Suppression of NtZIP4A/B Changes Zn and Cd Root-to-Shoot Translocation in a Zn/Cd Status-Dependent Manner
Abstract
:1. Background
2. Results
2.1. Generation and General Characteristics of NtZIP4A/B-RNAi Tobacco Plants
2.2. Suppression of NtZIP4A/B Decreased Efficiency of Zn/Cd Status-Dependent Zn and Cd Translocation of Both Metals to Shoots
2.3. Changes in the Accumulation of Zn and Cd in the Root Parts of NtZIP4A/B-RNAi Plants
2.4. Zinpyr-1 Based Determination of Zn Localization in the Root Parts
2.5. Spatial Expression Pattern of NtZIP4B in the Root Parts Depends on the Combinations of Zn/Cd Concentrations in the Medium
2.6. Zn/Cd Status-Dependent Expression of Tobacco ZIP Genes in the Root Parts of NtZIP4A/B-RNAi Plants
2.7. 65Zn Based Analysis of Zn Translocation to Shoots
3. Discussion
3.1. Suppression of NtZIP4A/B Decreased Zn Translocation to Shoots at 1 µM Zn + 1 µM Cd
3.2. Suppression of NtZIP4A/B Decreases Cd Translocation to Shoots in Zn-Deficient Medium Supplemented with 0.25 µM Cd
4. Methods
4.1. Plant Material and General Growth Conditions
4.2. Generation of NtZIP4A/B RNAi Plants
4.3. Experiments to Investigate the Expression Pattern
4.4. Determination of Zn and Cd Concentrations
4.5. GUS-Based Analysis of NtZIP4B Spatial Expression in Root Parts
4.6. Determination of Zn Localization in Root Parts
4.7. 65Zn Radiolabeling Experiments
4.8. Statistical Analysis
Supplementary Materials
Author Contributions
Funding
Conflicts of Interest
Abbreviations
Cd. | Cadmium |
GUS | β-glucuronidase |
RNAi | RNA interference |
ZIP | ZRT-IRT-like Proteins |
Zn | Zinc |
References
- Hart, J.J.; Welch, R.M.; Norvell, W.A.; Kochian, L.V. Transport interactions between cadmium and zinc in roots of bread and durum wheat seedlings. Physiol. Plant 2002, 116, 73–78. [Google Scholar] [CrossRef]
- Papoyan, A.; Pineros, M.; Kochian, L.V. Plant Cd2+ and Zn2+ status effects on root and shoot heavy metal accumulation in Thlaspi caerulescens. New Phytol. 2007, 175, 51–58. [Google Scholar] [CrossRef]
- Chaney, R.L. How does contamination of rice soils with Cd and Zn cause high incidence of human Cd disease in subsistence rice farmers. Curr. Pollut. Rep. 2015, 1, 13–22. [Google Scholar] [CrossRef]
- Paul, A.L.D.; Chaney, R.L. Effect of soil amendments on Cd accumulation by spinach from a Cd-mineralized soil. J. Environ. Qual. 2017, 46, 707–713. [Google Scholar] [CrossRef]
- He, Y.; Green, C.E.; Chaney, R.L.; Tan, F.; Ye, H.; Mei, V.; Kurti, M.; Lampe, K. Elemental profile of tobacco used in counterfeit cigarettes and increased cadmium risk to smokers. Integrat. J. Environ. Earth Sci. 2020, 01, 33–37. [Google Scholar]
- Herzig, R.; Nehnevajova, E.; Pfistner, C.; Schwitzguebel, J.-P.; Ricci, A.; Keller, C. Feasibility of labile Zn phytoextraction using enhanced tobacco and sunflower: Results of five- and one-year field-scale experiments in Switzerland. Int. J. Phytoremed. 2014, 16, 735–754. [Google Scholar] [CrossRef] [PubMed]
- Vera-Estrella, R.; Gómez-Méndez, M.F.; Amezcua-Romero, J.C.; Barkla, B.J.; Rosas-Santiago, P.; Pantoja, O. Cadmium and zinc activate adaptive mechanisms in Nicotiana tabacum similar to those observed in metal tolerant plants. Planta 2017, 246, 433–451. [Google Scholar] [CrossRef] [PubMed]
- Pilon, M.; Cohu, C.; Ravet, K.; Abdel-Ghany, S.E.; Gaymard, F. Essential transition metal homeostasis in plants. Curr. Opin. Plant Biol. 2009, 12, 347–357. [Google Scholar] [CrossRef]
- Ricachenevsky, F.K.; Menguer, P.K.; Sperotto, R.A.; Fett, J.P. Got to hide your Zn away: Molecular control of Zn accumulation and biotechnological applications. Plant Sci. 2015, 236, 1–17. [Google Scholar] [CrossRef]
- Yang, X.; Li, T.; Yang, J.; He, Z.; Lu, L.; Meng, F. Zinc compartmentation in root, transport into xylem, and absorption into leaf cells in the hyperaccumulating species of Sedum alfredii Hance. Planta 2006, 224, 185–195. [Google Scholar] [CrossRef]
- Lasat, M.M.; Baker, A.J.; Kochian, L.V. Altered zinc compartmentation in the root symplasm and stimulated Zn2+ absorption into the leaf as mechanisms involved in zinc hyperaccumulation in Thlaspi caerulescens. Plant Physiol. 1998, 118, 875–883. [Google Scholar] [CrossRef] [Green Version]
- Xing, J.P.; Jiang, R.F.; Ueno, D.; Ma, J.F.; Schat, H.; McGrath, S.P.; Zhao, F.J. Variation in root-to-shoot translocation of cadmium and zinc among different accessions of the hyperaccumulators Thlaspi caerulescens and Thlaspi praecox. New Phytol. 2008, 178, 315–325. [Google Scholar] [CrossRef] [PubMed]
- Ueno, D.; Yamaji, N.; Kono, I.; Huang, C.F.; Ando, T.; Yano, M.; Ma, J.F. Gene limiting cadmium accumulation in rice. Proc. Natl. Acad. Sci. USA 2010, 107, 16500–16505. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Miyadate, H.; Adachi, S.; Hiraizumi, A.; Tezuka, K.; Nakazawa, N.; Kawamoto, T.; Katou, K.; Kodama, I.; Sakurai, K.; Takahashi, H.; et al. OsHMA3, a P1B-type of ATPase affects root-to-shoot cadmium translocation in rice by mediating efflux into vacuoles. New Phytol. 2011, 189, 190–199. [Google Scholar] [CrossRef] [PubMed]
- Mori, S.; Uraguchi, S.; Ishikawa, S.; Arao, T. Xylem loading process is a critical factor in determining cd accumulation in the shoots of Solanum melongena and Solanum torvum. Environ. Exp. Bot. 2009, 67, 127–132. [Google Scholar] [CrossRef]
- Lu, L.L.; Tian, S.K.; Yang, X.E.; Wang, X.C.; Brown, P.; Li, T.Q.; He, Z.L. Enhanced root-to-shoot translocation of cadmium in the hyperaccumulating ecotype of Sedum alfredii. J. Exp. Bot. 2008, 59, 3203–3213. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Ueno, D.; Kono, I.; Yokosho, K.; Ando, T.; Yano, M.; Ma, J.F. A major quantitative trait locus controlling cadmium translocation in rice (Oryza sativa). New Phytol. 2009, 182, 644–653. [Google Scholar] [CrossRef]
- Mills, R.F.; Krijger, G.C.; Baccarini, B.J.; Hall, J.L.; Williams, L.E. Functional expression of AtHMA4, a P1B-ATPase of the Zn/Co/Cd/Pb subclass. Plant J. 2003, 35, 164–176. [Google Scholar] [CrossRef]
- Mills, R.F.; Francini, A.; daRocha, P.S.C.F.; Bacarini, P.J.; Aylett, M.; Krijger, G.C.; Williams, L.E. The plant P-1B-type ATPase AtHMA4 transports Zn and Cd and plays a role in detoxification of transition metals supplied at elevated levels. FEBS Lett. 2005, 579, 783–791. [Google Scholar] [CrossRef] [Green Version]
- Hussain, D.; Haydon, M.J.; Wang, Y.; Wong, E.; Sherson, S.M.; Young, J.; Camakaris, J.; Harper, J.F.; Cobbett, C.S. P-type ATPase heavy metal transporters with roles in essential zinc homeostasis in Arabidopsis. Plant Cell 2004, 16, 1327–1339. [Google Scholar] [CrossRef] [Green Version]
- Hanikenne, M.; Talke, I.N.; Haydon, M.J.; Lanz, C.; Nolte, A.; Motte, P.; Kroymann, J.; Weigel, D.; Krämer, U. Evolution of metal hyperaccumulation required cis-regulatory changes and triplication of HMA4. Nature 2008, 453, 391–395. [Google Scholar] [CrossRef] [PubMed]
- Hermand, V.; Julio, E.; deBorne, F.D.; Punshon, T.; Ricachenevsky, F.K.; Bellec, A.; Gosti, F.; Berthomieu, P. Inactivation of two newly identified tobacco heavy metal ATPases leads to reduced Zn and cd accumulation in shoots and reduced pollen germination. Metallomics 2014, 6, 1427–1440. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Richard, O.; Pineau, C.; Loubet, S.; Chalies, C.; Vile, D.; Marquès, L.; Berthomieu, P. Diversity analysis of the response to Zn within the Arabidopsis thaliana species revealed a low contribution of Zn translocation to Zn tolerance and a new role for Zn in lateral root development. Plant Cell Environ. 2011, 34, 1065–1078. [Google Scholar] [CrossRef] [PubMed]
- Barabasz, A.; Wilkowska, A.; Ruszczyńska, A.; Bulska, E.; Hanikenne, M.; Czarny, M.; Krämer, U.; Antosiewicz, D.M. Metal response of transgenic tomato plants expressing P1B-ATPase. Physiol. Plant. 2012, 145, 315–331. [Google Scholar] [CrossRef] [PubMed]
- Kendziorek, M.; Barabasz, A.; Rudzka, J.; Tracz, K.; Mills, R.F.; Williams, L.E.; Antosiewicz, D.M. Approach to engineer tomato by expression of AtHMA4 to enhance Zn in the aerial parts. J. Plant Physiol. 2014, 171, 1413–1422. [Google Scholar] [CrossRef]
- Bovet, L.; Rossi, L.; Lugon-Moulin, L. Cadmium partitioning and gene expression studies in Nicotiana tabacum and Nicotiana rustica. Physiol. Plant 2006, 128, 466–475. [Google Scholar] [CrossRef]
- Assunção, A.G.L.; Bleeker, P.; ten Bookum, W.M.; Vooijs, R.; Schat, H. Intraspecific variation of metal preference patterns for hyperaccumulation in Thlaspi caerulescens: Evidence from binary metal exposures. Plant Soil 2008, 303, 289–299. [Google Scholar] [CrossRef]
- Palusińska, M.; Barabasz, A.; Kozak, K.; Papierniak, A.; Maślińska, K.; Antosiewicz, D.M. Zn/Cd status-dependent accumulation of Zn and Cd in root parts in tobacco is accompanied by specific expression of ZIP genes. BMC Plant Biol. 2020, 20, 37. [Google Scholar] [CrossRef]
- Barabasz, A.; Klimecka, M.; Kendziorek, M.; Weremczuk, A.; Ruszczyńska, A.; Bulska, E.; Antosiewicz, D.M. The ratio of Zn to cd supply as a determinant of metal-homeostasis gene expression in tobacco and its modulation by overexpressing the metal exporter AtHMA4. J. Exp. Bot. 2016, 67, 6201–6214. [Google Scholar] [CrossRef] [Green Version]
- Guerinot, M.L. The ZIP family of metal transporters. Biochim. Biophys. Acta 2000, 1465, 190–198. [Google Scholar] [CrossRef] [Green Version]
- Barabasz, A.; Palusińska, M.; Papierniak, A.; Kendziorek, M.; Kozak, K.; Williams, L.E.; Antosiewicz, D.M. Functional analysis of NtZIP4B and Zn status-dependent expression pattern of tobacco ZIP genes. Front. Plant Sci. 2019, 9, 1984. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Jain, A.; Sinilal, B.; Dhandapani, G.; Meagher, R.B.; Sahi, S.V. Effects of deficiency and excess of zinc on morphophysiological traits and spatiotemporal regulation of zinc-responsive genes reveal incidence of cross talk between micro- and macronutrients. Environ. Sci. Technol. 2013, 47, 5327–5335. [Google Scholar] [CrossRef]
- Palmgren, M.G.; Clemens, S.; Williams, L.E.; Kraemer, U.; Borg, S.; Schjørring, J.K.; Sanders, D. Zinc biofortification of cereals: Problems and solutions. Trends Plant Sci. 2008, 13, 464–473. [Google Scholar] [CrossRef] [PubMed]
- Clemens, S.; Ma, J.F. Toxic Heavy Metal and Metalloid Accumulation in Crop Plants and Foods. Annu. Rev. Plant. Biol. 2016, 67, 489–512. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Ishimaru, Y.; Masuda, H.; Suzuki, M.; Bashir, K.; Takahashi, M.; Nakanishi, H.; Mori, S.; Nishizawa, N.K. Overexpression of the OsZIP4 zinc transporter confers disarrangement of zinc distribution in rice plants. J. Exp. Bot. 2007, 58, 2909–2915. [Google Scholar] [CrossRef] [Green Version]
- Barberon, M. The endodermis as a checkpoint for nutrients. New Phytol. 2017, 213, 1604–1610. [Google Scholar] [CrossRef]
- Palmer, C.M.; Guerinot, M.L. Facing the challenges of Cu, Fe and Zn homeostasis in plants. Nat. Chem. Biol. 2009, 5, 333–340. [Google Scholar] [CrossRef] [Green Version]
- Sperotto, R.A.; Ricachenevsky, F.K.; Williams, L.E.; Vasconcelos, M.W.; Menguer, P.K. From soil to seed: Micronutrient movement into and within the plant. Front. Plant Sci. 2014, 5, 438. [Google Scholar] [CrossRef]
- Milner, M.J.; Seamon, J.; Craft, E.; Kochian, L.V. Transport properties of members of the ZIP family in plants and their role in Zn and Mn homeostasis. J. Exp. Bot. 2013, 64, 369–381. [Google Scholar] [CrossRef] [Green Version]
- Papierniak, A.; Kozak, K.; Kendziorek, M.; Barabasz, A.; Palusińska, M.; Tiuryn, J.; Williams, L.E.; Antosiewicz, D.M. Contribution of NtZIP1-Like to the regulation of Zn homeostasis. Front. Plant. Sci. 2018, 9, 185. [Google Scholar] [CrossRef] [Green Version]
- Wintz, H.; Fox, T.; Wu, Y.Y.; Feng, V.; Chen, W.; Chang, H.S.; Zhu, T.; Vulpe, C. Expression profiles of Arabidopsis thaliana in mineral deficiencies reveal novel transporters involved in metal homeostasis. J. Biol. Chem. 2003, 278, 47644–47653. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Burleigh, S.H.; Kristensen, B.K.; Bechmann, I.E. A plasma membrane zinc transporter from Medicago truncatula is up-regulated in roots by Zn fertilization, yet down-regulated by arbuscular mycorrhizal colonization. Plant Mol. Biol. 2003, 52, 1077–1088. [Google Scholar] [CrossRef] [PubMed]
- Yoshihara, T.; Hodoshima, H.; Miyano, Y.; Shoji, K.; Shimada, H.; Goto, F. Cadmium inducible Fe deficiency responses observed from macro and molecular views in tobacco plants. Plant Cell Rep. 2006, 25, 365–373. [Google Scholar] [CrossRef] [PubMed]
- Hodoshima, H.; Enomoto, Y.; Shoji, K.; Shimada, H.; Goto, F.; Yoshihara, T. Differential regulation of cadmium-inducible expression of irondeficiency-responsive genes in tobacco and barley. Physiol. Plant. 2007, 129, 622–634. [Google Scholar] [CrossRef]
- Clemens, S. Toxic metal accumulation, responses to exposure and mechanisms of tolerance in plants. Biochimie 2006, 88, 1707–1719. [Google Scholar] [CrossRef]
- Krämer, U.; Talke, I.N.; Hanikenne, M. Transition metal transport. FEBS Lett. 2007, 581, 2263–2272. [Google Scholar] [CrossRef]
- Sasaki, A.; Yamaji, N.; Yokosho, K.; Ma, J.F. Nramp5 is a major transporter responsible for manganese and cadmium uptake in rice. Plant Cell 2012, 24, 2155–2167. [Google Scholar] [CrossRef] [Green Version]
- Sinclair, S.A.; Senger, T.; Talke, I.N.; Cobbett, C.S.; Haydon, M.J.; Krämer, U. Systemic upregulation of MTP2- and HMA2-mediated Zn partitioning to the shoot supplements local Zn deficiency responses. Plant Cell. 2018, 30, 2463–2479. [Google Scholar] [CrossRef] [Green Version]
- Karimi, M.; Inzé, D.; Depicker, A. GATEWAY vectors for Agrobacterium-mediated plant transformation. Trends Plant Sci. 2002, 7, 193–195. [Google Scholar] [CrossRef]
- Barabasz, A.; Krämer, U.; Hanikenne, M.; Rudzka, J.; Antosiewicz, D.M. Metal accumulation in tobacco expressing Arabidopsis halleri metal hyperaccumulation gene depends on external supply. J. Exp. Bot. 2010, 61, 3057–3067. [Google Scholar] [CrossRef] [Green Version]
- Livak, K.J.; Schmittgen, T.D. Analysis of relative gene expression data using real-time quantitative PCR and the 2-ΔΔCT method method. Methods 2001, 25, 402–408. [Google Scholar] [CrossRef] [PubMed]
- Wojas, S.; Hennig, J.; Plaza, S.; Geisler, M.; Siemianowski, O.; Skłodowska, A.; Ruszczyńska, A.; Bulska, E.; Antosiewicz, D.M. Ectopic expression of Arabidopsis ABC transporter MRP7 modifies cadmium root-to-shoot transport and accumulation. Environ. Pollut. 2009, 157, 2781–2789. [Google Scholar] [CrossRef] [PubMed]
- Siemianowski, O.; Barabasz, A.; Weremczuk, A.; Ruszczyńska, A.; Bulska, E.; Williams, L.E.; Antosiewicz, D.M. Development of Zn-related necrosis in tobacco is enhanced by expressing AtHMA4 and depends on the apoplastic Zn levels. Plant Cell Environ. 2013, 36, 1093–1104. [Google Scholar] [CrossRef] [PubMed]
Gene Name/Target | Primer For | Primer Rev | Products on Target Templates | Length of Amplicon |
---|---|---|---|---|
Primers for qPCR | ||||
NtIRT1 | CGCAATAACAACTCCATTCG | AAGCCATATAGATCAGAAGGC | AB263746.1 | 134 |
NtIRT1-like | CTTCTTCGCAGTAACAACC | AGCCATGTAAATAAGAAGACC | XM_016611068.1 | 139 |
NtZIP1-like | TGCTGCTGGTGTCATTCTAG | GCTGGCATGACTATGACTGTG | XM_016652513.1 | 274 |
NtZIP2 | CACCATGTTTAGTGACTGC | CTTGAGAAAAGGATTTGCTTCC | XM_016617597.1 | 136 |
NtZIP4A | CTGTTTCCAATACCACCTGT | GCTTCTTGCCAACTAATGGA | XM_016647965.1 | 150 |
NtZIP4B | ACTGACTCTAATCTCTTTCTTGC | ATGGCGATAAAACCAGCG | XM_016586154.1 | 161 |
NtZIP5A | TGGGAACTCTTATGGTGGAT | CTGAACCATGTGAATGAACATGA | NM_001325745.1 | 126 |
NtZIP5B | GGGAACTCTAATGGTGGAC | ATGTGCATGGCCATGTG | XM_016593570.1 | 130 |
NtZIP5-like | TCTGCGAAAAATGGTGTG | GAAGGAGCTCGGAATCAG | XM_016594002.1 | 118 |
NtZIP8 | GGTTGTGCCATTAGAAGAGG | AGTTAATGCCGCTACAAGG | XM_016603305.1, XM_016586286.1 | 163 |
NtZIP11 | CTGACACAGATTCCGACTCA | CACAATCAGCCAACATAGTAAGC | XM_016644574.1 | 321 |
NtHMAα/NtHMAβ | TCCTCAAACGTGCTCTACC | TGGAGCTTGAAGTTGCAGA | HF675181.1, HF937054.1 | 188 |
NtPP2A | GCACATTCATTCAGTTTGAACC | GTAGCATATAAAGCAGTCAGC | NM_001325282.1 | 142 |
Primers used for amplification of NtZIP4B-delta3 fragment | ||||
5′-terminal fragment of NtZIP4B coding sequence | CACCATGTCGTTCACTGAGGATCTCGTGCCC (named ZIP4B-ORF-START) | AGTCAGATCGATGGTACCGATGCTTCTTGC (named ZIP4B-delta3-KnpI-ClaI) | Plasmid pENTR-TOPO-NtZIP4B-STOP | 274 |
Primer used for confirmation of RNAi cassette in T0 plants | ||||
NtZIP4B-delta3 in ‘sens” orientation | CTATCCTTCGCAAGACCCTTC | CATAACTCAGCACACCAGAG | Plasmid pK7GWIWG2-ZIP4B-delta3 | 662 |
NtZIP4B-delta3 in “antisens” orientation | CTTCTTAGCATTTAACGTGTTTGC | CCTTATCTGGGAACTACTCAC | Plasmid pK7GWIWG2-ZIP4B-delta3 | 535 |
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations. |
© 2021 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Maślińska-Gromadka, K.; Barabasz, A.; Palusińska, M.; Kozak, K.; Antosiewicz, D.M. Suppression of NtZIP4A/B Changes Zn and Cd Root-to-Shoot Translocation in a Zn/Cd Status-Dependent Manner. Int. J. Mol. Sci. 2021, 22, 5355. https://doi.org/10.3390/ijms22105355
Maślińska-Gromadka K, Barabasz A, Palusińska M, Kozak K, Antosiewicz DM. Suppression of NtZIP4A/B Changes Zn and Cd Root-to-Shoot Translocation in a Zn/Cd Status-Dependent Manner. International Journal of Molecular Sciences. 2021; 22(10):5355. https://doi.org/10.3390/ijms22105355
Chicago/Turabian StyleMaślińska-Gromadka, Karolina, Anna Barabasz, Małgorzata Palusińska, Katarzyna Kozak, and Danuta Maria Antosiewicz. 2021. "Suppression of NtZIP4A/B Changes Zn and Cd Root-to-Shoot Translocation in a Zn/Cd Status-Dependent Manner" International Journal of Molecular Sciences 22, no. 10: 5355. https://doi.org/10.3390/ijms22105355