Antitumor Effects of 5-Aminolevulinic Acid on Human Malignant Glioblastoma Cells
Abstract
:1. Introduction
2. Results
2.1. 5-Aminolevulinic Acid (5-ALA) Inhibits Cell Viability of U87MG Cells
2.2. 5-ALA Induces Apoptosis in U87MG Cells
2.3. 5-ALA Increases the Production of ROS
2.4. 5-ALA Inhibits the Migration of U87MG
3. Discussion
4. Materials and Methods
4.1. Cell Cultures
4.2. Evaluation of Cell Viability
4.3. Evaluation of Apoptosis
4.4. RNA Analysis and Quantitative Reverse Transcription (qRT)-PCR
4.5. Assessment of ROS Generation
4.6. Evaluation of Cell Cycle
4.7. Evaluation of Migration Property
4.8. Statistical Analysis
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Conflicts of Interest
Abbreviations
5-ALA | 5-Aminolevulinic acid |
DMEM | Dulbecco’s modified Eagle’s medium |
DMSO | Dimethyl sulfoxide |
FBS | Fetal bovine serum |
GBM | Glioblastoma multiforme |
IC50 | Half-maximal inhibitory concentration |
PP-IX | Protoporphyrin IX |
ROS | Reactive oxygen species |
U87MG | U-87 malignant GBM cell line |
References
- Koshy, M.; Villano, J.L.; Dolecek, T.A.; Howard, A.; Mahmood, U.; Chmura, S.J.; Weichselbaum, R.R.; McCarthy, B.J. Improved survival time trends for glioblastoma using the SEER 17 population-based registries. J. Neuro Oncol. 2012, 107, 207–212. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Witthayanuwat, S.; Pesee, M.; Supaadirek, C.; Supakalin, N.; Thamronganantasakul, K.; Krusun, S. Survival Analysis of Glioblastoma Multiforme. Asian Pac. J. Cancer Prev. 2018, 19, 2613–2617. [Google Scholar] [PubMed]
- Han, S.J.; Englot, D.J.; Birk, H.; Molinaro, A.M.; Chang, S.M.; Clarke, J.L.; Prados, M.D.; Taylor, J.W.; Berger, M.S.; Butowski, N.A. Impact of Timing of Concurrent Chemoradiation for Newly Diagnosed Glioblastoma. Neurosurgery 2015, 62 (Suppl. 1), 160–165. [Google Scholar] [CrossRef] [Green Version]
- Stummer, W.; Pichlmeier, U.; Meinel, T.; Wiestler, O.D.; Zanella, F.; Reulen, H.-J. Fluorescence-guided surgery with 5-aminolevulinic acid for resection of malignant glioma: A randomised controlled multicentre phase III trial. Lancet Oncol. 2006, 7, 392–401. [Google Scholar] [CrossRef]
- Kuhnt, D.; Becker, A.; Ganslandt, O.; Bauer, M.; Buchfelder, M.; Nimsky, C. Correlation of the extent of tumor volume resection and patient survival in surgery of glioblastoma multiforme with high-field intraoperative MRI guidance. Neuro-Oncology 2011, 13, 1339–1348. [Google Scholar] [CrossRef] [Green Version]
- Hadjipanayis, C.G.; Stummer, W. 5-ALA and FDA approval for glioma surgery. J. Neuro Oncol. 2019, 141, 479–486. [Google Scholar] [CrossRef]
- Armocida, D.; Pesce, A.; Di Giammarco, F.; Frati, A.; Santoro, A.; Salvati, M. Long Term Survival in Patients Suffering from Glio-blastoma Multiforme: A Single-Center Observational Cohort Study. Diagnostics 2019, 9, 209. [Google Scholar] [CrossRef] [Green Version]
- Walter, S.; Susanne, S.; Simon, W.; Herbert, S.; Clemens, F.; Claudia, G.; Alwin, E.G.; Rainer, K.; Hans, J.R. Intraoperative Detection of Malignant Gliomas by 5-Aminolevulinic Acid-induced Porphyrin Fluorescence. Neurosurgery 1998, 42, 518–526. [Google Scholar] [CrossRef] [PubMed]
- Nakayama, T.; Otsuka, S.; Kobayashi, T.; Okajima, H.; Matsumoto, K.; Hagiya, Y.; Inoue, K.; Shuin, T.; Nakajima, M.; Tanaka, T.; et al. Dormant cancer cells accumulate high protoporphyrin IX levels and are sensitive to 5-aminolevulinic acid-based photodynamic therapy. Sci. Rep. 2016, 6, 36478. [Google Scholar] [CrossRef] [Green Version]
- Karmakar, S.; Banik, N.L.; Patel, S.J.; Ray, S.K. 5-Aminolevulinic acid-based photodynamic therapy suppressed survival factors and activated proteases for apoptosis in human glioblastoma U87MG cells. Neurosci. Lett. 2007, 415, 242–247. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Coupienne, I.C.I.; Bontems, S.; Dewaele, M.; Rubio, N.; Habraken, Y.; Fulda, S.; Agostinis, P.; Piette, J. NF-kappaB inhibition improves the sensitivity of human glioblastoma cells to 5-aminolevulinic acid-based photodynamic therapy. Biochem. Pharmacol. 2011, 81, 606–616. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Yamamoto, J.; Ogura, S.-I.; Shimajiri, S.; Nakano, Y.; Akiba, D.; Kitagawa, T.; Ueta, K.; Tanaka, T.; Nishizawa, S. 5-Aminolevulinic acid-induced protoporphyrin IX with multi-dose ionizing irradiation enhances host antitumor response and strongly inhibits tumor growth in experimental glioma in vivo. Mol. Med. Rep. 2014, 11, 1813–1819. [Google Scholar] [CrossRef] [PubMed]
- Yamada, K.; Murayama, Y.; Kamada, Y.; Arita, T.; Kosuga, T.; Konishi, H.; Morimura, R.; Shiozaki, A.; Kuriu, Y.; Ikoma, H.; et al. Radiosensitizing effect of 5-aminolevulinic acid in colorectal cancer in vitro and in vivo. Oncol. Lett. 2019, 17, 5132–5138. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Yamamoto, J.; Ogura, S.-I.; Tanaka, T.; Kitagawa, T.; Nakano, Y.; Saito, T.; Takahashi, M.; Akiba, D.; Nishizawa, S. Radiosensitizing effect of 5-aminolevulinic acid-induced protoporphyrin IX in glioma cells in vitro. Oncol. Rep. 2012, 27, 1748–1752. [Google Scholar] [CrossRef] [Green Version]
- Miyake, M.; Tanaka, N.; Hori, S.; Ohnishi, S.; Takahashi, H.; Fujii, T.; Owari, T.; Ohnishi, K.; Iida, K.; Morizawa, Y.; et al. Dual benefit of supplementary oral 5-aminolevulinic acid to pelvic radiotherapy in a syngenic prostate cancer model. Prostate 2019, 79, 340–351. [Google Scholar] [CrossRef] [PubMed]
- Yang, X.; Palasuberniam, P.; Myers, K.A.; Wang, C.; Chen, B. Her2 oncogene transformation enhances 5-aminolevulinic acid-mediated protoporphyrin IX production and photodynamic therapy response. Oncotarget 2016, 7, 57798–57810. [Google Scholar] [CrossRef] [Green Version]
- Yoshioka, E.; Chelakkot, V.S.; Licursi, M.; Rutihinda, S.G.; Som, J.; Derwish, L.; King, J.J.; Pongnopparat, T.; Mearow, K.; Larijani, M.; et al. Enhancement of Cancer-Specific Protoporphyrin IX Fluorescence by Targeting Oncogenic Ras/MEK Pathway. Theranostics 2018, 8, 2134–2146. [Google Scholar] [CrossRef]
- Kitajima, Y.; Ishii, T.; Kohda, T.; Ishizuka, M.; Yamazaki, K.; Nishimura, Y.; Tanaka, T.; Dan, S.; Nakajima, M. Mechanistic study of PpIX accumulation using the JFCR39 cell panel revealed a role for dynamin 2-mediated exocytosis. Sci. Rep. 2019, 9, 8666. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Luwor, R.; Morokoff, A.P.; Amiridis, S.; D’Abaco, G.; Paradiso, L.; Stylli, S.S.; Nguyen, H.P.T.; Tarleton, M.; Young, K.A.; O’Brien, T.J.; et al. Targeting Glioma Stem Cells by Functional Inhibition of Dynamin 2: A Novel Treatment Strategy for Glioblastoma. Cancer Investig. 2019, 37, 144–155. [Google Scholar] [CrossRef]
- Koeller, H.B.; Ross, M.E.; Glickstein, S.B. Cyclin D1 in excitatory neurons of the adult brain enhances kainate-induced neurotoxicity. Neurobiol. Dis. 2008, 31, 230–241. [Google Scholar] [CrossRef] [Green Version]
- Friedl, P.; Wolf, K. Plasticity of cell migration: A multiscale tuning model. J. Cell Biol. 2009, 188, 11–19. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Fisher, T.; Galanti, G.; Lavie, G.; Jacob-Hirsch, J.; Kventsel, I.; Zeligson, S.; Winkler, R.; Simon, A.J.; Amariglio, N.; Rechavi, G.; et al. Mechanisms Operative in the Antitumor Activity of Temozolomide in Glioblastoma Multiforme. Cancer J. 2007, 13, 335–344. [Google Scholar] [CrossRef]
- Paolini, A.; Pasi, F.; Facoetti, A.; Mazzini, G.; Corbella, F.; Di Liberto, R.; Nano, R. Cell death forms and HSP70 expression in U87 cells after ionizing radiation and/or chemotherapy. Anticancer. Res. 2011, 31, 3727–3731. [Google Scholar] [PubMed]
- Hirose, Y.; Berger, M.S.; Pieper, R.O. Abrogation of the Chk1-mediated G(2) checkpoint pathway potentiates te-mozolomide-induced toxicity in a p53-independent manner in human glioblastoma cells. Cancer Res. 2001, 61, 1957–1963. [Google Scholar] [PubMed]
- Akbarnejad, Z.; Eskandary, H.; Dini, L.; Vergallo, C.; Nematollahi-Mahani, S.N.; Farsinejad, A.; Abadi, M.F.S.; Ahmadi, M. Cytotoxicity of temozolomide on human glioblastoma cells is enhanced by the concomitant exposure to an extremely low-frequency electromagnetic field (100 Hz, 100 G). Biomed. Pharmacother. 2017, 92, 254–264. [Google Scholar] [CrossRef] [PubMed]
- Zhang, Y.; Dube, C.; Gibert, J.M.; Cruickshanks, N.; Wang, B.; Coughlan, M.; Yang, Y.; Setiady, I.; Deveau, C.; Saoud, K.; et al. The p53 Pathway in Glioblastoma. Cancers 2018, 10, 297. [Google Scholar] [CrossRef] [Green Version]
- Fels, C.; Schäfer, C.; Hüppe, B.; Bahn, H.; Heidecke, V.; Kramm, C.M.; Lautenschläger, C.; Rainov, N.G. Bcl-2 expression in higher-grade human glioma: A clinical and experimental study. J. Neuro Oncol. 2000, 48, 207–216. [Google Scholar] [CrossRef]
- Daniele, S.; Pietrobono, D.; Costa, B.; Giustiniano, M.; La Pietra, V.; Giacomelli, C.; La Regina, G.; Silvestri, R.; Taliani, S.; Trincavelli, M.L.; et al. Bax Activation Blocks Self-Renewal and Induces Apoptosis of Human Glioblastoma Stem Cells. ACS Chem. Neurosci. 2017, 9, 85–99. [Google Scholar] [CrossRef] [Green Version]
- Valdés-Rives, S.A.; Casique-Aguirre, D.; Germán-Castelán, L.; Velasco-Velázquez, M.A.; González-Arenas, A. Apoptotic Signaling Pathways in Glioblastoma and Therapeutic Implications. BioMed Res. Int. 2017, 2017, 1–12. [Google Scholar] [CrossRef] [Green Version]
- Eisele, G.; Weller, M. Targeting apoptosis pathways in glioblastoma. Cancer Lett. 2013, 332, 335–345. [Google Scholar] [CrossRef] [Green Version]
- Teper, E.; Makhov, P.; Golovine, K.; Canter, D.J.; Myers, C.B.; Kutikov, A.; Sterious, S.N.; Uzzo, R.G.; Kolenko, V.M. The Effect of 5-Aminolevulinic Acid and Its Derivatives on Protoporphyrin IX Accumulation and Apoptotic Cell Death in Castrate-resistant Prostate Cancer Cells. Urology 2012, 80, 1391.e1–1391.e7. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Jiang, L.; Malik, N.; Acedo, P.; Zawacka-Pankau, J. Protoporphyrin IX is a dual inhibitor of p53/MDM2 and p53/MDM4 interactions and induces apoptosis in B-cell chronic lymphocytic leukemia cells. Cell Death Discov. 2019, 5, 77. [Google Scholar] [CrossRef] [Green Version]
- Chang, M.; Ma, X.; Ouyang, T.; Lin, J.; Liu, J.; Xiao, Y.; Chen, H.; Yu, J.; Huang, Y.; Xu, M. Potential Molecular Mechanisms Involved in 5-Aminolevulinic Acid–Based Photodynamic Therapy against Human Hypertrophic Scars. Plast. Reconstr. Surg. 2015, 136, 715–727. [Google Scholar] [CrossRef] [PubMed]
- Wei, X.Q.; Ma, H.Q.; Liu, A.H.; Zhang, Y.Z. Synergistic Anticancer Activity of 5-Aminolevulinic Acid Photodynamic Therapy in Combination with Low-dose Cisplatin on Hela Cells. Asian Pac. J. Cancer Prev. 2013, 14, 3023–3028. [Google Scholar] [CrossRef] [Green Version]
- Suehiro, S.; Ohnishi, T.; Yamashita, D.; Kohno, S.; Inoue, A.; Nishikawa, M.; Ohue, S.; Tanaka, J.; Kunieda, T. Enhancement of antitumor activity by using 5-ALA–mediated sonodynamic therapy to induce apoptosis in malignant gliomas: Significance of high-intensity focused ultrasound on 5-ALA-SDT in a mouse glioma model. J. Neurosurg. 2018, 129, 1416–1428. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Sheehan, K.; Sheehan, D.; Sulaiman, M.; Padilla, F.; Moore, D.; Sheehan, J.; Xu, Z. Investigation of the tumoricidal effects of sonodynamic therapy in malignant glioblastoma brain tumors. J. Neuro Oncol. 2020, 148, 9–16. [Google Scholar] [CrossRef]
- Wiman, K.G.; Zhivotovsky, B. Understanding cell cycle and cell death regulation provides novel weapons against human diseases. J. Intern. Med. 2017, 281, 483–495. [Google Scholar] [CrossRef]
- Pucci, B.; Kasten, M.; Giordano, A. Cell Cycle and Apoptosis. Neoplasia 2000, 2, 291–299. [Google Scholar] [CrossRef] [Green Version]
- Chen, J. The Cell-Cycle Arrest and Apoptotic Functions of p53 in Tumor Initiation and Progression. Cold Spring Harb. Perspect. Med. 2016, 6, a026104. [Google Scholar] [CrossRef]
- Chen, X.; Zhao, P.; Chen, F.; Li, L.; Luo, R. Effect and mechanism of 5-aminolevulinic acid-mediated photodynamic therapy in esophageal cancer. Lasers Med. Sci. 2010, 26, 69–78. [Google Scholar] [CrossRef] [PubMed]
- Li, Q.; Wang, X.; Zhang, K.; Li, X.; Liu, Q.; Wang, P. DNA Damage and Cell Cycle Arrest Induced by Protoporphyrin IX in Sarcoma 180 Cells. Cell. Physiol. Biochem. 2013, 32, 778–788. [Google Scholar] [CrossRef] [PubMed]
- Castro-Gamero, A.M.; Pezuk, J.A.; Brassesco, M.S.; Tone, L.G. G2/M inhibitors as pharmacotherapeutic opportunities for glioblastoma: The old, the new, and the future. Cancer Biol. Med. 2018, 15, 354–374. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Cemeli, T.; Guasch-Vallés, M.; Nàger, M.; Felip, I.; Cambray, S.; Santacana, M.; Gatius, S.; Pedraza, N.; Dolcet, X.; Ferrezuelo, F.; et al. Cytoplasmic cyclin D1 regulates glioblastoma dissemination. J. Pathol. 2019, 248, 501–513. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Mahzouni, P.; Taheri, F. An Immunohistochemical Study of Cyclin D1 Expression in Astrocytic Tumors and its Correlation with Tumor Grade. Iran. J. Pathol. 2019, 14, 252–257. [Google Scholar] [CrossRef]
- Zhang, D.; Dai, D.; Zhou, M.; Li, Z.; Wang, C.; Lu, Y.; Li, Y.; Wang, J. Inhibition of Cyclin D1 Expression in Human Glioblastoma Cells is Associated with Increased Temozolomide Chemosensitivity. Cell. Physiol. Biochem. 2018, 51, 2496–2508. [Google Scholar] [CrossRef]
- Wang, W.; Tabu, K.; Hagiya, Y.; Sugiyama, Y.; Kokubu, Y.; Murota, Y.; Ogura, S.-I.; Taga, T. Enhancement of 5-aminolevulinic acid-based fluorescence detection of side population-defined glioma stem cells by iron chelation. Sci. Rep. 2017, 7, 42070. [Google Scholar] [CrossRef] [PubMed]
- Ito, H.; Kurokawa, H.; Suzuki, H.; Indo, H.P.; Majima, H.J.; Matsui, H. 5-Aminolevulinic acid induced apoptosis via oxidative stress in normal gastric epithelial cells. J. Clin. Biochem. Nutr. 2019, 65, 83–90. [Google Scholar] [CrossRef] [Green Version]
- Kast, R.E.; Skuli, N.; Sardi, I.; Capanni, F.; Hessling, M.; Frosina, G.; Kast, A.P.; Karpel-Massler, G.; Halatsch, M.E. Augmentation of 5-Aminolevulinic Acid Treatment of Glioblastoma by Adding Ciprofloxacin, Deferiprone, 5-Fluorouracil and Febuxostat: The CAALA Regimen. Brain Sci. 2018, 8, 203. [Google Scholar] [CrossRef] [Green Version]
- Triviño, A.; Ramírez, J.M.; Salazar, J.J.; Ramírez, A.I. Astroglial Architecture of the Human Optic Nerve: Functional Role of Astrocytes; Castellano, B., González, B., Nieto-Sampedro, M., Eds.; Understanding Glial Cells; Springer: Boston, MA, USA, 1998. [Google Scholar] [CrossRef]
- Kennedy, P.; Lisak, R. Astrocytes and oligodendrocytes in dissociated cell culture of adult rat optic nerve. Neurosci. Lett. 1980, 16, 229–233. [Google Scholar] [CrossRef]
- Yang, P.; Hernandez, M. Purification of astrocytes from adult human optic nerve heads by immunopanning. Brain Res. Protoc. 2003, 12, 67–76. [Google Scholar] [CrossRef]
- Jahan-Abad, A.J.; Karima, S.; Negah, S.S.; Noorbakhsh, F.; Borhani-Haghighi, M.; Gorji, A. Therapeutic potential of conditioned medium derived from oligodendrocytes cultured in a self-assembling peptide nanoscaffold in experimental autoimmune encephalomyelitis. Brain Res. 2019, 1711, 226–235. [Google Scholar] [CrossRef]
- Livak, K.J.; Schmittgen, T.D. Analysis of relative gene expression data using real-time quantitative PCR and the 2–ΔΔCT Method. Methods 2001, 25, 402–408. [Google Scholar] [CrossRef] [PubMed]
- Sahab-Negah, S.; Ariakia, F.; Jalili-Nik, M.; Afshari, A.R.; Salehi, S.; Samini, F.; Rajabzadeh, G.; Gorji, A. Curcumin Loaded in Niosomal Nanoparticles Improved the Anti-tumor Effects of Free Curcumin on Glioblastoma Stem-like Cells: An In Vitro Study. Mol. Neurobiol. 2020, 57, 3391–3411. [Google Scholar] [CrossRef] [PubMed]
- Grada, A.; Otero-Vinas, M.; Prieto-Castrillo, F.; Obagi, Z.; Falanga, V. Research Techniques Made Simple: Analysis of Collective Cell Migration Using the Wound Healing Assay. J. Investig. Dermatol. 2017, 137, e11–e16. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Rodriguez, L.G.; Wu, X.; Guan, J.-L. Wound-Healing Assay. In Cell Migration. Methods in Molecular Biology; Humana Press: Berlin/Heidelberg, Germany, 2005; Volume 294, pp. 23–30. [Google Scholar] [CrossRef]
Gene Symbol | Gene Name | Primers (5′ → 3′) | Accession Number |
---|---|---|---|
Bax | Bcl-2-associated X protein | Forward: TGACGGCAACTTCAACTGGG Reverse: CTTCAGTGACTCGGCCAGGG | NM_001291428.2 |
Bcl-2 | B-cell lymphoma 2 | Forward: GTCATGTGTGTGGAGAGCGTC Reverse: CCGTACAGTTCCACAAAGGCATC | NM_000633.3 |
P53 | Tumor suppressor protein | Forward: ACACGCTTCCCTGGATTGG Reverse: CTAGGATCTGACTGCGGCTC | NM_000546.6 |
CCND1 | Cyclin D1 | Forward: CAAATGTGTGCAGAAGGAGGTC Reverse: CTCGCACTTCTGTTCCTCGC | NM_053056.3 |
GAPDH | Glyceraldehyde-3-phosphate dehydrogenase | Forward: TCAAGATCATCAGCAATGCCTCC Reverse: GCCATCACGCCACAGTTTC | NM_001357943.2 |
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations. |
© 2021 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Jalili-Nik, M.; Abbasinezhad-moud, F.; Sahab-Negah, S.; Maghrouni, A.; Etezad Razavi, M.; Khaleghi Ghadiri, M.; Stummer, W.; Gorji, A. Antitumor Effects of 5-Aminolevulinic Acid on Human Malignant Glioblastoma Cells. Int. J. Mol. Sci. 2021, 22, 5596. https://doi.org/10.3390/ijms22115596
Jalili-Nik M, Abbasinezhad-moud F, Sahab-Negah S, Maghrouni A, Etezad Razavi M, Khaleghi Ghadiri M, Stummer W, Gorji A. Antitumor Effects of 5-Aminolevulinic Acid on Human Malignant Glioblastoma Cells. International Journal of Molecular Sciences. 2021; 22(11):5596. https://doi.org/10.3390/ijms22115596
Chicago/Turabian StyleJalili-Nik, Mohammad, Farzaneh Abbasinezhad-moud, Sajad Sahab-Negah, Abolfazl Maghrouni, Mohammad Etezad Razavi, Maryam Khaleghi Ghadiri, Walter Stummer, and Ali Gorji. 2021. "Antitumor Effects of 5-Aminolevulinic Acid on Human Malignant Glioblastoma Cells" International Journal of Molecular Sciences 22, no. 11: 5596. https://doi.org/10.3390/ijms22115596