YB-1 Is Altered in Pregnancy-Associated Disorders and Affects Trophoblast in Vitro Properties via Alternation of Multiple Molecular Traits
Abstract
1. Introduction
2. Results
2.1. YB-1 Expression Is Unaltered in Miscarriage Samples but Is Impaired in IUGR and PE Syndrome
2.2. YB-1 Enhances Trophoblast Cell Proliferation
2.3. Exposure to YB-1 Positively Affects Migration and Invasion of Trophoblasts
2.4. Loss of YB-1 Function Reduces Proliferation and Affects Apoptosis in Trophoblasts
2.5. Loss of YB-1 Affects Trophoblast Functionality by Modulation of Genes Involved in Cell Migration and Invasion
2.6. YB-1 Mediates IL-6 Secretion and Directly Binds to NF-B Regulatory DNA Regions
3. Discussion
4. Conclusions
5. Materials and Methods
5.1. Sampling and Ethical Approval
5.2. Cell Lines
5.3. YB-1 Detection in Serum
5.4. Recombinant YB-1 Protein Harvest and Purification
5.5. YBX1 Overexpression
5.6. Lentiviral Transduction of YB-1
5.7. Protein Isolation and Western Blot Analysis
5.8. Functional Assays
5.9. RNA Isolation and qPCR Analysis
5.10. IL-6 Quantification
5.11. Caspase Activity Assay
5.12. MTT Assay
5.13. Chromatin Immunoprecipitation Assay (CHIP)
5.14. Statistical Analysis
Supplementary Materials
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Acknowledgments
Conflicts of Interest
References
- Romero, R.; Kusanovic, J.P.; Chaiworapongsa, T.; Hassan, S.S. Placental bed disorders in preterm labor, preterm PROM, spontaneous abortion and abruptio placentae. Best Pr. Res. Clin. Obs. Gynaecol. 2011, 25, 313–327. [Google Scholar] [CrossRef]
- Fisher, S.J. Why is placentation abnormal in preeclampsia? Am. J. Obs. Gynecol. 2015, 213, S115–S122. [Google Scholar] [CrossRef]
- Burton, G.J.; Jauniaux, E. Placental oxidative stress: From miscarriage to preeclampsia. J. Soc. Gynecol. Investig. 2004, 11, 342–352. [Google Scholar] [CrossRef]
- Schumacher, A.; Zenclussen, A.C. Human Chorionic Gonadotropin-Mediated Immune Responses That Facilitate Embryo Implantation and Placentation. Front. Immunol. 2019, 10, 1–14. [Google Scholar] [CrossRef]
- Whitley, G.S.J.; Cartwright, J.E. Cellular and Molecular Regulation of Spiral Artery Remodelling: Lessons from the Cardiovascular Field. Placenta 2010, 31, 465–474. [Google Scholar] [CrossRef]
- Mullen, C.A. Analogies between trophoblastic and malignant cells. Am. J. Reprod. Immunol. 1998, 39, 41–49. [Google Scholar] [CrossRef] [PubMed]
- Ferretti, C.; Bruni, L.; Dangles-Marie, V.; Pecking, A.P.; Bellet, D. Molecular circuits shared by placental and cancer cells, and their implications in the proliferative, invasive and migratory capacities of trophoblasts. Hum. Reprod. Update 2007, 13, 121–141. [Google Scholar] [CrossRef]
- Fujiwara-Okada, Y.; Matsumoto, Y.; Fukushi, J.; Setsu, N.; Matsuura, S.; Kamura, S.; Fujiwara, T.; Iida, K.; Hatano, M.; Nabeshima, A.; et al. Y-box binding protein-1 regulates cell proliferation and is associated with clinical outcomes of osteosarcoma. Br. J. Cancer 2013, 108, 836–847. [Google Scholar] [CrossRef]
- Davies, A.H.; Barrett, I.; Pambid, M.R.; Hu, K.; Stratford, A.L.; Freeman, S.; Berquin, I.M.; Pelech, S.; Hieter, P.; Maxwell, C.; et al. YB-1 evokes susceptibility to cancer through cytokinesis failure, mitotic dysfunction and HER2 amplification. Oncogene 2011, 30, 3649–3660. [Google Scholar] [CrossRef][Green Version]
- Faury, D.; Nantel, A.; Dunn, S.E.; Guiot, M.C.; Haque, T.; Hauser, P.; Garami, M.; Bognár, L.; Hanzély, Z.; Liberski, P.P.; et al. Molecular profiling identifies prognostic subgroups of pediatric glioblastoma and shows increased YB-1 expression in tumors. J. Clin. Oncol. 2007, 25, 1196–1208. [Google Scholar] [CrossRef] [PubMed]
- Kosnopfel, C.; Sinnberg, T.; Sauer, B.; Niessner, H.; Muenchow, A.; Fehrenbacher, B.; Schaller, M.; Mertens, P.R.; Garbe, C.; Thakur, B.K.; et al. Tumour progression stage-dependent secretion of YB-1 stimulates melanoma cell migration and invasion. Cancers 2020, 12, 2328. [Google Scholar] [CrossRef]
- Izumi, H.; Imamura, T.; Nagatani, G.; Ise, T.; Murakami, T.; Uramoto, H.; Torigoe, T.; Ishiguchi, H.; Yoshida, Y.; Nomoto, M.; et al. Y box-binding protein-1 binds preferentially to single-stranded nucleic acids and exhibits 3 ′ →5 ′ exonuclease activity. Nucleic Acids Res. 2001, 29, 1200–1207. [Google Scholar] [CrossRef]
- Lasham, A.; Print, C.G.; Woolley, A.G.; Dunn, S.E.; Braithwaite, A.W. YB-1: Oncoprotein, prognostic marker and therapeutic target? Biochem. J. 2013, 449, 11–23. [Google Scholar] [CrossRef]
- Fujii, T.; Seki, N.; Namoto-Matsubayashi, R.; Takahashi, H.; Inoue, Y.; Toh, U.; Kage, M.; Shirouzu, K. YB-1 prevents apoptosis via the mTOR/STAT3 pathway in HER-2-overexpressing breast cancer cells. Futur. Oncol. 2009, 5, 153–156. [Google Scholar] [CrossRef] [PubMed]
- Lindquist, J.A.; Mertens, P.R. Cold shock proteins: From cellular mechanisms to pathophysiology and disease. Cell Commun. Signal. 2018, 16, 1–14. [Google Scholar] [CrossRef] [PubMed]
- Rauen, T.; Raffetseder, U.; Frye, B.C.; Djudjaj, S.; Mühlenberg, P.J.T.; Eitner, F.; Lendahl, U.; Bernhagen, J.; Dooley, S.; Mertens, P.R. YB-1 acts as a ligand for notch-3 receptors and modulates receptor activation. J. Biol. Chem. 2009, 284, 26928–26940. [Google Scholar] [CrossRef]
- Ito, K.; Tsutsumi, K.I.; Kuzumaki, T.; Gomez, P.F.; Otsu, K.; Ishikawa, K. A novel growth-inducible gene that encodes a protein with a conserved cold-shock domain. Nucleic Acids Res. 1994, 22, 2036–2041. [Google Scholar] [CrossRef]
- Lu, Z.H.; Books, J.T.; Ley, T.J. YB-1 Is Important for Late-Stage Embryonic Development, Optimal Cellular Stress Responses, and the Prevention of Premature Senescence. Mol. Cell. Biol. 2005, 25, 4625–4637. [Google Scholar] [CrossRef]
- Uchiumi, T.; Fotovati, A.; Sasaguri, T.; Shibahara, K.; Shimada, T.; Fukuda, T.; Nakamura, T.; Izumi, H.; Tsuzuki, T.; Kuwano, M.; et al. YB-1 is important for an early stage embryonic development: Neural tube formation and cell proliferation. J. Biol. Chem. 2006, 281, 40440–40449. [Google Scholar] [CrossRef]
- Meyer, N.; Schumacher, A.; Coenen, U.; Woidacki, K.; Schmidt, H.; Lindquist, J.A.; Mertens, P.R.; Zenclussen, A.C. Y-Box Binding Protein 1 Expression in Trophoblast Cells Promotes Fetal and Placental Development. Cells 2020, 9, 1942. [Google Scholar] [CrossRef]
- Hannan, N.J.; Paiva, P.; Dimitriadis, E.; Salamonsen, L.A. Models for study of human embryo implantation: Choice of cell lines? Biol. Reprod. 2010, 82, 235–245. [Google Scholar] [CrossRef]
- Brasier, A.R. The nuclear factor-B-interleukin-6 signalling pathway mediating vascular inflammation. Cardiovasc. Res. 2010, 86, 211–218. [Google Scholar] [CrossRef]
- Wongchana, W.; Palaga, T. Direct regulation of interleukin-6 expression by Notch signaling in macrophages. Cell Mol. Immunol. 2012, 9, 155–162. [Google Scholar] [CrossRef]
- Creyghton, M.P.; Cheng, A.W.; Welstead, G.G.; Kooistra, T.; Carey, B.W.; Steine, E.J.; Hanna, J.; Lodato, M.A.; Frampton, G.M.; Sharp, P.A.; et al. Histone H3K27ac separates active from poised enhancers and predicts developmental state. Proc. Natl. Acad. Sci. USA 2010, 107, 21931–21936. [Google Scholar] [CrossRef] [PubMed]
- Kotake, Y.; Arikawa, N.; Tahara, K.; Maru, H.; Naemura, M. Y-box binding protein 1 is involved in regulating the G2/M phase of the cell cycle. Anticancer Res. 2017, 37, 1603–1608. [Google Scholar] [CrossRef] [PubMed]
- Villar, J.; Carroli, G.; Wojdyla, D.; Abalos, E.; Giordano, D.; Ba’aqeel, H.; Farnot, U.; Bergsjø, P.; Bakketeig, L.; Lumbiganon, P.; et al. Preeclampsia, gestational hypertension and intrauterine growth restriction, related or independent conditions? Am. J. Obstet. Gynecol. 2006, 194, 921–931. [Google Scholar] [CrossRef]
- Maynard, S.E.; Min, J.; Merchan, J.; Lim, K.; Li, J.; Mondal, S.; Libermann, T.; Morgon, J.P.; Sellke, F.W.; Stillman, I.E.; et al. Excess placental soluble fms-like tyrosine kinase 1 (sFlt1) may contribute to endothelial dysfunction, hypertension, and proteinuria in preeclampsia. J. Clin. Invest. 2003, 111, 649–658. [Google Scholar] [CrossRef]
- Venkatesha, S.; Toporsian, M.; Lam, C.; Hanai, J.; Mammoto, T.; Kim, Y.M.; Bdolah, Y.; Lim, K.-H.; Yuan, H.-T.; Libermann, T.; et al. Soluble endoglin contributes to the pathogenesis of preeclampsia. Nat. Med. 2006, 12, 642–649. [Google Scholar] [CrossRef] [PubMed]
- Xue, X.; Huang, J.; Yu, K.; Chen, X.; He, Y.; Qi, D.; Wu, Y. YB-1 transferred by gastric cancer exosomes promotes angiogenesis via enhancing the expression of angiogenic factors in vascular endothelial cells. BMC Cancer 2020, 20, 1–12. [Google Scholar] [CrossRef]
- Frye, B.C.; Halfter, S.; Djudjaj, S.; Muehlenberg, P.; Weber, S.; Raffetseder, U.; En-Nia, A.; Knott, H.; Baron, J.M.; Dooley, S.; et al. Y-box protein-1 is actively secreted through a non-classical pathway and acts as an extracellular mitogen. EMBO Rep. 2009, 10, 783–789. [Google Scholar] [CrossRef]
- Gopal, S.K.; Greening, D.W.; Mathias, R.A.; Ji, H.; Rai, A.; Chen, M.; Zhu, H.J.; Simpson, R.J. YBX1/YB-1 induces partial EMT and tumourigenicity through secretion of angiogenic factors into the extracellular microenvironment. Oncotarget 2015, 6, 13718–13730. [Google Scholar] [CrossRef]
- Abou-Kheir, W.; Barrak, J.; Hadadeh, O.; Daoud, G. HTR-8/SVneo cell line contains a mixed population of cells. Placenta 2017, 50, 1–7. [Google Scholar] [CrossRef] [PubMed]
- Safak, M.; Gallia, G.L.; Ansari, S.A.; Khalili, K. Physical and Functional Interaction between the Y-Box Binding Protein YB-1 and Human Polyomavirus JC Virus Large T Antigen. J. Virol. 1999, 73, 10146–10157. [Google Scholar] [CrossRef]
- Mayhew, T.M.; Leach, L.; McGee, R.; Wan Ismail, W.; Myklebust, R.; Lammiman, M.J. Proliferation, differentiation and apoptosis in villous trophoblast at 13-41 weeks of gestation (including observations on annulate lamellae and nuclear pore complexes). Placenta 1999, 20, 407–422. [Google Scholar] [CrossRef] [PubMed]
- Ishihara, N.; Matsuo, H.; Murakoshi, H.; Laoag-Fernandez, J.B.; Samoto, T.; Maruo, T. Increased apoptosis in the syncytiotrophoblast in human term placentas complicated by either preeclampsia or intrauterine growth retardation. Am. J. Obstet. Gynecol. 2002, 186, 158–166. [Google Scholar] [CrossRef] [PubMed]
- Straszewski-Chavez, S.L.; Abrahams, V.M.; Mor, G. The role of apoptosis in the regulation of trophoblast survival and differentiation during pregnancy. Endocr. Rev. 2005, 26, 877–897. [Google Scholar] [CrossRef] [PubMed]
- Lovett, D.H.; Cheng, S.; Cape, L.; Pollock, A.S.; Mertens, P.R. YB-1 alters MT1-MMP trafficking and stimulates MCF-7 breast tumor invasion and metastasis. Biochem. Biophys. Res. Commun. 2010, 398, 482–488. [Google Scholar] [CrossRef] [PubMed][Green Version]
- Zhao, S.; Wang, Y.; Guo, T.; Yu, W.; Li, J.; Tang, Z.; Yu, Z.; Zhao, L.; Zhang, Y.; Wang, Z.; et al. YBX1 regulates tumor growth via CDC25a pathway in human lung adenocarcinoma. Oncotarget 2016, 7, 82139–82157. [Google Scholar] [CrossRef]
- Jia, J.; Zheng, Y.; Wang, W.; Shao, Y.; Li, Z.; Wang, Q.; Wang, Y.; Yan, H. Antimicrobial peptide LL-37 promotes YB-1 expression, and the viability, migration and invasion of malignant melanoma cells. Mol. Med. Rep. 2017, 15, 240–248. [Google Scholar] [CrossRef]
- Liang, C.; Ma, Y.; Yong, L.; Yang, C.; Wang, P.; Liu, X.; Zhu, B.; Zhou, H.; Liu, X.; Liu, Z. Y-box binding protein-1 promotes tumorigenesis and progression via the epidermal growth factor receptor/AKT pathway in spinal chordoma. Cancer Sci. 2019, 110, 166–179. [Google Scholar] [CrossRef]
- Johnson, T.G.; Schelch, K.; Mehta, S.; Burgess, A.; Reid, G. Why Be One Protein When You Can Affect Many? The Multiple Roles of YB-1 in Lung Cancer and Mesothelioma. Front. Cell Dev. Biol. 2019, 7, 1–25. [Google Scholar]
- Rahat, B.; Sharma, R.; Bagga, R.; Hamid, A.; Kaur, J. Imbalance between matrix metalloproteinases and their tissue inhibitors in preeclampsia and gestational trophoblastic diseases. Reproduction 2016, 152, 11–22. [Google Scholar] [CrossRef]
- Siwetz, M.; Blaschitz, A.; El-Heliebi, A.; Hiden, U.; Desoye, G.; Huppertz, B.; Gauster, M. TNF-α alters the inflammatory secretion profile of human first trimester placenta. Lab. Investig. 2016, 96, 428–438. [Google Scholar] [CrossRef]
- Goyal, P.; Brünnert, D.; Ehrhardt, J.; Bredow, M.; Piccenini, S.; Zygmunt, M. Cytokine IL-6 secretion by trophoblasts regulated via sphingosine-1-phosphate receptor 2 involving Rho/Rho-kinase and Rac1 signaling pathways. Mol. Hum. Reprod. 2013, 19, 528–538. [Google Scholar] [CrossRef]
- Das, C.; Kumar, V.S.; Gupta, S.; Kumar, S. Network of cytokines, integrins and hormones in human trophoblast cells. J. Reprod. Immunol. 2002, 53, 257–268. [Google Scholar] [CrossRef]
- Bowen, J.M.; Chamley, L.; Keelan, J.A.; Mitchell, M.D. Cytokines of the placenta and extra-placental membranes: Roles and regulation during human pregnancy and parturition. Placenta 2002, 23, 257–273. [Google Scholar] [CrossRef] [PubMed]
- Zenclussen, A.C.; Kortebani, G.; Mazzolli, A.; Margni, R.; Malan Borel, I. Interleukin-6 and soluble interleukin-6 receptor serum levels in recurrent spontaneous abortion women immunized with paternal white cells. Am. J. Reprod. Immunol. 2000, 44, 22–29. [Google Scholar] [CrossRef] [PubMed]
- Sansone, P.; Storci, G.; Tavolari, S.; Guarnieri, T.; Giovannini, C.; Taffurelli, M.; Ceccarelli, C.; Santini, D.; Paterini, P.; Marcu, K.B.; et al. IL-6 triggers malignant features in mammospheres from human ductal breast carcinoma and normal mammary gland. J. Clin. Invest. 2007, 117, 3988–4002. [Google Scholar] [CrossRef] [PubMed]
- Martin, M.; Hua, L.; Wang, B.; Wei, H.; Prabhu, L.; Hartley, A.V.; Jiang, G.; Liu, Y.; Lu, T. Novel serine 176 phosphorylation of YBX1 activates NF-κB in colon cancer. J. Biol. Chem. 2017, 292, 3433–3444. [Google Scholar] [CrossRef] [PubMed]
- Shah, A.; Plaza-Sirvent, C.; Weinert, S.; Buchbinder, J.H.; Lavrik, I.N.; Mertens, P.R.; Schmitz, I.; Lindquist, J.A. YB-1 Mediates TNF-Induced Pro-Survival Signaling by Regulating NF-κB Activation. Cancers 2020, 12, 2188. [Google Scholar] [CrossRef]
- Kent, W.J.; Sugnet, C.W.; Furey, T.S.; Roskin, K.M.; Pringle, T.H.; Zahler, A.M.; Haussler, A.D. The Human Genome Browser at UCSC. Genome Res. 2002, 12, 996–1006. [Google Scholar] [CrossRef]
- Lenardo, M.J.; Baltimore, D. NF-κB: A pleiotropic mediator of inducible and tissue-specific gene control. Cell 1989, 58, 227–229. [Google Scholar] [CrossRef]
- Oh, S.-Y.; Hwang, J.R.; Choi, M.; Kim, Y.M.; Kim, J.S.; Suh, Y.L.; Choi, S.J.; Roh, C.R. Autophagy regulates trophoblast invasion by targeting NF-κB activity. Sci. Rep. 2020, 10, 1–10. [Google Scholar] [CrossRef]
- Armistead, B.; Kadam, L.; Drewlo, S.; Kohan-Ghadr, H.R. The role of NFκB in healthy and preeclamptic placenta: Trophoblasts in the spotlight. Int. J. Mol. Sci. 2020, 21, 1775. [Google Scholar] [CrossRef] [PubMed]
- Sakowicz, A. The role of NFκB in the three stages of pregnancy—Implantation, maintenance, and labour: A review article. BJOG 2018, 125, 1379–1387. [Google Scholar] [CrossRef]
- Cramer, M.; Nagy, I.; Murphy, B.J.; Gassmann, M.; Hottiger, M.O.; Georgiev, O.; Schaffner, W. NF-κB contributes to transcription of placenta growth factor and interacts with metal responsive transcription factor-1 in hypoxic human cells. Biol. Chem. 2005, 386, 865–872. [Google Scholar] [CrossRef] [PubMed]
Patient Characteristics | Induced Abortion (n = 20) | Spontaneous Abortion (n = 20) | |
---|---|---|---|
Maternal age (y) | 26.79 ± 5,52 | 29.85 ± 6.84 | |
Gestational week | 10.74 ± 1.50 | 9.69 ± 3.55* | |
Patient Characteristics | Control (n = 18) | IUGR (n = 12) | PE (n = 18) |
Maternal age (y) | 28.80 ± 5.25 | 28.00 ± 3.07 | 32.29 ± 8,18 |
Gestational week | 39.65 ± 1.58 | 32.25 ± 4.09 **** | 28.97 ± 3,01 **** |
Fetal weight (g) | 3518 ± 459.3 | 1897 ± 869.2 ** | 1017 ± 388,1 **** |
Fetal length (cm) | 52.13 ± 2.56 | 46.17 ± 6.24 | 42.50 ± 2.12 * |
Sex (% female) | 33.33 | 63.64 | 42.86 |
Mode of delivery (% SC) | 40 | 63.64 | 100 |
No. | Primer (Gene) Name | (Sequence 5‘-3‘) |
---|---|---|
1 | hYBX1 fw position 1 | GGGAAGCCTTTTCTTCACGG |
2 | hYBX1 rv position 1 | GAGTAGTCGGCCACGAAAAC |
3 | hYBX1 fw position 2 | GAAGCTAGGGATTGGGGTCA |
4 | hYBX1 rv position 2 | GCTACCGATCGAACTAGCGA |
5 | hNOTCH3 fw position 1 | CACAGAGGAAGTGGGTTGCT |
6 | hNOTCH3 rv position 1 | ATTTGCAGCCTCAGACCTCA |
7 | hNOTCH3 fw position 2 | ATGGGGAAACACGAGAGGTTG |
8 | hNOTCH3 rv position 2 | TTTGTCACTTGGGCCTGGGG |
9 | hNF-B1 (p50) fw position 1 | CCCCTCTGCCAGATCAGTATT |
10 | hNF-B1 (p50) rv position 1 | CGACTTGTGCCCAGTAAAGT |
11 | hNF-B1 (p50) fw position 2 | CTTCCTCATTCCTGCGCTAAC |
12 | hNF-B1 (p50) rv position 2 | GTAAGAGTTCCCCTCCGGTT |
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations. |
© 2021 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Stojanovska, V.; Shah, A.; Woidacki, K.; Fischer, F.; Bauer, M.; Lindquist, J.A.; Mertens, P.R.; Zenclussen, A.C. YB-1 Is Altered in Pregnancy-Associated Disorders and Affects Trophoblast in Vitro Properties via Alternation of Multiple Molecular Traits. Int. J. Mol. Sci. 2021, 22, 7226. https://doi.org/10.3390/ijms22137226
Stojanovska V, Shah A, Woidacki K, Fischer F, Bauer M, Lindquist JA, Mertens PR, Zenclussen AC. YB-1 Is Altered in Pregnancy-Associated Disorders and Affects Trophoblast in Vitro Properties via Alternation of Multiple Molecular Traits. International Journal of Molecular Sciences. 2021; 22(13):7226. https://doi.org/10.3390/ijms22137226
Chicago/Turabian StyleStojanovska, Violeta, Aneri Shah, Katja Woidacki, Florence Fischer, Mario Bauer, Jonathan A. Lindquist, Peter R. Mertens, and Ana C. Zenclussen. 2021. "YB-1 Is Altered in Pregnancy-Associated Disorders and Affects Trophoblast in Vitro Properties via Alternation of Multiple Molecular Traits" International Journal of Molecular Sciences 22, no. 13: 7226. https://doi.org/10.3390/ijms22137226
APA StyleStojanovska, V., Shah, A., Woidacki, K., Fischer, F., Bauer, M., Lindquist, J. A., Mertens, P. R., & Zenclussen, A. C. (2021). YB-1 Is Altered in Pregnancy-Associated Disorders and Affects Trophoblast in Vitro Properties via Alternation of Multiple Molecular Traits. International Journal of Molecular Sciences, 22(13), 7226. https://doi.org/10.3390/ijms22137226