Optimization of Lyophilized Hyperacute Serum (HAS) as a Regenerative Therapeutic in Osteoarthritis
Abstract
:1. Introduction
2. Results
2.1. Optimizing HAS Production Based on Chondrogenic Viability Effect
2.2. Gene Expression of Osteoarthritis-Related Genes after Blood Derivatives Supplementation
2.3. Protein Profiling after Treating the Inflamed Explant Co-Culture Model with HAS
3. Discussion
4. Materials and Methods
4.1. Primary Osteoarthritic (OA) Chondrocytes Isolation
4.2. Preparation of PRP
4.3. Preparation of Hyperacute Serum (HAS)
4.4. Viability Assay of 2D Chondrogenic Cultures
4.5. RNA Isolation and Quantitative Real-Time PCR (qRT-PCR)
4.6. Explant Co-Culture for the Inflammatory Model
4.7. Statistical Analysis
Supplementary Materials
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Zhang, Y.; Jordan, J.M. Epidemiology of osteoarthritis. Clin. Geriatr. Med. 2010, 26, 355–369. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Zhang, W.; Nuki, G.; Moskowitz, R.; Abramson, S.; Altman, R.; Arden, N.; Bierma-Zeinstra, S.; Brandt, K.; Croft, P.; Doherty, M.; et al. OARSI recommendations for the management of hip and knee osteoarthritis: Part III: Changes in evidence following systematic cumulative update of research published through January 2009. Osteoarthr. Cartil. 2010, 18, 476–499. [Google Scholar] [CrossRef] [Green Version]
- Bielecki, T.; Dohan Ehrenfest, D.M. Platelet-rich plasma (PRP) and platelet-rich fibrin (PRF): Surgical adjuvants, preparations for in situ regenerative medicine and tools for tissue engineering. Curr. Pharm. Biotechnol. 2012, 13, 1121–1130. [Google Scholar] [CrossRef] [PubMed]
- Kardos, D.; Simon, M.; Vácz, G.; Hinsenkamp, A.; Holczer, T.; Cseh, D.; Sárközi, A.; Szenthe, K.; Bánáti, F.; Szathmary, S.; et al. The composition of hyperacute serum and plate-let-rich plasma is markedly different despite the similar production method. Int. J. Mol. Sci. 2019, 20, 721. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Taniguchi, Y.; Yoshioka, T.; Kanamori, A.; Aoto, K.; Sugaya, H.; Yamazaki, M. Intra-articular platelet-rich plasma (PRP) injections for treating knee pain associated with osteoarthritis of the knee in the Japanese population: A phase I and IIa clinical trial. Nagoya J. Med. Sci. 2018, 80, 39–51. [Google Scholar] [CrossRef]
- Meheux, C.J.; McCulloch, P.; Lintner, D.M.; Varner, K.E.; Harris, J.D. Efficacy of intra-articular platelet-rich plasma injections in knee osteoarthritis: A systematic review. Arthrosc. J. Arthrosc. Relat. Surg. 2016, 32, 495–505. [Google Scholar] [CrossRef]
- Di Martino, A.; Di Matteo, B.; Papio, T.; Tentoni, F.; Selleri, F.; Cenacchi, A.; Kon, E.; Filardo, G. Platelet-rich plasma versus hyaluronic acid injections for the treatment of knee osteoarthritis: Results at 5 years of a double-blind, randomized controlled trial. Am. J. Sports Med. 2019, 47, 347–354. [Google Scholar] [CrossRef]
- Tuakli-Wosornu, Y.A.; Terry, A.; Boachie-Adjei, K.; Harrison, J.R.; Gribbin, C.K.; LaSalle, E.E.; Nguyen, J.T.; Solomon, J.L.; Lutz, G.E. Lumbar intradiskal platelet-rich plasma (PRP) injections: A prospective, double-blind, randomized controlled study. PMR 2016, 8, 1–10. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Andia, I.; Perez-Valle, A.; Del Amo, C.; Maffulli, N. Freeze-drying of platelet-rich plasma: The quest for standardization. Int. J. Mol. Sci. 2020, 21, 6904. [Google Scholar] [CrossRef] [PubMed]
- Dohan Ehrenfest, D.M.; Andia, I.; Zumstein, M.A.; Zhang, C.Q.; Pinto, N.R.; Bielecki, T. Classification of platelet concentrates (platelet-rich plasma-PRP, platelet-rich fibrin-PRF) for topical and infiltrative use in orthopedic and sports medicine: Current consensus, clinical implications and perspectives. Muscles Ligaments Tendons J. 2014, 4, 3–9. [Google Scholar] [CrossRef] [Green Version]
- Fernández-Barbero, J.E.; Galindo-Moreno, P.; Ávila-Ortiz, G.; Caba, O.; Sánchez-Fernández, E.; Wang, H.L. Flow cytometric and morphological characterization of platelet-rich plasma gel. Clin. Oral Implant. Res. 2006, 17, 687–693. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Jensen, T.; Kierulf, P.; Sandset, P.M.; Klingenberg, O.; Joø, G.B.; Godal, H.C.; Skjønsberg, O.H. Fibrinogen and fibrin induce synthesis of pro-inflammatory cytokines from isolated peripheral blood mononuclear cells. Thromb. Haemost. 2007, 97, 822–829. [Google Scholar] [PubMed]
- Zhou, Y.; Zhang, J.; Wu, H.; Hogan, M.V.; Wang, J.H.-C. The differential effects of leukocyte-containing and pure platelet-rich plasma (PRP) on tendon stem/progenitor cells—Implications of PRP application for the clinical treatment of tendon injuries. Stem Cell Res. Ther. 2015, 6, 1–13. [Google Scholar] [CrossRef] [Green Version]
- Vácz, G.; Major, B.; Gaál, D.; Petrik, L.; Horváthy, D.B.; Han, W.; Holczer, T.; Simon, M.; Muir, J.M.; Hornyák, I.; et al. Hyperacute serum has markedly better regenerative efficacy than platelet-rich plasma in a human bone oxygen–glucose deprivation model. Regen. Med. 2018, 13, 531–543. [Google Scholar] [CrossRef] [Green Version]
- Kuten, O.; Simon, M.; Hornyák, I.; De Luna-Preitschopf, A.; Nehrer, S.; Lacza, Z. The effects of hyperacute serum on adipo-genesis and cell proliferation of mesenchymal stromal cells. Tissue Eng. Part. A 2018, 24, 1011–1021. [Google Scholar] [CrossRef] [PubMed]
- Jeyakumar, V.; Niculescu-Morzsa, E.; Bauer, C.; Lacza, Z.; Nehrer, S. Platelet-rich plasma supports proliferation and rediffer-entiation of chondrocytes during in vitro expansion. Front. Bioeng. Biotechnol. 2017, 5, 1–8. [Google Scholar] [CrossRef]
- Simon, M.; Major, B.; Vácz, G.; Kuten, O.; Hornyak, I.; Hinsenkamp, A.; Kardos, D.; Bagó, M.; Cseh, D.; Sarkozi, A.; et al. The effects of hyperacute serum on the elements of the human subchondral bone marrow niche. Stem Cells Int. 2018, 2018, 1–12. [Google Scholar] [CrossRef]
- Neubauer, M.; Kuten, O.; Stotter, C.; Kramer, K.; De Luna, A.; Muellner, T.; Lacza, Z.; Nehrer, S. The effect of blood-derived products on the chondrogenic and osteogenic differentiation potential of adipose-derived mesenchymal stem cells originated from three different locations. Stem Cells Int. 2019, 2019, 1–20. [Google Scholar] [CrossRef]
- Kardos, D.; Marschall, B.; Simon, M.; Hornyák, I.; Hinsenkamp, A.; Kuten, O.; Gyevnár, Z.; Erdélyi, G.; Bárdos, T.; Paukovits, T.M.; et al. Investigation of cytokine changes in osteo-arthritic knee joint tissues in response to hyperacute serum treatment. Cells 2019, 8, 824. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Johnson, C.I.; Argyle, D.J.; Clements, D.N. In vitro models for the study of osteoarthritis. Veter. J. 2016, 209, 40–49. [Google Scholar] [CrossRef] [Green Version]
- Man, G.S.; Mologhianu, G. Osteoarthritis pathogenesis—A complex process that involves the entire joint. J. Med. Life 2014, 7, 37–41. [Google Scholar]
- Otero, M. In vitro OA models to study chondrocytes and cartilage. Osteoarthr. Cartil. 2018, 26, S4–S5. [Google Scholar] [CrossRef] [Green Version]
- Jayadev, C.; Snelling, S.; Price, A.J.; Hulley, P.A. Multiplex analysis of osteoarthritic synovial fluid: A comparison of Luminex & Mesoscale discovery. Osteoarthr. Cartil. 2013, 21, S73. [Google Scholar] [CrossRef] [Green Version]
- Mabey, T.; Honsawek, S. Cytokines as biochemical markers for knee osteoarthritis. World J. Orthop. 2015, 6, 95–105. [Google Scholar] [CrossRef] [PubMed]
- Daghestani, H.; Kraus, V. Inflammatory biomarkers in osteoarthritis. Osteoarthr. Cartil. 2015, 23, 1890–1896. [Google Scholar] [CrossRef] [Green Version]
- Wojdasiewicz, P.; Poniatowski, Ł.A.; Szukiewicz, D. The role of inflammatory and anti-inflammatory cytokines in the path-ogenesis of osteoarthritis. Mediat. Inflamm. 2014, 2014, 1–19. [Google Scholar] [CrossRef] [Green Version]
- Maldonado, M.; Nam, J. The role of changes in extracellular matrix of cartilage in the presence of inflammation on the pathology of osteoarthritis. BioMed Res. Int. 2013, 2013, 284873. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Baheti, A.; Kumar, L.; Bansal, A.K. Excipients used in lyophilization of small molecules. J. Excip. Food Chem. 2010, 1, 41–54. [Google Scholar]
- Butreddy, A.; Dudhipala, N.; Janga, K.Y.; Gaddam, R.P. Lyophilization of small-molecule injectables: An industry perspective on formulation development, process optimization, scale-up challenges, and drug product quality attributes. AAPS PharmSciTech 2020, 21, 251–271. [Google Scholar] [CrossRef]
- Goa, K.L.; Benfield, P. Hyaluronic acid: A review of its pharmacology and use as a surgical aid in ophthalmology, and its therapeutic potential in joint disease and wound healing. Drugs 1994, 47, 536–566. [Google Scholar] [CrossRef]
- Raeissadat, S.A.; Rayegani, S.M.; Hassanabadi, H.; Fathi, M.; Ghorbani, E.; Babaee, M.; Azma, K. Knee osteoarthritis injection choices: Platelet- rich plasma (PRP) versus hyaluronic acid (a one-year randomized clinical trial). Clin. Med. Insights Arthritis Musculoskelet. Disord. 2015, 8, 1–8. [Google Scholar] [CrossRef]
- Andía, I.; Abate, M. Knee osteoarthritis: Hyaluronic acid, platelet-rich plasma or both in association? Expert Opin. Biol. Ther. 2014, 14, 635–649. [Google Scholar] [CrossRef]
- Hayes, A.J.; Melrose, J. Glycosaminoglycan and proteoglycan biotherapeutics in articular cartilage protection and repair strategies: Novel approaches to visco-supplementation in orthobiologics. Adv. Ther. 2019, 2, 1900034. [Google Scholar] [CrossRef]
- Chen, X.; Sadineni, V.; Maity, M.; Quan, Y.; Enterline, M.; Mantri, R.V. Finite Element Method (FEM) modeling of freeze-drying: Monitoring pharmaceutical product robustness during lyophilization. AAPS PharmSciTech 2015, 16, 1317–1326. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Wolkers, W.F.; Oldenhof, H. Cryopreservation and Freeze-Drying Protocols; Springer: New York, NY, USA, 2021. [Google Scholar]
- Kasper, J.C.; Friess, W. The freezing step in lyophilization: Physico-chemical fundamentals, freezing methods and consequences on process performance and quality attributes of biopharmaceuticals. Eur. J. Pharm. Biopharm. 2011, 78, 248–263. [Google Scholar] [CrossRef]
- Fissore, D.; Pisano, R.; Barresi, A.A. Process analytical technology for monitoring pharmaceuticals freeze-drying—A comprehensive review. Dry. Technol. 2018, 36, 1839–1865. [Google Scholar] [CrossRef]
- Akeda, K.; An, H.; Okuma, M.; Attawia, M.; Miyamoto, K.; Thonar, E.-M.; Lenz, M.; Sah, R.; Masuda, K. Platelet-rich plasma stimulates porcine articular chondrocyte proliferation and matrix biosynthesis. Osteoarthr. Cartil. 2006, 14, 1272–1280. [Google Scholar] [CrossRef] [Green Version]
- Spreafico, A.; Chellini, F.; Frediani, B.; Bernardini, G.; Niccolini, S.; Serchi, T.; Collodel, G.; Paffetti, A.; Fossombroni, V.; Galeazzi, M.; et al. Biochemical investigation of the effects of human platelet releasates on human articular chondrocytes. J. Cell. Biochem. 2009, 108, 1153–1165. [Google Scholar] [CrossRef]
- Drengk, A.; Zapf, A.; Stürmer, E.K.; Stürmer, K.M.; Frosch, K.-H. Influence of platelet-rich plasma on chondrogenic differentiation and proliferation of chondrocytes and mesenchymal stem cells. Cells Tissues Organs 2009, 189, 317–326. [Google Scholar] [CrossRef]
- Russo, F.; D’Este, M.; Vadalà, G.; Cattani, C.; Papalia, R.; Alini, M.; Denaro, V. Platelet rich plasma and hyaluronic acid blend for the treatment of osteoarthritis: Rheological and biological evaluation. PLoS ONE 2016, 11, e0157048. [Google Scholar] [CrossRef] [Green Version]
- Chen, W.-H.; Lo, W.-C.; Hsu, W.-C.; Wei, H.-J.; Liu, H.-Y.; Lee, C.-H.; Chen, S.-Y.T.; Shieh, Y.-H.; Williams, D.F.; Deng, W.-P. Synergistic anabolic actions of hyaluronic acid and platelet-rich plasma on cartilage regeneration in osteoarthritis therapy. Biomaterials 2014, 35, 9599–9607. [Google Scholar] [CrossRef]
- Smyth, N.A.; Ross, K.; Haleem, A.M.; Hannon, C.P.; Murawski, C.D.; Do, H.T.; Kennedy, J.G. Platelet-rich plasma and hyaluronic acid are not synergistic when used as biological adjuncts with autologous osteochondral transplantation. Cartilage 2016, 9, 321–328. [Google Scholar] [CrossRef]
- Melrose, J. The Importance of the knee joint meniscal fibrocartilages as stabilizing weight bearing structures providing global protection to human knee-joint tissues. Cells 2019, 8, 324. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Melrose, J.; Fuller, E.S.; Little, C.B. The biology of meniscal pathology in osteoarthritis and its contribution to joint disease: Beyond simple mechanics. Connect. Tissue Res. 2017, 58, 282–294. [Google Scholar] [CrossRef]
- Chabane, N.; Zayed, N.; Afif, H.; Mfuna-Endam, L.; Benderdour, M.; Boileau, C.; Martel-Pelletier, J.; Duval, N.; Fahmi, H. Histone deacetylase inhibitors suppress interleukin-1β-induced nitric oxide and prostaglandin E2 production in human chondrocytes. Osteoarthr. Cartil. 2008, 16, 1267–1274. [Google Scholar] [CrossRef] [Green Version]
- Ying, X.; Chen, X.; Cheng, S.; Shen, Y.; Peng, L.; Xu, H.Z. Piperine inhibits IL-β induced expression of inflammatory mediators in human osteoarthritis chondrocyte. Int. Immunopharmacol. 2013, 17, 293–299. [Google Scholar] [CrossRef] [PubMed]
- Kobayashi, M.; Squires, G.R.; Mousa, A.; Tanzer, M.; Zukor, D.J.; Antoniou, J.; Feige, U.; Poole, A.R. Role of interleukin-1 and tumor necrosis factor α in matrix degradation of human osteoarthritic cartilage. Arthritis Rheum. 2005, 52, 128–135. [Google Scholar] [CrossRef] [PubMed]
- Thomas Vangsness, J.; Burke, W.S.; Narvy, S.J.; MacPhee, R.D.; Fedenko, A.N. Human knee synovial fluid cytokines correlated with grade of knee osteoarthritis: A pilot study. Bull. NYU Hosp. Jt. Dis. 2011, 69, 122–127. [Google Scholar]
- Vernal, R.; Velásquez, E.; Gamonal, J.; Garcia-Sanz, J.A.; Silva, A.; Sanz, M. Expression of proinflammatory cytokines in osteo-arthritis of the temporomandibular joint. Arch. Oral Biol. 2008, 53, 910–915. [Google Scholar] [CrossRef] [Green Version]
- Miller, R.E.; Miller, R.J.; Malfait, A.-M. Osteoarthritis joint pain: The cytokine connection. Cytokine 2014, 70, 185–193. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Lee, K.-C.; Prasad, V.; Achuthan, A.; Fleetwood, A.; Hamilton, J.; Cook, A. Targeting GM-CSF for collagenase-induced osteoarthritis pain and disease in mice. Osteoarthr. Cartil. 2020, 28, 486–491. [Google Scholar] [CrossRef] [PubMed]
- Bykerk, V.P. The efficacy and safety of targeting GM-CSF in arthritis. Lancet Rheumatol. 2020, 2, e648–e650. [Google Scholar] [CrossRef]
- Chen, Z.; Ma, Y.; Li, X.; Deng, Z.; Zheng, M.; Zheng, Q. The immune cell landscape in different anatomical structures of knee in osteoarthritis: A gene expression-based study. BioMed Res. Int. 2020, 2020, 9647072. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Armah, H.B.; Wilson, N.O.; Sarfo, B.Y.; Powell, M.D.; Bond, V.C.; Anderson, W.; Adjei, A.A.; Gyasi, R.K.; Tettey, Y.; Wiredu, E.K.; et al. Cerebrospinal fluid and serum biomarkers of cerebral malaria mortality in Ghanaian children. Malar. J. 2007, 6, 147. [Google Scholar] [CrossRef] [Green Version]
- de-Oliveira-Pinto, L.M.; Gandini, M.; Freitas, L.P.; Siqueira, M.M.; Marinho, C.F.; Setúbal, S.; Kubelka, C.F.; Cruz, O.G.; de Oliviera, S.A. Profile of circulating levels of IL-1Ra, CXCL10/IP-10, CCL4/MIP-1β and CCL2/MCP-1 in dengue fever and parvovirosis. Mem Inst. Oswaldo Cruz. 2012, 107, 48–56. [Google Scholar] [CrossRef] [Green Version]
- Ren, G.; Lutz, I.; Railton, P.; Wiley, J.P.; McAllister, J.; Powell, J.; Krawetz, R.J.; Railton, P.; Wiley, J.P.; McAllister, P.; et al. Serum and synovial fluid cytokine profiling in hip osteo-arthritis: Distinct from knee osteoarthritis and correlated with pain. BMC Musculoskelet Disord. 2018, 19, 1–11. [Google Scholar] [CrossRef] [Green Version]
- Nees, T.A.; Rosshirt, N.; Zhang, J.A.; Reiner, T.; Sorbi, R.; Tripel, E.; Walker, T.; Schiltenwolf, M.; Hagmann, S.; Moradi, B. Synovial cytokines significantly correlate with osteoar-thritis-related knee pain and disability: Inflammatory mediators of potential clinical relevance. J. Clin. Med. 2019, 8, 1343. [Google Scholar] [CrossRef] [PubMed] [Green Version]
HA | ||||||
---|---|---|---|---|---|---|
− | + | − | + | − | + | |
FCS | 1.5722 | 2.1943 | 1.9111 | 1.6714 | 4.1204 | 3.8288 |
Filtered lyophilized HAS | 1.8737 | 1.8371 | 1.9618 | 1.0740 | 3.2265 | 3.8791 |
Non-filtered lyo. HAS | 2.9374 | 3.3930 | 3.2409 | 3.3741 | 5.8379 | 7.0123 |
Day 3 | Day 5 | Day 7 |
FCS | Filtered Lyophilized | Non-Filtered Lyophilized | |||||
---|---|---|---|---|---|---|---|
Genes | − | + | − | + | − | + | HA |
Col1a1 | 1.43(±0.82) | 1.76(±0.60) | 1.55(±1.14) | 2.27(±1.21) | 2.32(±0.86) | 2.45(±0.74) | |
Col2a1 | 0.17(±0.12) | 0.25(±0.12) | 0.15(±0.09) | 0.13(±0.12) | 0.11(±0.12) | 0.12(±0.09) | |
Acan | 2.61(±0.86) | 2.70(±0.65) | 1.94(±0.76) | 2.63(±0.77) | 3.77(±2.41) | 4.67(±1.98) | |
Mmp-3 | 0.16(±0.14) | 0.28(±0.26) | 0.25(±0.25) | 0.33(±0.37) | 0.34(±0.47) | 0.31(±0.32) | |
Mmp-13 | 1.91(±1.59) | 1.68(±1.69) | 4.44(±5.67) | 3.62(±4.31) | 6.72(±8.82) | 8.85(±13.76) | |
Prg4 | 0.30(±0.19) | 0.30(±0.23) | 0.50(±0.37) | 0.49(±0.44) | 0.62(±0.62) | 0.38(±0.32) | |
Sox9 | 0.43(±0.10) | 0.38(±0.08) | 0.23(±0.04) | 0.26(±0.05) | 0.22(±0.14) | 0.17(±0.07) |
Treatment Conditions | Genes |
---|---|
+HAS/+HA/+HAS and +HA | MIP-1α, VEGF, IFNγ, IL-8, IL-1β |
+HA | IL-2, IL-7, IL-13, IL-12 |
+HAS | BFGF |
+HAS and +HA | IL-2, IL-7, IP-10, IL-12, IL-13, MIP-1β |
Gene | Forward Primer | Reverse Primer | Probe |
---|---|---|---|
Gapdh | ATGTTCCAGTATGATTCCACCC | ATACTCAGCACCAGCATCAC | AGCTTCCCGTTCTCTGCCTTGAC |
Acan | ACCTACGATGTCTACTGCTACG | AGAGTGGCGTTTTGGGATTC | AGAAGGTGAACTGCTCCAGGCG |
Col2a1 | GTGCAACTGGTCCTCTGG | ACCTCTTTTCCCTTCTTCACC | CCTTGTTCGCCTTTGAAGCCAGC |
Col1a1 | CCCCTGGAAAGAATGGAGATG | TCCAAACCACTGAAACCTCTG | TTCCGGGCAATCCTCGAGCA |
Sox9 | ACTTGCACAACGCCGAG | CTGGTACTTGTAATCCGGGTG | TCTGGAGACTTCTGAACGAGAGCGA |
Mmp-3 | CCAGGGATTAATGGAGATGCC | AGTGTTGGCTGAGTGAAAGAG | ACAATGGACAAAGGATACAACAGGGACC |
Mmp-13 | CTAAACATCCCAAAACGCCAG | ACAGCTCTGCTTCAACCTG | CCCTTGATGCCATAACCAGTCTCCG |
Prg4 | AGAACTGGCCTGAATCTGTG | ACCTGTGTCGTTTCTCCATAC | TCAAGAGAGGTGGCAGCATTCAGC |
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations. |
© 2021 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Olmos Calvo, I.; Kuten-Pella, O.; Kramer, K.; Madár, Á.; Takács, S.; Kardos, D.; Simon, D.; Erdö-Bonyár, S.; Berki, T.; De Luna, A.; et al. Optimization of Lyophilized Hyperacute Serum (HAS) as a Regenerative Therapeutic in Osteoarthritis. Int. J. Mol. Sci. 2021, 22, 7496. https://doi.org/10.3390/ijms22147496
Olmos Calvo I, Kuten-Pella O, Kramer K, Madár Á, Takács S, Kardos D, Simon D, Erdö-Bonyár S, Berki T, De Luna A, et al. Optimization of Lyophilized Hyperacute Serum (HAS) as a Regenerative Therapeutic in Osteoarthritis. International Journal of Molecular Sciences. 2021; 22(14):7496. https://doi.org/10.3390/ijms22147496
Chicago/Turabian StyleOlmos Calvo, Isabel, Olga Kuten-Pella, Karina Kramer, Ágnes Madár, Szilvia Takács, Dorottya Kardos, Diána Simon, Szabina Erdö-Bonyár, Timea Berki, Andrea De Luna, and et al. 2021. "Optimization of Lyophilized Hyperacute Serum (HAS) as a Regenerative Therapeutic in Osteoarthritis" International Journal of Molecular Sciences 22, no. 14: 7496. https://doi.org/10.3390/ijms22147496