In Silico and In Vitro Analyses Validate Human MicroRNAs Targeting the SARS-CoV-2 3′-UTR
Abstract
:1. Introduction
2. Results
2.1. Prediction Tools Indicate That Human MicroRNAs Have Binding Sites in the 3′-UTR Sequence of SARS-CoV-2 Genome
2.2. Human Cell Lines Show Different Endogenous Regulation of SARS-CoV-2 3′-UTR
2.3. MicroRNAs Can Target the 3′-UTR Sequence of SARS-CoV-2
3. Discussion
4. Materials and Methods
4.1. SARS-CoV-2 Sequences
4.2. Computational Prediction
- IntaRNA ([72], version 2.0) [53]: we selected 10 interactions per RNA pair (microRNA/mRNA SARS-CoV-2 3′-UTR) with a minimal number of 6 base pairs in the seed region. No other parameters were modified. We exported the interactions from lower to higher free energy values and the 100 interactions with the lower E in CSV format.
- STarMir [77,78]: we manually introduced the microRNA lists in groups of 20, the NCBI genome ID of SARS-CoV-2 mRNA, and its 3′-UTR sequence. As STarMir require information on the CDS start and end points in the sequence, we included one additional nucleotide from the 5′end of the 3′-UTR, which served as both the start and end nucleotide of the CDS. The predictions, including Logit.Prob. values, were obtained.
4.3. Sequence Alignments and Analysis of Variants
4.4. Subcloning of SARS-CoV-2 3′-UTR Sequence
4.5. Cell Culture
4.6. Dual Luciferase Reporter Assays
4.7. MTT Assay
4.8. Data Analysis
5. Conclusions
Supplementary Materials
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Coronavirus Update (Live). Available online: https://www.worldometers.info/coronavirus/ (accessed on 24 May 2021).
- WHO Solidarity Trial Consortium; Pan, H.; Peto, R.; Henao-Restrepo, A.M.; Preziosi, M.P.; Sathiyamoorthy, V.; Abdool Karim, Q.; Alejandria, M.M.; Hernández García, C.; Kieny, M.P.; et al. Repurposed Antiviral Drugs for Covid-19—Interim WHO Solidarity Trial Results. N. Engl. J. Med. 2021, 384, 497–511. [Google Scholar] [CrossRef]
- Mohr, A.M.; Mott, J.L. Overview of microRNA biology. Semin. Liver Dis. 2015, 35, 3–11. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Trobaugh, D.W.; Klimstra, W.B. MicroRNA Regulation of RNA Virus Replication and Pathogenesis. Trends Mol. Med. 2017, 23, 80–93. [Google Scholar] [CrossRef] [PubMed]
- Bruscella, P.; Bottini, S.; Baudesson, C.; Pawlotsky, J.-M.; Feray, C.; Trabucchi, M. Viruses and miRNAs: More Friends than Foes. Front. Microbiol. 2017, 8, 824. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Chakraborty, C.; Sharma, A.R.; Sharma, G. Therapeutic advances of miRNAs: A preclinical and clinical update. J. Adv. Res. 2020, 28, 127–138. [Google Scholar] [CrossRef] [PubMed]
- Song, L.; Liu, H.; Gao, S.; Jiang, W.; Huang, W. Cellular MicroRNAs Inhibit Replication of the H1N1 Influenza A Virus in Infected Cells. J. Virol. 2010, 84, 8849–8860. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Wang, L.; Qin, Y.; Tong, L.; Wu, S.; Wang, Q.; Jiao, Q.; Guo, Z.; Lin, L.; Wang, R.; Zhao, W.; et al. MiR-342-5p suppresses coxsackievirus B3 biosynthesis by targeting the 2C-coding region. Antivir. Res. 2012, 93, 270–279. [Google Scholar] [CrossRef]
- Zheng, Z.; Ke, X.; Wang, M.; He, S.; Li, Q.; Zheng, C.; Zhang, Z.; Liu, Y.; Wang, H. Human MicroRNA hsa-miR-296-5p Suppresses Enterovirus 71 Replication by Targeting the Viral Genome. J. Virol. 2013, 87, 5645–5656. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Lu, R.; Zhao, X.; Li, J.; Niu, P.; Yang, B.; Wu, H.; Wang, W.; Song, H.; Huang, B.; Zhu, N.; et al. Genomic characterisation and epidemiology of 2019 novel coronavirus: Implications for virus origins and receptor binding. Lancet 2020, 395, 565–574. [Google Scholar] [CrossRef] [Green Version]
- Demirci, M.D.S.; Adan, A. Computational analysis of microRNA-mediated interactions in SARS-CoV-2 infection. PeerJ 2020, 8, e9369. [Google Scholar] [CrossRef]
- Ivashchenko, A.; Rakhmetullina, A.; Aisina, D. How miRNAs Can Protect Humans from Coronaviruses COVID-19, SARS-CoV, and MERS-CoV. PREPRINT (Version 1). 2020. Available online: https://www.researchsquare.com/article/rs-16264/latest.pdf (accessed on 24 May 2021).
- Jafarinejad-Farsangi, S.; Jazi, M.M.; Rostamzadeh, F.; Hadizadeh, M. High affinity of host human microRNAs to SARS-CoV-2 genome: An in silico analysis. Noncoding RNA Res. 2020, 5, 222–231. [Google Scholar] [CrossRef]
- Fulzele, S.; Sahay, B.; Yusufu, I.; Lee, T.J.; Sharma, A.; Kolhe, R.; Isales, C.M. COVID-19 Virulence in Aged Patients Might Be Impacted by the Host Cellular MicroRNAs Abundance/Profile. Aging Dis. 2020, 11, 509–522. [Google Scholar] [CrossRef] [PubMed]
- Hosseini Rad Sm, A.; McLellan, A.D. Implications of SARS-CoV-2 Mutations for Genomic RNA Structure and Host microRNA Targeting. Int. J. Mol. Sci. 2020, 21, 4807. [Google Scholar] [CrossRef]
- Mohammadi-Dehcheshmeh, M.; Moghbeli, S.M.; Rahimirad, S.; Alanazi, I.O.; Shehri, Z.S.A.; Ebrahimie, E. A Transcription Regulatory Sequence in the 5′ Untranslated Region of SARS-CoV-2 Is Vital for Virus Replication with an Altered Evolutionary Pattern against Human Inhibitory MicroRNAs. Cells 2021, 10, 319. [Google Scholar] [CrossRef]
- Alam, T.; Lipovich, L. miRCOVID-19: Potential Targets of Human miRNAs in SARS-CoV-2 for RNA-Based Drug Discovery. Noncoding RNA 2021, 7, 18. [Google Scholar] [CrossRef]
- Brown, B.D.; Naldini, L. Exploiting and antagonizing microARN regulation for therapeutical and experimental applications. Nat. Rev. Genet. 2009, 10, 578–585. [Google Scholar] [CrossRef]
- Mutalib, N.A.; Sulaiman, S.A.; Jamal, R. Computational tools for microRNA target prediction. In Book Computational Epigenetics and Diseases; Academic Press: Cambridge, MA, USA, 2019; Chapter 6; pp. 79–105. [Google Scholar] [CrossRef]
- Kozomara, A.; Griffiths-Jones, S. miRBase: Annotating high confidence microRNAs using deep sequencing data. Nucleic Acids Res. 2014, 42, 68–73. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- FTP Listing of/Pub/Mirbase/CURRENT/at Mirbase.org. Available online: Ftp://mirbase.org/pub/mirbase/CURRENT/Coronavirus (accessed on 20 May 2020).
- Rennie, W.; Liu, C.; Carmack, C.S.; Wolenc, A.; Kanoria, S.; Lu, J.; Long, D.; Ding, Y. STarMir: A web server for prediction of microRNA binding sites. Nucleic Acids Res. 2014, 42, 114–118. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Korber, B.; Fischer, W.; Gnanakaran, S.; Yoon, H.; Theiler, J.; Abfalterer, W.; Hengartner, N.; Giorgi, E.; Bhattacharya, T.; Foley, B.; et al. Tracking changes in SARS-CoV-2 Spike: Evidence that D614G increases infectivity of the COVID-19 virus. Cell 2020, 182, 812–827. [Google Scholar] [CrossRef]
- Nathans, R.; Chu, C.Y.; Serquina, A.K.; Lu, C.C.; Cao, H.; Rana, T.M. Cellular microRNA and P bodies modulate host-HIV-1 interactions. Mol. Cell 2009, 34, 696–709. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Yousefi, H.; Poursheikhani, A.; Bahmanpour, Z.; Vatanmakanian, M.; Taheri, M.; Mashouri, L.; Alahari, S.K. SARS-CoV infection crosstalk with human host cell noncoding-RNA machinery: An in-silico approach. Biomed. Pharmacother. 2020, 130, 110548. [Google Scholar] [CrossRef]
- Arisan, E.D.; Dart, A.; Grant, G.H.; Arisan, S.; Cuhadaroglu, S.; Lange, S.; Uysal-Onganer, P. The Prediction of miRNAs in SARS-CoV-2 Genomes: Hsa-miR Databases Identify 7 Key miRs Linked to Host Responses and Virus Pathogenicity-Related KEGG Pathways Significant for Comorbidities. Viruses 2020, 12, 614. [Google Scholar] [CrossRef] [PubMed]
- Chen, L.; Zhong, L. Genomics functional analysis and drug screening of SARS-CoV-2. Genes Dis. 2020, 7, 542–550. [Google Scholar] [CrossRef] [PubMed]
- Balmeh, N.; Mahmoudi, S.; Mohammadi, N.; Karabedianhajiabadi, A. Predicted therapeutic targets for COVID-19 disease by inhibiting SARS-CoV-2 and its related receptors. Inform. Med. Unlocked 2020, 20, 100407. [Google Scholar] [CrossRef]
- Chan, A.P.; Choi, Y.; Schork, N.J. Conserved Genomic Terminals of SARS-CoV-2 as Co-evolving Functional Elements and Potential Therapeutic Targets. mSphere 2020, 5, e00754-20. [Google Scholar] [CrossRef] [PubMed]
- Zheng, Y.; Fu, X.; Wang, L.; Zhang, W.; Zhou, P.; Zhang, X.; Zeng, W.; Chen, J.; Cao, Z.; Jia, K.; et al. Comparative analysis of MicroRNA expression in dog lungs infected with the H3N2 and H5N1 canine influenza viruses. Microb. Pathog. 2018, 121, 252–261. [Google Scholar] [CrossRef] [PubMed]
- Bavagnoli, L.; Campanini, G.; Forte, M.; Ceccotti, G.; Percivalle, E.; Bione, S.; Lisa, A.; Baldanti, F.; Maga, G. Identification of a novel antiviral micro-RNA targeting the NS1 protein of the H1N1 pandemic human influenza virus and a corresponding viral escape mutation. Antivir. Res. 2019, 171, 104593. [Google Scholar] [CrossRef]
- Lange, S.; Arisan, E.D.; Grant, G.H.; Uysal-Onganer, P. MicroRNAs for Virus Pathogenicity and Host Responses, Identified in SARS-CoV-2 Genomes, May Play Roles in Viral-Host Co-Evolution in Putative Zoonotic Host Species. Viruses 2021, 13, 117. [Google Scholar] [CrossRef]
- miRTarBase—The Experimentally Validated MicroRNA-Target Interactions Database. Available online: http://mirtarbase.cuhk.edu.cn/php/index.php (accessed on 19 May 2021).
- Huang, H.Y.; Lin, Y.C.; Li, J.; Huang, K.Y.; Shrestha, S.; Hong, H.C.; Tang, Y.; Chen, Y.G.; Jin, C.N.; Yu, Y.; et al. miRTarBase 2020: Updates to the experimentally validated microRNA-target interaction database. Nucleic Acids Res. 2020, 48, D148–D154. [Google Scholar] [CrossRef] [Green Version]
- Fei, S.; Cao, L.; Pan, L. microRNA-3941 targets IGF2 to control LPS-induced acute pneumonia in A549 cells. Mol. Med. Rep. 2018, 17, 4019–4026. [Google Scholar] [CrossRef] [PubMed]
- Kindrachuk, J.; Ork, B.; Hart, B.J.; Mazur, S.; Holbrook, M.R.; Frieman, M.B.; Traynor, D.; Johnson, R.F.; Dyall, J.; Kuhn, J.H.; et al. Antiviral Potential of ERK/MAPK and PI3K/AKT/mTOR Signaling Modulation for Middle East Respiratory Syndrome Coronavirus Infection as Identified by Temporal Kinome Analysis. Antimicrob. Agents Chemother. 2015, 59, 1088–1099. [Google Scholar] [CrossRef] [Green Version]
- Icard, P.; Lincet, H.; Wu, Z.; Coquerel, A.; Forgez, P.; Alifano, M.; Fournel, L. The key role of Warburg effect in SARS-CoV-2 replication and associated inflammatory response. Biochimie 2020, 180, 169–177. [Google Scholar] [CrossRef]
- H2V—Human Response to Coronaviruses. Available online: http://www.datjar.com:40090/h2v/ (accessed on 21 May 2021).
- Zhou, N.; Bao, J.; Ning, Y. H2V: A database of human genes and proteins that respond to SARS-CoV-2, SARS-CoV, and MERS-CoV infection. BMC Bioinform. 2021, 22, 18. [Google Scholar] [CrossRef] [PubMed]
- Chow, J.T.; Salmena, L. Prediction and Analysis of SARS-CoV-2-Targeting MicroRNA in Human Lung Epithelium. Genes 2020, 11, 1002. [Google Scholar] [CrossRef] [PubMed]
- Sardar, R.; Satish, D.; Birla, S.; Gupta, D. Integrative analyses of SARS-CoV-2 genomes from different geographical locations reveal unique features potentially consequential to host-virus interaction, pathogenesis and clues for novel therapies. Heliyon 2020, 6, e04658. [Google Scholar] [CrossRef]
- Gasparello, J.; Finotti, A.; Gambari, R. Tackling the COVID-19 “cytokine storm” with microRNA mimics directly targeting the 3′UTR of pro-inflammatory mRNAs. Med. Hypotheses 2021, 146, 110415. [Google Scholar] [CrossRef]
- Pan, D.; Flores, O.; Umbach, J.L.; Pesola, J.M.; Bentley, P.; Rosato, P.C.; Leib, D.A.; Cullen, B.R.; Coen, D.M. A neuron-specific host microRNA targets herpes simplex virus-1 ICP0 expression and promotes latency. Cell Host Microbe 2014, 15, 446–456. [Google Scholar] [CrossRef] [Green Version]
- Sun, B.; Yang, X.; Hou, F.; Yu, X.; Wang, Q.; Oh, H.S.; Raja, P.; Pesola, J.M.; Vanni, E.A.H.; McCarron, S.; et al. Regulation of host and virus genes by neuronal miR-138 favours herpes simplex virus 1 latency. Nat. Microbiol. 2021, 6, 682–696. [Google Scholar] [CrossRef] [PubMed]
- Gene Ontology. Available online: http://geneontology.org/ (accessed on 21 May 2021).
- Gene Ontology Consortium. The Gene Ontology resource: Enriching a GOld mine. Nucleic Acids Res. 2021, 49, D325–D334. [Google Scholar] [CrossRef] [PubMed]
- Arbuckle, J.H.; Gardina, P.J.; Gordon, D.N.; Hickman, H.D.; Yewdell, J.W.; Pierson, T.C.; Myers, T.G.; Kristie, T.M. Inhibitors of the Histone Methyltransferases EZH2/1 Induce a Potent Antiviral State and Suppress Infection by Diverse Viral Pathogens. MBio 2017, 8, e01141-17. [Google Scholar] [CrossRef] [Green Version]
- Pan, T.; Hu, X.; Liu, T.; Xu, Z.; Wan, N.; Zhang, Y.; Li, S. MiR-128-1-5p regulates tight junction induced by selenium deficiency via targeting cell adhesion molecule 1 in broilers vein endothelial cells. J. Cell. Physiol. 2018, 233, 8802–8814. [Google Scholar] [CrossRef] [PubMed]
- Tian, W.; Zhang, N.; Jin, R.; Feng, Y.; Wang, S.; Gao, S.; Wong, C.C. Immune suppression in the early stage of COVID-19 disease. Nat. Commun. 2020, 11, 1–8. [Google Scholar] [CrossRef] [PubMed]
- Gordon, D.E.; Hiatt, J.; Bouhaddou, M.; Rezelj, V.V.; Ulferts, S.; Braberg, H.; Jureka, A.S.; Obernier, K.; Guo, J.Z.; Batra, J.; et al. Comparative host-coronavirus protein interaction networks reveal pan-viral disease mechanisms. Science 2020, 370, eabe9403. [Google Scholar] [CrossRef] [PubMed]
- Stukalov, A.; Girault, V.; Grass, V.; Karayel, O.; Bergant, V.; Urban, C.; Haas, D.A.; Huang, Y.; Oubraham, L.; Wang, A.; et al. Multilevel proteomics reveals host perturbations by SARS-CoV-2 and SARS-CoV. Nature 2021. [Google Scholar] [CrossRef] [PubMed]
- Wang, J.; Zheng, X.; Peng, Q.; Zhang, X.; Qin, Z. Eph receptors: The bridge linking host and virus. Cell Mol. Life Sci. 2020, 77, 2355–2365. [Google Scholar] [CrossRef] [Green Version]
- Shi, S.T.; Lee, K.J.; Aizaki, H.; Hwang, S.B.; Lai, M.M. Hepatitis C virus RNA replication occurs on a detergent-resistant membrane that cofractionates with caveolin-2. J. Virol. 2003, 77, 4160–4168. [Google Scholar] [CrossRef] [Green Version]
- Moore, J.P.; Offit, P.A. SARS-CoV-2 Vaccines and the Growing Threat of Viral Variants. JAMA 2021, 325, 821–822. [Google Scholar] [CrossRef]
- Periwal, N.; Sarma, S.; Arora, P.; Sood, V. In-silico analysis of SARS-CoV-2 genomes: Insights from SARS encoded non-coding RNAs. bioRxiv 2020. [Google Scholar] [CrossRef]
- Chen, D.Y.; Khan, N.; Close, B.J.; Goel, R.K.; Blum, B.; Tavares, A.H.; Kenney, D.; Conway, H.L.; Ewoldt, J.K.; Kapell, S.; et al. SARS-CoV-2 desensitizes host cells to interferon through inhibition of the JAK-STAT pathway. bioRxiv 2020. [Google Scholar] [CrossRef]
- Monteil, V.; Kwon, H.; Prado, P.; Hagelkrüys, A.; Wimmer, R.A.; Stahl, M.; Leopoldi, A.; Garreta, E.; Hurtado Del Pozo, C.; Prosper, F.; et al. Inhibition of SARS-CoV-2 Infections in Engineered Human Tissues Using Clinical-Grade Soluble Human ACE2. Cell 2020, 181, 905–913.e7. [Google Scholar] [CrossRef]
- Qian, Q.; Fan, L.; Liu, W.; Li, J.; Yue, J.; Wang, M.; Ke, X.; Yin, Y.; Chen, Q.; Jiang, C. Direct evidence of active SARS-CoV-2 replication in the intestine. Clin. Infect. Dis. 2020, 8, ciaa925. [Google Scholar] [CrossRef] [PubMed]
- Lamers, M.M.; Beumer, J.; van der Vaart, J.; Knoops, K.; Puschhof, J.; Breugem, T.I.; Ravelli, R.B.G.; Paul van Schayck, J.; Mykytyn, A.Z.; Duimel, H.Q.; et al. SARS-CoV-2 productively infects human gut enterocytes. Science 2020, 369, 50–54. [Google Scholar] [CrossRef]
- Zhang, B.Z.; Chu, H.; Han, S.; Shuai, H.; Deng, J.; Hu, Y.F.; Gong, H.R.; Lee, A.C.; Zou, Z.; Yau, T.; et al. SARS-CoV-2 infects human neural progenitor cells and brain organoids. Cell Res. 2020, 30, 928–931. [Google Scholar] [CrossRef]
- Song, E.; Zhang, C.; Israelow, B.; Lu-Culligan, A.; Prado, A.V.; Skriabine, S.; Lu, P.; Weizman, O.E.; Liu, F.; Dai, Y.; et al. Neuroinvasion of SARS-CoV-2 in human and mouse brain. J. Exp. Med. 2021, 218, e20202135. [Google Scholar] [CrossRef] [PubMed]
- Dong, M.; Zhang, J.; Ma, X.; Tan, J.; Chen, L.; Liu, S.; Xin, Y.; Zhuang, L. ACE2, TMPRSS2 distribution and extrapulmonary organ injury in patients with COVID-19. Biomed. Pharmacother. 2020, 131, 110678. [Google Scholar] [CrossRef] [PubMed]
- GenBank Overview. Available online: https://www.ncbi.nlm.nih.gov/genbank/ (accessed on 20 May 2020).
- GISAID—Initiative. Available online: https://www.gisaid.org/ (accessed on 7 March 2021).
- Elbe, S.; Bucklanåd-Merrett, G. Data, disease and diplomacy: GISAID’s innovative contribution to global health. Glob. Chall. 2017, 1, 33–46. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- GenBank Overview. Available online: http://www.mirbase.org (accessed on 20 May 2020).
- Mann, M.; Wright, P.R.; Backofen, R. IntaRNA 2.0: Enhanced and customizable prediction of RNA–RNA interactions. Nucleic Acids Res. 2017, 45, 435–439. [Google Scholar] [CrossRef]
- Wong, N.; Wang, X. miRDB: An online resource for microRNA target prediction and functional annotations. Nucleic Acids Res. 2015, 43, 146–152. [Google Scholar] [CrossRef]
- High Confidence miRNA Set Available for miRBase 21—miRBase Blog. Available online: http://www.mirbase.org/blog/2014/07/high-confidence-mirna-set-available-for-mirbase-21/ (accessed on 20 May 2020).
- miRDB—MicroRNA Target Prediction Database. Available online: http://mirdb.org/index.html (accessed on 17 August 2020).
- Chen, Y.; Wang, X. miRDB: An online database for prediction of functional microRNA targets. Nucleic Acids Res. 2020, 48, 127–131. [Google Scholar] [CrossRef] [Green Version]
- IntaRNA—RNA-RNA Interaction. Available online: http://rna.informatik.uni-freiburg.de/IntaRNA/Input.jsp (accessed on 25 August 2020).
- RNA22 V2. Available online: https://cm.jefferson.edu/rna22/Interactive/ (accessed on 18 August 2020).
- Miranda, K.C.; Huynh, T.; Tay, Y.; Ang, Y.S.; Tam, W.L.; Thomson, A.M.; Lim, B.; Rigoutsos, I. A pattern-based method for the identification of MicroRNA binding sites and their corresponding heteroduplexes. Cell 2006, 126, 1203–1217. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- BiBiServ2—RNAhybrid. Available online: https://bibiserv.cebitec.uni-bielefeld.de/rnahybrid (accessed on 20 August 2020).
- Rehmsmeier, M.; Steffen, P.; Hochsmann, M.; Giegerich, R. Fast and effective prediction of microRNA/target duplexes. RNA 2004, 10, 1507–1517. [Google Scholar] [CrossRef] [Green Version]
- Welcome to STarMir. Available online: http://sfold.wadsworth.org/cgi-bin/starmirtest2.pl (accessed on 24 August 2020).
- Liu, C.; Mallick, B.; Long, D.; Rennie, W.A.; Wolenc, A.; Carmack, C.S.; Ding, Y. StarMir: CLIP-based prediction of mammalian microRNA binding sites. Nucleic Acids Res. 2013, 41, e138. [Google Scholar] [CrossRef] [Green Version]
- Multiple Sequence Alignment—CLUSTALW. Available online: https://www.genome.jp/tools-bin/clustalw (accessed on 7 March 2021).
- Thompson, J.D.; Higgins, D.G.; Gibson, T.J. CLUSTAL W: Improving the sensitivity of progressive multiple sequence alignment through sequence weighting, position-specific gap penalties and weight matrix choice. Nucleic Acids Res. 1994, 22, 4673–4680. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- COVID CG. Available online: https://covidcg.org/ (accessed on 22 February 2021).
- Chen, A.T.; Altschuler, K.; Zhan, S.H.; Chan, Y.A.; Deverman, B.E. COVID-19 CG: Tracking SARS-CoV-2 mutations by locations and dates of interest. bioRxiv 2020. [Google Scholar] [CrossRef]
- Addgene—pmiRGLO Plasmid. Available online: http://www.addgene.org/vector-database/8236/ (accessed on 21 May 2021).
- Chauhan, N.; Jaggi, M.; Chauhan, S.C.; Yallapu, M.M. COVID-19: Fighting the invisible enemy with microRNAs. Expert Rev. Anti-Infect. Ther. 2021, 19, 137–145. [Google Scholar] [CrossRef] [PubMed]
microRNA | miRDB | IntaRNA | RNA22 | RNAhybrid | STarMir | |
---|---|---|---|---|---|---|
Target Score | Energy Score | Folding Energy (p-Value) | Minimum Free Energy | Logit. Prob. | ||
Complete miRBase 22 | hsa-miR-4717-3p | 68 | −10.21 | −16 (0.33) | −26.3 | 0.898 |
hsa-miR-3941 | 84 | −11.32 | −19.2 | 0.805 | ||
hsa-miR-466 | 81 | −7.57 | −14.7 | 0.756 | ||
hsa- miR-5088-5p | 60 | −9.59 | −21.8 | 0.803 | ||
hsa-miR-4775 | 78 | −6.56 | −15.7 | 0.719 | ||
High confidence miRBase 22 | hsa-miR-1307-3p | −19.56 | −31.1 (0.224) | −37.6 | 0.761 | |
hsa-miR-5010-5p | −16.44 | −28.7 | 0.769 | |||
hsa-miR-128-1-5p | −15 | −30 | 0.879 | |||
hsa-miR-4433b-3p | −14.5 | −26.5 | 0.86 | |||
hsa-miR-365b-5p | −12.8 | −34.2 | 0.831 |
Nowadays | ||||||
---|---|---|---|---|---|---|
Nucleotide | Frequency (%) | Mutation | Dates | Yes/No | Where | |
hsa-miR-3941 | 29,679 | 0.5 | T | July 20–Jan 21 | No | |
29,686 | 0.3 | T | Sept 20–Jan 21 | No | ||
29,690 | 0.1 | T | Jan 21 | No | ||
29,692 | 1.4 | T | May 20–Jan 21 | No | ||
hsa-miR-138-5p | 29,706 | 0.3 | T | Jun 20–Feb 21 | Yes | All |
29,708 | 0.1 | T | Mar 20–Feb 21 | Yes | All | |
29,710 | 0.5 | C | Apr 20–Feb 21 | Yes | The United States | |
29,711 | 0.1 | T | Mar 20–Feb 21 | Yes | The United States and Europe | |
29,717 | 0.1 | A | Apr 20–Feb 21 | Yes | Europe | |
29,721 | 0.1 | T | Jun 20–Jan 21 | No | ||
29,726 | 0.2 | - | Oct 20–Feb 21 | Yes | Europe | |
29,730 | 0.4 | T/G | May 20–Feb 21 | Yes | Europe and The United States | |
29,732 | 1.1 | A/G | Jul 20–Feb 21 | Yes | Europe | |
29,733 | 0.2 | T | Apr 20–Feb 21 | No | Canada | |
29,734 | 5.1 | T/G/A/C | Apr 20–Feb 21 | Yes | The United States and Europe | |
29,736 | 0.1 | T | May 20–Feb 21 | Yes | All | |
29,737 | 0.3 | C | Jun 20–Feb 21 | Yes | The United States and Europe | |
29,738 | 0.1 | T | May 20–Feb 21 | Yes | The United States and Europe | |
29,740 | 0.3 | A | Sept 20–Feb 21 | Yes | Europe | |
29,741 | 0.4 | T | Sept 20–Feb 21 | Yes | The United States and Europe | |
29,742 | 0.7 | T/A | Mar 20–Feb 21 | Yes | The United States and Europe | |
29,743 | 0.4 | T | Apr 20–Feb 21 | Yes | All | |
hsa-miR-365b-5p | 29,784 | 0.4 | T | May 20–Feb 21 | Yes | The United States |
29,785 | 0.2 | A | Jun 20–Feb 21 | Yes | Europe | |
29,791 | 0.8 | C/G/T | ||||
29,796 | 7.6 | C/G/A | ||||
29,797 | 0.3 | T | Dec 20–Feb 21 | Yes | Europe | |
29,798 | 0.3 | C | Jan 21–Feb 21 | Yes | Europe | |
29,799 | 0.4 | -/C | Dec 20–Feb 21 | Yes | Europe | |
29,803 | 0.1 | T | Oct 20 | No | ||
hsa-miR-128-1-5p | 29,825 | 0.1 | T | Jul 20–Jan 21 | No |
Principle | miRDB | IntaRNA | RNA22 | RNAhybrid | STarMiR |
---|---|---|---|---|---|
Seed sequence complementary | X | X | X | X | X |
Free energy | X | X | X | X | X |
G-U wobble | X | X | X | X | X |
Evolutionary conservation status | X | X | X | ||
3′-UTR compensatory binding | X | X | |||
Target-site accessibility | X | X | X | X | |
Target-site abundance | X | ||||
Local AU flanking content | X | X | |||
Machine learning | X | X | |||
Pattern-based approach | X | X |
Primers | Sequences |
---|---|
Forward SARS-CoV-2 3′-UTR SacI | 5′ctcgagctctaacaatctttaatcagtgtgtaacattagggaggacttgaaagagccaccacattttcaccgaggccacgcggagtacgatcgagtgtacagtgaacaatgctagggaga3′ |
Reverse SARS-CoV-2 3′-UTR SalI | 5′ctcgtcgactgtcattctcctaagaagctattaaaatcacatggggatagcactactaaaattaattttacacattagggctcttccatataggcagctctccctagcattgttcactgt3′ |
Forward pmiRGLO sequencing | 5′caagaagggcggcaagatcg3′ |
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations. |
© 2021 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Barreda-Manso, M.A.; Nieto-Díaz, M.; Soto, A.; Muñoz-Galdeano, T.; Reigada, D.; Maza, R.M. In Silico and In Vitro Analyses Validate Human MicroRNAs Targeting the SARS-CoV-2 3′-UTR. Int. J. Mol. Sci. 2021, 22, 6094. https://doi.org/10.3390/ijms22116094
Barreda-Manso MA, Nieto-Díaz M, Soto A, Muñoz-Galdeano T, Reigada D, Maza RM. In Silico and In Vitro Analyses Validate Human MicroRNAs Targeting the SARS-CoV-2 3′-UTR. International Journal of Molecular Sciences. 2021; 22(11):6094. https://doi.org/10.3390/ijms22116094
Chicago/Turabian StyleBarreda-Manso, María Asunción, Manuel Nieto-Díaz, Altea Soto, Teresa Muñoz-Galdeano, David Reigada, and Rodrigo M. Maza. 2021. "In Silico and In Vitro Analyses Validate Human MicroRNAs Targeting the SARS-CoV-2 3′-UTR" International Journal of Molecular Sciences 22, no. 11: 6094. https://doi.org/10.3390/ijms22116094