFALS | Insulin-like growth factor-binding protein complex acid labile subunits |
ILPR | Insulin-like peptide receptor |
PI3K | Phosphoinositide 3-kinase |
AKT | Protein kinase B |
TOR | target of rapamycin |
AMPK | monophosphate-activated protein |
References
- Templeman, N.M.; Murphy, C.T. Regulation of reproduction and longevity by nutrient-sensing pathways. J. Cell Biol. 2018, 217, 93–106. [Google Scholar] [CrossRef]
- Liu, G.Y.; Sabatini, D.M. mTOR at the nexus of nutrition, growth, ageing and disease. Nat. Rev. Mol. Cell Biol. 2020, 21, 183–203. [Google Scholar] [CrossRef] [PubMed]
- Plum, L.; Belgardt, B.F.; Brüning, J.C. Central insulin action in energy and glucose homeostasis. J. Clin. Investig. 2006, 116, 1761–1766. [Google Scholar] [CrossRef] [PubMed]
- Duan, C.; Ren, H.; Gao, S. Insulin-like growth factors (IGFs), IGF receptors, and IGF-binding proteins: Roles in skeletal muscle growth and differentiation. Gen. Comp. Endocrinol. 2010, 167, 344–351. [Google Scholar] [CrossRef] [PubMed]
- Laviola, L.; Natalicchio, A.; Giorgino, F. The IGF-I signaling pathway. Curr. Pharm. Des. 2007, 13, 663–669. [Google Scholar] [CrossRef] [PubMed]
- Fu, Z.; Gilbert, E.R.; Liu, D. Regulation of Insulin Synthesis and Secretion and Pancreatic Beta-Cell Dysfunction in Diabetes. Curr. Diabetes Rev. 2013, 9, 25–53. [Google Scholar] [CrossRef] [PubMed]
- Bianchi, V.E.; Locatelli, V.; Rizzi, L. Neurotrophic and Neuroregenerative Effects of GH/IGF1. Int. J. Mol. Sci. 2017, 18, 2441–2466. [Google Scholar] [CrossRef] [Green Version]
- Moore, B.; Whitehead, A.; Davies, K. Short Stature, Growth Hormone Deficiency, and Primary IGF-1 Deficiency. In Advanced Practice in Endocrinology Nursing; Llahana, S., Follin, C., Yedinak, C., Grossman, A., Eds.; Springer: Cham, Switzerland, 2019. [Google Scholar] [CrossRef]
- Allard, J.B.; Duan, C. IGF-Binding Proteins: Why Do They Exist and Why Are There So Many? Front. Endocrinol. 2018, 9, 117–129. [Google Scholar] [CrossRef] [Green Version]
- Hakuno, F.; Takahashi, S.I. IGF1 receptor signaling pathways. J. Mol. Endocrinol. 2018, 61, T69–T86. [Google Scholar] [CrossRef] [Green Version]
- Khan, H.R.; Griffond, B.; Saleuddin, A.S. Insulin-like peptide(s) in the central nervous system of the snail Helisoma duryi. Brain Res. 1992, 580, 111–114. [Google Scholar] [CrossRef]
- Nässel, D.R.; Vanden Broeck, J. Insulin/IGF signaling in Drosophila and other insects: Factors that regulate production, release and post-release action of the insulin-like peptides. Cell. Mol. Life Sci. 2016, 73, 271–290. [Google Scholar] [CrossRef] [PubMed]
- Satake, S.; Masumura, M.; Ishizaki, H.; Nagata, K.; Kataoka, H.; Suzuki, A.; Mizoguchi, A. Bombyxin, an insulin-related peptide of insects, reduces the major storage carbohydrates in the silkworm Bombyx mori. Comp. Biochem. Physiol. B Biochem. Mol. Biol. 1997, 118, 349–357. [Google Scholar] [CrossRef]
- Geraerts, W.P. Control of growth by the neurosecretory hormone of the light green cells in the freshwater snail Lymnaea stagnalis. Gen. Comp. Endocrinol. 1976, 29, 61–71. [Google Scholar] [CrossRef]
- Gomot, A.; Gomot, L.; Marchand, C.R.; Colard, C.; Bride, J. Immunocytochemical localization of insulin-related peptide(s) in the central-nervous-system of the snail helix-aspersa muller—Involvement in growth-control. Cell. Mol. Neurobiol. 1992, 12, 21–32. [Google Scholar] [CrossRef] [PubMed]
- Gorczyca, M.; Augart, C.; Budnik, V. Insulin-like receptor and insulin-like peptide are localized at neuromuscular junctions in Drosophila. J. Neurosci. 1993, 13, 3692–3704. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Schot, L.P.; Boer, H.H.; Swaab, D.F.; Van Noorden, S. Immunocytochemical demonstration of peptidergic neurons in the central nervous system of the pond snail Lymnaea stagnalis with antisera raised to biologically active peptides of vertebrates. Cell Tissue Res. 1981, 216, 273–291. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Smit, A.B.; Vreugdenhil, E.; Ebberink, R.H.; Geraerts, W.P.; Klootwijk, J.; Joosse, J. Growth-controlling molluscan neurons produce the precursor of an insulin-related peptide. Nature 1988, 331, 535–538. [Google Scholar] [CrossRef]
- Brogiolo, W.; Stocker, H.; Ikeya, T.; Rintelen, F.; Fernandez, R.; Hafen, E. An evolutionarily conserved function of the Drosophila insulin receptor and insulin-like peptides in growth control. Curr. Biol. 2001, 11, 213–221. [Google Scholar] [CrossRef] [Green Version]
- Shi, Y.; Guan, Y.; He, M. Molecular identification of insulin-related peptide receptor and its potential role in regulating development in Pinctada fucata. Aquaculture 2013, 408, 118–127. [Google Scholar] [CrossRef] [Green Version]
- Nässel, D.R.; Liu, Y.; Luo, J. Insulin/IGF signaling and its regulation in Drosophila. Gen. Comp. Endocrinol. 2015, 221, 255–266. [Google Scholar] [CrossRef] [PubMed]
- Honegger, B.; Galic, M.; Köhler, K.; Wittwer, F.; Brogiolo, W.; Hafen, E.; Stocker, H. Imp-L2, a putative homolog of vertebrate IGF-binding protein 7, counteracts insulin signaling in Drosophila and is essential for starvation resistance. J. Biol. 2008, 7, 10–21. [Google Scholar] [CrossRef] [Green Version]
- Li, N.; Zhang, Z.; Zhang, L.; Wang, S.; Zou, Z.; Wang, G.; Wang, Y. Insulin-like growth factor binding protein 7, a member of insulin-like growth factor signal pathway, involved in immune response of small abalone Haliotis diversicolor. Fish. Shellfish Immunol. 2012, 33, 229–242. [Google Scholar] [CrossRef]
- Feng, L.; Li, X.; Yu, Q.; Ning, X.; Dou, J.; Zou, J.; Zhang, L.; Wang, S.; Hu, X.; Bao, Z. A scallop IGF binding protein gene: Molecular characterization and association of variants with growth traits. PLoS ONE 2014, 9, e89039. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Rosen, O.; Weil, S.; Manor, R.; Roth, Z.; Khalaila, I.; Sagi, A. A crayfish insulin-like-binding protein: Another piece in the androgenic gland insulin-like hormone puzzle is revealed. J. Biol. Chem. 2013, 288, 22289–22298. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Chandler, J.C.; Aizen, J.; Elizur, A.; Hollander-Cohen, L.; Battaglene, S.C.; Ventura, T. Discovery of a novel insulin-like peptide and insulin binding proteins in the Eastern rock lobster Sagmariasus verreauxi. Gen. Comp. Endocrinol. 2015, 215, 76–87. [Google Scholar] [CrossRef]
- Li, F.; Bai, H.; Xiong, Y.; Fu, H.; Jiang, S.; Jiang, F.; Jin, S.; Sun, S.; Qiao, H.; Zhang, W. Molecular characterization of insulin-like androgenic gland hormone-binding protein gene from the oriental river prawn Macrobrachium nipponense and investigation of its transcriptional relationship with the insulin-like androgenic gland hormone gene. Gen. Comp. Endocrinol. 2015, 216, 152–160. [Google Scholar] [CrossRef] [PubMed]
- Jouaux, A.; Franco, A.; Heude-Berthelin, C.; Sourdaine, P.; Blin, J.L.; Mathieu, M.; Kellner, K. Identification of Ras, Pten and p70S6K homologs in the Pacific oyster Crassostrea gigas and diet control of insulin pathway. Gen. Comp. Endocrinol. 2012, 176, 28–38. [Google Scholar] [CrossRef] [PubMed]
- Claeys, I.; Simonet, G.; Poels, J.; Van Loy, T.; Vercammen, L.; De Loof, A.; Vanden Broeck, J. Insulin-related peptides and their conserved signal transduction pathway. Peptides 2002, 23, 807–816. [Google Scholar] [CrossRef]
- Murphy, C.T.; Hu, P.J. Insulin/insulin-like growth factor signaling in C. elegans. In WormBook: The Online Review of C. elegans Biology; WormBook, Ed.; The C. elegans Research Community: Pasadena, CA, USA, 2013; pp. 1–43. [Google Scholar]
- Choi, Y.H.; Kim, E.-Y.; Nam, T.J. Involvement of insulin-like growth factor in intraspecific variation in growth of Pacific oyster Crassostrea gigas during winter. Fish. Sci. 2018, 84, 1017–1024. [Google Scholar] [CrossRef]
- Kim, E.-Y.; Choi, Y.H. Regulation of adductor muscle growth by the IGF-1/AKT pathway in the triploid Pacific oyster, Crassostrea gigas. Fish. Aquat. Sci. 2019, 22, 19–29. [Google Scholar] [CrossRef] [Green Version]
- Shi, Y.; He, M.X. PfIRR Interacts with HrIGF-I and Activates the MAP-kinase and PI3-kinase Signaling Pathways to Regulate Glycogen Metabolism in Pinctada fucata. Sci. Rep. 2016, 6, 22063. [Google Scholar] [CrossRef] [Green Version]
- Umezaki, Y.; Hayley, S.E.; Chu, M.L.; Seo, H.W.; Shah, P.; Hamada, F.N. Feeding-State-Dependent Modulation of Temperature Preference Requires Insulin Signaling in Drosophila Warm-Sensing Neurons. Curr. Biol. 2018, 28, 779–787. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Hyun, S. Body size regulation and insulin-like growth factor signaling. Cell. Mol. Life Sci. 2013, 70, 2351–2365. [Google Scholar] [CrossRef]
- Zhang, H.; He, M. The role of a new insulin-like peptide in the pearl oyster Pinctada fucata martensii. Sci. Rep. 2020, 10, 433–460. [Google Scholar] [CrossRef] [Green Version]
- Troost, K. Causes and effects of a highly successful marine invasion: Case-study of the introduced Pacific oyster Crassostrea gigas in continental NW European estuaries. J. Sea Res. 2010, 64, 145–165. [Google Scholar] [CrossRef]
- Zhang, F.; Hu, B.; Fu, H.; Jiao, Z.; Li, Q.; Liu, S. Comparative Transcriptome Analysis Reveals Molecular Basis Underlying Fast Growth of the Selectively Bred Pacific Oyster, Crassostrea gigas. Front. Genet. 2019, 10, 610. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Zhang, J.; Li, Q.; Xu, C.; Han, Z. Response to selection for growth in three selected strains of the Pacific oyster Crassostrea gigas. Aquaculture 2019, 503, 34–39. [Google Scholar] [CrossRef]
- Li, Y.; Fu, H.; Zhang, F.; Ren, L.; Tian, J.; Li, Q.; Liu, S. Identification, characterization, and expression profiles of insulin-like peptides suggest their critical roles in growth regulation of the Pacific oyster, Crassostrea gigas. Gene 2021, 769, 145244. [Google Scholar] [CrossRef] [PubMed]
- Haeusler, R.A.; McGraw, T.E.; Accili, D. Biochemical and cellular properties of insulin receptor signalling. Nat. Rev. Mol. Cell Biol. 2018, 19, 31–44. [Google Scholar] [CrossRef]
- Payankaulam, S.; Raicu, A.M.; Arnosti, D.N. Transcriptional Regulation of INSR, the Insulin Receptor Gene. Genes 2019, 10, 984–1006. [Google Scholar] [CrossRef] [Green Version]
- Huang, X.; Ye, H.; Feng, B.; Huang, H. Insights into insulin-like peptide system in invertebrates from studies on IGF binding domain-containing proteins in the female mud crab, Scylla paramamosain. Mol. Cell. Endocrinol. 2015, 416, 36–45. [Google Scholar] [CrossRef] [PubMed]
- Renes, J.; van Doorn, J.; Breukhoven, P.; Lem, A.; de Ridder, M.; Hokken-Koelega, A. Acid-labile subunit levels and the association with response to growth hormone treatment in short children born small for gestational age. Horm. Res. Paediatr. 2014, 81, 126–132. [Google Scholar] [CrossRef] [PubMed]
- Domené, H.; Scaglia, P.; Martínez, A.; Keselman, A.; Karabatas, L.; Pipman, V.R. Heterozygous IGFALS gene variants in idiopathic short stature and normal children: Impact on height and the IGF system. Horm. Res. Paediatr. 2013, 80, 413–423. [Google Scholar] [CrossRef] [PubMed]
- Boisclair, Y.R.; Hurst, K.R.; Ueki, I.; Tremblay, M.L.; Ooi, G.T. Regulation and role of the acid-labile subunit of the 150-kilodalton insulin-like growth factor complex in the mouse. Pediatr. Nephrol. (Berlin, Germany) 2000, 14, 562–566. [Google Scholar] [CrossRef] [PubMed]
- Whitehead, J.P.; Clark, S.F.; Ursø, B.; James, D.E. Signalling through the insulin receptor. Curr. Opin. Cell Biol. 2000, 12, 222–228. [Google Scholar] [CrossRef]
- Sun, Y.; Liu, W.; Liu, T.; Feng, X.; Yang, N.; Zhou, H. Signaling pathway of MAPK/ERK in cell proliferation, differentiation, migration, senescence and apoptosis. J. Recept. Signal. Transduct. Res. 2015, 35, 600–604. [Google Scholar] [CrossRef] [PubMed]
- Taniguchi, C.; Emanuelli, B.; Kahn, C. Critical nodes in signalling pathways: Insights into insulin action. Nat. Rev. Mol. Cell Biol. 2006, 7, 85–96. [Google Scholar] [CrossRef]
- Saxton, R.; Sabatini, D.M. mTOR Signaling in Growth, Metabolism, and Disease. Cell 2017, 168, 960–976. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Li, Y.; Lu, L.; Luo, N.; Wang, Y.; Gao, H. Inhibition of PI3K/AKt/mTOR signaling pathway protects against d-galactosamine/lipopolysaccharide-induced acute liver failure by chaperone-mediated autophagy in rats. Biomed. Pharmacother. 2017, 92, 544–553. [Google Scholar] [CrossRef] [PubMed]
- Emilie, V.H.; Seong-Il, L.; Sricharan, B.; Griffin, T.J.; Do-Hyung, K. Insulin signalling to mTOR mediated by the Akt/PKB substrate PRAS40. Nat. Cell Biol. 2007, 9, 316–323. [Google Scholar]
- Magnuson, B.; Ekim, B.; Fingar, D. Regulation and function of ribosomal protein S6 kinase (S6K) within mTOR signalling networks. Biochem. J. 2012, 441, 1–21. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Bouskila, M.; Hirshman, M.F.; Jensen, J.; Goodyear, L.; Sakamoto, K. Insulin promotes glycogen synthesis in the absence of GSK3 phosphorylation in skeletal muscle. Am. J. Physiol. Endocrinol. Metab. 2008, 294, E28–E35. [Google Scholar] [CrossRef] [PubMed]
- Lee, S.; Dong, H. FoxO integration of insulin signaling with glucose and lipid metabolism. J. Endocrinol. 2017, 233, R67–R79. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Kumar, S.; Stecher, G.; Tamura, K. MEGA7: Molecular evolutionary genetics analysis version 7.0 for bigger datasets. Mol. Biol. Evol. 2016, 33, 1870–1874. [Google Scholar] [CrossRef] [PubMed] [Green Version]
Gene Name | Gene Full Name | Amino Acid (aa) | mRNA (bp) | ORF (bp) | NCBI Gene ID |
---|---|---|---|---|---|
ILPR | Insulin-like peptide receptor | 1561 | 9092 | 4686 | 105348544 |
IRS | Insulin receptor substrate 1-B | 1400 | 6375 | 4203 | 105342662 |
IGFBPRP | Insulin-like growth factor-binding protein-related protein 1 | 258 | 1926 | 777 | 105339347 |
ALS4336 | Insulin-like growth factor-binding protein complex acid labile subunit | 858 | 3189 | 2577 | 105331921 |
ALS7489 | Insulin-like growth factor-binding protein complex acid labile subunit | 1000 | 3987 | 3003 | 105342288 |
ALS5594 | Insulin-like growth factor-binding protein complex acid labile subunit | 978 | 4175 | 2937 | 105319673 |
ALS1089 | Insulin-like growth factor-binding protein complex acid labile subunit | 456 | 4620 | 1371 | 105324304 |
ALS2466 | Insulin-like growth factor-binding protein complex acid labile subunit | 913 | 4713 | 2744 | 105338877 |
ALS7789 | Insulin-like growth factor-binding protein complex acid labile subunit | 780 | 2607 | 2343 | 105342519 |
ALS6223 | Insulin-like growth factor-binding protein complex acid labile subunit | 349 | 1726 | 1050 | 105320119 |
Gene Name | Forward Primer (5′-3′) | Reverse Primer (5′-3′) |
---|---|---|
ILPR | ACCAGGGACTGTCCAATGAG | GGTCTGTAGCGCCAACATTT |
IRS | TGTGGGTCAGGAAGGGAATC | CCAAACGAGCCTGACCTAGA |
IGFBPRP | ACCTCGCCTGTAAGATGGAC | TCGGTACCACAGAGTGTGTC |
ALS5594 | GGCCGCTTATGCTAATGGAG | ACTCGTCCAACACATCCTGT |
ALS7789 | GTCTCCCGAGGGACATACTG | GTGCAACGTCTGAATCTCGT |
ALS7489 | TTCCTCGAGAACACGGACAT | AGGTGTTGGAAGGTGTAGGG |
ALS2466 | AACAGGCACTACCCAAGGTT | TAGAGGAAGCGGTGGTTTGT |
ALS6223 | CGAGCGTCAAAGATGTCCTG | TCGATCCCGATCCGTTTGAT |
ALS1089 | TCAACAACACAGCGTGCTTA | CATTTGAAAGCGGTGCCATC |
ALS4336 | CCACAGAACGCCTTTGAGAG | GGGAACTGCTGAACGAACTC |
PI3K | TCCGTTCACATACCAAACGC | GGGCAGAGTGGCTTCATAGA |
PDK | CATCAAGGTGCTGGAGAAGC | CTGTCTGTGTCCTGGAAGGT |
AKT | AGAGGTTGCTCCAATCGTCA | ATGAAACACGCCATCAGCTC |
GSK3β | CTAGCCTACATCCACTCGCA | AGGAGCCCTGTAGTAACGTG |
mTOR | ACGTGACAAGACCTCCACAT | CAGGATCCCGGGAAGGTATC |
FoxO | TCGCTACTACAGCGTTGTCT | GCCTGTCGTAGAAGCGAATC |
PTEN | ACAAGATGGCGGATGTTGTG | GGGTTGTGGTCATCGAATGG |
RAS | GACCCGACCATAGAGGACAG | TCCCTGCCCATTCTTCATGT |
MAPK | TGGCTGTATCCTGGCAGAAA | TGTTCCATGGGACTTTGGGT |
ERK | GCAATGGATCCACCACTTCC | ACGTGTTACCATGCACACTG |
EF1α | AGTCACCAAGGCTGCACAGAAAG | TCCGACGTATTTCTTTGCGATGT |
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations. |
© 2021 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Li, Y.; Fu, H.; Zhang, F.; Ren, L.; Tian, J.; Li, Q.; Liu, S. Insulin-Like Peptide Receptor-Mediated Signaling Pathways Orchestrate Regulation of Growth in the Pacific Oyster (Crassostrea gigas), as Revealed by Gene Expression Profiles. Int. J. Mol. Sci. 2021, 22, 5259. https://doi.org/10.3390/ijms22105259
Li Y, Fu H, Zhang F, Ren L, Tian J, Li Q, Liu S. Insulin-Like Peptide Receptor-Mediated Signaling Pathways Orchestrate Regulation of Growth in the Pacific Oyster (Crassostrea gigas), as Revealed by Gene Expression Profiles. International Journal of Molecular Sciences. 2021; 22(10):5259. https://doi.org/10.3390/ijms22105259
Chicago/Turabian StyleLi, Yongjing, Huiru Fu, Fuqiang Zhang, Liting Ren, Jing Tian, Qi Li, and Shikai Liu. 2021. "Insulin-Like Peptide Receptor-Mediated Signaling Pathways Orchestrate Regulation of Growth in the Pacific Oyster (Crassostrea gigas), as Revealed by Gene Expression Profiles" International Journal of Molecular Sciences 22, no. 10: 5259. https://doi.org/10.3390/ijms22105259