Next Article in Journal
The Carboxyl-Terminus of TRANSPARENT TESTA GLABRA1 Is Critical for Its Functions in Arabidopsis
Previous Article in Journal
Gephyrin-Lacking PV Synapses on Neocortical Pyramidal Neurons
 
 
Font Type:
Arial Georgia Verdana
Font Size:
Aa Aa Aa
Line Spacing:
Column Width:
Background:
Article

Hesperetin Inhibits Expression of Virulence Factors and Growth of Helicobacter pylori

1
Department of Biomedical Laboratory Science, College of Health Sciences, Yonsei University, Wonju 26493, Korea
2
Department of Clinical Laboratory Science, Semyung University, Jecheon 27136, Korea
3
Division of Crop Foundation, National Institute of Crop Science (NICS), Rural Development Administration (RDA), Wanju 55365, Korea
*
Author to whom correspondence should be addressed.
These authors contributed equally.
Int. J. Mol. Sci. 2021, 22(18), 10035; https://doi.org/10.3390/ijms221810035
Submission received: 18 August 2021 / Revised: 9 September 2021 / Accepted: 13 September 2021 / Published: 17 September 2021
(This article belongs to the Section Bioactives and Nutraceuticals)

Abstract

:
Helicobacter pylori (H. pylori) is a bacterium known to infect the human stomach. It can cause various gastrointestinal diseases including gastritis and gastric cancer. Hesperetin is a major flavanone component contained in citrus fruits. It has been reported to possess antibacterial, antioxidant, and anticancer effects. However, the antibacterial mechanism of hesperetin against H. pylori has not been reported yet. Therefore, the objective of this study was to determine the inhibitory effects of hesperetin on H. pylori growth and its inhibitory mechanisms. The results of this study showed that hesperetin inhibits the growth of H. pylori reference strains and clinical isolates. Hesperetin inhibits the expression of genes in replication (dnaE, dnaN, dnaQ, and holB) and transcription (rpoA, rpoB, rpoD, and rpoN) machineries of H. pylori. Hesperetin also inhibits the expression of genes related to H. pylori motility (flhA, flaA, and flgE) and adhesion (sabA, alpA, alpB, hpaA, and hopZ). It also inhibits the expression of urease. Hespereti n downregulates major virulence factors such as cytotoxin-associated antigen A (CagA) and vacuolating cytotoxin A (VacA) and decreases the translocation of CagA and VacA proteins into gastric adenocarcinoma (AGS) cells. These results might be due to decreased expression of the type IV secretion system (T4SS) and type V secretion system (T5SS) involved in translocation of CagA and VacA, respectively. The results of this study indicate that hesperetin has antibacterial effects against H. pylori. Thus, hesperetin might be an effective natural product for the eradication of H. pylori.

1. Introduction

Helicobacter pylori (H. pylori) is a Gram-negative, curved bacterium. It is well known as an important human pathogen. H. pylori causes various gastrointestinal diseases such as gastritis, chronic gastritis, peptic ulcer, mucosa-associated lymphoid tissue (MALT) lymphoma, and gastric adenocarcinoma [1]. The prevalence of H. pylori varies widely depending on age, ethnicity, socioeconomic status, dietary habits such as food, alcohol consumption, and smoking status [2]. In particular, East Asian countries are at high risk of gastric cancer due to the high rates of H. pylori infection [3]. Therefore, a concerted effort for the eradication of H. pylori infection is necessary for health promotion worldwide.
DNA replication and transcription are vitally important processes for the survival and propagation of all living organisms including H. pylori. DnaA and DnaB form the complex of DNA-unwinding helicase [4,5]. DnaG primase can synthesize primers [6]. DNA polymerase III consists of core polymerases (DnaE, DnaQ, and HolE), sliding clamp (DnaN), and multiprotein clamp-loader (DnaX, HolA, HolB, HolC, and HolD), all of which are necessary for an organism to function properly [7,8]. Bacterial RNA polymerase consists of four subunits: α, β, β’, and ω subunits (α2ββ’ω) [9]. The rpoA and rpoB genes encode α and β subunits, respectively. Both rpoN and rpoD genes encode the σ factor.
The motility of H. pylori plays an important role in the movement of H. pylori toward the gastric epithelium for successful colonization [10,11]. H. pylori has lophotrichous flagella. FlaA and FlaB are flagellin proteins that comprise the filament structure of flagella [12,13]. FlgE is a hook protein that connects the flagellar filament to the export domain of the basal body [14]. FlhA is involved in the expression regulation and export of flagellin proteins [15].
The adhesion of H. pylori is an important step in establishing a successful infection by protecting H. pylori from clearance mechanisms such as gastric peristalsis and mucus flow. BabA (HopS) is a major adhesin and SabA (HopP) is the second most known adhesin of H. pylori [16,17]. OipA (HopH) promotes IL-8 secretion and causes inflammation [18]. AlpA (HopC) and AlpB (HopB) are adherence-associated lipoproteins and HpaA is a surface-located lipoprotein [19,20,21,22]. HopZ is involved in colonization [23,24].
One of the most studied virulence factors of H. pylori is cytotoxin-associated gene A (CagA). After it is injected into host cells, it can affect cell shape and proliferation [25]. CagA is injected directly into host cells through type IV secretion system (T4SS) encoded in cagPAI [26]. The T4SS consists of 12 subunits, including 11 VirB proteins (VirB1–VirB11) and VirD4 protein [27,28,29].
Vacuolating cytotoxin A (VacA) is another well-studied virulence factor of H. pylori. It is a toxin secreted by type Va secretion system (T5aSS). It is known to induce cytoplasmic vacuole formation [30]. The secretion system subunit protein A (SecA) is an especially important regulatory protein because it is an ATPase that provides energy for the translocation of VacA to the cell membrane [31].
Hesperetin is a natural flavanone. An aglycone of hesperidin has been found in citrus fruits such as lemon, lime, and orange. The chemical structure of hesperetin is shown in Figure 1A. Hesperetin has been reported to show various beneficial effects, including antioxidant, anti-inflammatory, and chemopreventive effects and anti-carcinogenic properties [32,33]. There are also several studies that have reported the antibacterial effect of hesperetin against various bacteria including Escherichia coli, Salmonella enterica, and Pseudomonas putida [34,35]. Lee et al. [36] have reported that plant flavonoids including hesperetin possess inhibitory effects on H. pylori. However, the mechanism by which hesperetin inhibits H. pylori has not been elucidated yet. There are many studies reporting on flavonoids and their anti-virulence potential against H. pylori [37,38,39]. Therefore, the objective of this study was to determine the inhibitory effect of hesperetin on H. pylori growth and its inhibitory mechanism. The results of this study suggest that hesperetin is an effective natural product for the eradication of H. pylori.

2. Results

2.1. Inhibitory Effect of Hesperetin on the Growth of H. pylori by Downregulating Replication and Transcription Genes

The agar dilution test was performed to determine the minimum inhibitory concentration (MIC) of hesperetin against H. pylori. Mueller–Hinton agar plates containing 10% bovine serum and various concentrations (0, 6.25, 12.5, 25, 50 and 100 μM) of hesperetin were prepared. Five H. pylori reference strains (ATCC 49503, ATCC 43504, ATCC 700392, ATCC 51932, and SS1) were grown on agar plates for 72 h. According to the agar dilution test, MICs of hesperetin against ATCC 43504, ATCC 51932, and SS1 strains were 50 μM while those against ATCC 49503 and ATCC 700392 strains were 100 μM (Figure 1B). To confirm that hesperetin could inhibit the growth of H. pylori clinical isolates as well as reference strains, 46 clinical isolates of H. pylori were collected from gastric biopsies and MICs of hesperetin against the isolates were determined with the agar dilution test. Results showed that the MIC of hesperetin was 6.25 μM against 8.7% (4/46), 12.5 μM against 6.5% (3/46), 25 μM against 6.5% (3/46), 50 μM against 69.6% (32/46), and 100 μM against 8.7% (4/46) of these clinical isolates (Table 1). Because H. pylori strains were grown in the broth for subsequent experiments, the MIC of hesperetin was also determined by the broth dilution test. Among five H. pylori reference strains, ATCC 49503, which is known as the most virulent CagA(+)/VacA(+) strain, was used in these experiments. As a result of the broth dilution test, the growth of H. pylori was significantly inhibited by hesperetin at a concentration above 100 μM (Figure 1C). These results confirm that hesperetin has an antibacterial effect on H. pylori. Particularly, these results showed that hesperetin not only possesses antibacterial effects on H. pylori strains but also exerts reference-similar antibacterial effects on the clinical isolates of H. pylori.
The expression levels of genes in replication and transcription machineries of H. pylori were evaluated to determine the mechanism by which hesperetin could inhibit the growth of H. pylori. H. pylori was treated with a sub-MIC concentration of hesperetin (0, 6.25, 12.5, 25, or 50 μM) for 72 h in Mueller–Hinton broth containing 10% bovine serum. RNA was extracted and RT-PCR was performed for various genes related to replication (dnaA, dnaB, dnaE, dnaN, dnaQ, polA, and holB) and transcription (rpoA, rpoB, rpoD, and rpoN). Results showed that mRNA expression levels of dnaE, dnaN, dnaQ, and holB among replication genes of H. pylori were decreased in H. pylori treated with hesperetin (Figure 2A,C). Furthermore, hesperetin reduced the expression levels of rpoA, rpoB, rpoD, and rpoN genes related to the transcription of H. pylori (Figure 2B,C). These results suggest that the inhibitory mechanism of H. pylori growth by hesperetin is partially suppressed by the downregulation of replication and transcription genes essential for the growth of H. pylori.

2.2. Downregulation of Urease, Motility, and Adhesion of H. pylori Treated with Hesperetin

Various virulence factors are necessary for H. pylori to survive and colonize in the gastric mucosa. The urease of H. pylori is essential for its survival in an environment with a strong acidity [40,41]. Therefore, mRNA and protein expression levels of urease α and β subunits of H. pylori treated with hesperetin were measured by RT-PCR and Western blot, respectively. Expression levels of both UreA and UreB were decreased in H. pylori treated with hesperetin (Figure 3A–C).
To ensure that the effect of decreased expression of UreA and UreB on the urease activity of H. pylori, the amount of ammonia produced by urease activity was measured. H. pylori was treated with hesperetin at each concentration (0, 6.25, 12.5, 25, and 50 μM) and cultured. After urea was added, the amount of ammonia produced was measured. As a result, it was confirmed that ammonia production of H. pylori was remarkably reduced by hesperetin (Figure 3D). Based on this result, the ammonia production of H. pylori, which can be seen as a result of urease activity, is thought to be due to the reduction of UreA and UreB expression in H. pylori by hesperetin.
H. pylori moves to the gastric epithelium and attaches to epithelial cells. Such attachment is necessary for successful infection. H. pylori moves through flagella movements [42]. Therefore, in this experiment, expression levels of genes constituting the flagella (flhA, flaA, flaB, and flgE) of H. pylori treated with hesperetin were determined by RT-PCR. Expression levels of flhA, flaA, and flgE were decreased by hesperetin treatment (Figure 4A,B). To confirm the effect of the reduction of flhA, flaA, and flgE gene expression on the motility of H. pylori, a motility test was performed. The motility medium contained 0.4% agar and hesperetin at different concentrations (0, 6.25, 12.5, 25, and 50 μM). After incubating H. pylori for 5 days, it was observed that H. pylori grew widely. Its diameter was measured. In this experiment, as the hesperetin concentration increased compared to the control medium, H. pylori did not grow widely and its diameter decreased (Figure 4C,D). These results suggest that hesperetin can inhibit the motility of H. pylori by reducing the expression of flhA, flaA, and flgE genes in H. pylori.
The expression of genes related to adhesion closely associated with infection of H. pylori was investigated by RT-PCR. Results showed that expression levels of sabA, alpA, alpB, hpaA, and hopZ genes of H. pylori were all decreased by hesperetin treatment (Figure 5A,B). To determine whether the expression of sabA, alpA, alpB, hpaA, and hopZ genes was involved in cell binding of H. pylori, an adhesion assay was performed. H. pylori was incubated in a medium including the indicated concentration of hesperetin. H. pylori at 100 MOI was then mixed with AGS cells. After reaction for 30 min in a shaking incubator, cell adhesion of H. pylori was measured using a flow cytometer. Results showed that AGS cells infected with H. pylori had higher side scatter, meaning that the complexity of these cells was higher than that of normal AGS cells because H. pylori adhered to AGS cells. For AGS cells infected with H. pylori treated with hesperetin, it was observed that as the concentration of hesperetin increased, side scatters were similar to those of normal AGS cells (Figure 5C). This suggested that the reduction of H. pylori cell adhesion was due to the inhibition of sabA, alpA, alpB, hpaA, and hopZ gene expression in H. pylori treated with hesperetin.
In summary, these data indicate that hesperetin may interfere with the survival and colonization of H. pylori by reducing the expression and activity of urease, motility, and adhesion of H. pylori.

2.3. Hesperetin Reduces CagA and VacA Translocation to AGS Cells

CagA and VacA proteins are representative proteins secreted by H. pylori. They can destroy gastric epithelial cells and cause gastrointestinal diseases. When CagA protein is injected into the host cell through the type IV secretion system, rearrangement of the actin cytoskeleton will occur, leading to a changed shape of the host cell. Especially, this change of cell morphology induced by CagA is called a hummingbird phenotype [43]. VacA proteins secreted by type Va secretion system can cause the vacuolation and accumulation of many vesicles inside the host cells [44]. Thus, we investigated whether hesperetin could change cell morphology by CagA and VacA proteins and affect the translocation of both proteins into host cells.
AGS cells were co-cultured with 100 MOI of H. pylori, which was exposed to hesperetin at each concentration (0, 6.25, 12.5, 25 and 50 μM) that did not affect cell viability (Figure 6A). After 6 h, the morphological changes of AGS cells induced by H. pylori infection were observed under a microscope. Compared to uninfected AGS cells, H. pylori-infected AGS cells showed a hummingbird phenotype and vacuolation by CagA and VacA proteins. These morphological changes of AGS cells were relieved by hesperetin treatment in a dose-dependent manner (data not shown). It was assumed that the translocation of CagA and VacA proteins to AGS cells might have decreased by hesperetin treatment. AGS cells infected with H. pylori exposed to hesperetin were harvested and Western blot was performed to investigate the amount of translocation of CagA and VacA proteins into AGS cells. Both CagA and VacA proteins were detected in H. pylori-infected AGS cells. As expected, the amounts of both proteins were decreased by hesperetin treatment (Figure 6B). In particular, CagA protein was dramatically decreased by hesperetin treatment. These results indicate that hesperetin can reduce the translocation of CagA and VacA proteins into AGS cells and inhibit morphological changes such as hummingbird phenotype and vacuolation caused by H. pylori infection.
To discover why the amounts of CagA and VacA proteins were decreased in H. pylori-infected AGS cells, the expression levels of CagA and VacA and the secretion system secreting each protein in H. pylori treated with hesperetin were measured by RT-PCR and Western blot. Hesperetin reduced mRNA and protein expression levels of CagA and VacA in H. pylori (Figure 6C–E). Moreover, mRNA expression levels of the components of T4SS for injecting CagA protein into AGS cells were examined using RT-PCR. Results showed that mRNA expression levels of virB2, virB4, virB5, virB6, virB7, virB8, virB9, and virD4 were decreased by hesperetin treatment (Figure 6D,E). Both mRNA and protein expression levels of SecA, a regulator of T5aSS in H. pylori, were also decreased by hesperetin treatment (Figure 6C–E).
In summary, these data indicated that hesperetin could inhibit the expression of CagA in H. pylori and downregulate the T4SS components required for injecting CagA into AGS cells. Hesperetin could also reduce VacA expression and SecA essential for VacA secretion. As hesperetin inhibited the translocation of CagA and VacA proteins, it mitigated the morphological changes of AGS cells induced by H. pylori infection.

3. Discussion

It is known that H. pylori infection is one of the crucial risk factors for gastric cancer. It accounts for 85% of all gastric cancers [45,46]. However, increased prevalence of resistance to antibiotics including clarithromycin used for the treatment of H. pylori limits the use of antibiotics as the first-line therapy for H. pylori [47]. Therefore, there is a need to develop new therapeutic agents or therapeutic supplements that help eradicate H. pylori. Several reports have shown that hesperetin has antibacterial effects on various Gram-positive and Gram-negative bacteria [34,35].
MICs of hesperetin for H. pylori reference strains were 50 μM (15.11 μg/mL) and 100 μM (30.23 μg/mL) with the agar dilution method (Figure 1B) and 6.25 μM (1.89 μg/mL) with the liquid dilution method (Figure 1C). In the agar dilution test, the drug was spread to the surface to check bacteria growth. In the broth dilution test, the drug could directly affect the bacteria. Therefore, the MIC with the broth dilution test could be lower than that with the agar dilution test. It has been reported that various flavonoids such as naringenin, quercetin, apigenin, and luteolin could inhibit the growth of H. pylori and that the MICs of these substances against H. pylori range from 5 to 20 mM [48]. Based on this result, the anti-H. pylori activity of hesperetin is more effective than that of the other plant flavonoids reported previously. In addition, the growth of about 20% of H. pylori isolated from patients was inhibited by hesperetin at a lower concentration than that for reference strains and about 70% showed the same MICs as the reference strain (Table 2).
During the inhibition of H. pylori growth, hesperetin inhibited the expression of the dnaE, dnaN, dnaQ, and holB genes involved in replication, a process essential for H. pylori survival (Figure 2A,C). Because dnaE and dnaQ are core components of DNA polymerase III, they play an important role in bacterial replication. The dnaE encodes the α-catalytic subunit of DNA polymerase III holoenzyme. In Bacillus subtilis, the polymerase activity of dnaE is essential for both the initiation and prolongation of DNA replication and the error-prone activity is strongly inhibited by DnaN [56]. Moreover, dnaN, a DNA polymerase sliding clamp, has been proposed as a target for antibiotics [57,58]. In particular, griselimycin is highly active against Mycobacterium tuberculosis by inhibiting DNA polymerase sliding clamp DnaN [59]. The holB gene encodes DNA polymerase III delta subunit [60]. Therefore, the downregulation of the expression of dnaE, dnaN, dnaQ, and holB genes essential for bacterial replication by hesperetin suggests that it might be one of the mechanisms that can inhibit the growth of H. pylori.
Furthermore, hesperetin suppressed the expression of rpoA, rpoB, rpoD, and rpoN genes related to mRNA synthesis in H. pylori (Figure 2B,C). RNA polymerase is involved in bacterial transcription. It is generally composed of α2ββ’ω subunits [9]. RNA polymerase subunit α is encoded by the rpoA gene. It is an initiator of RNA polymerase assembly. It serves as a target for transcriptional regulatory proteins [61]. RNA polymerase β is the largest subunit that plays an important role in the assembly of RNA polymerase [62]. Rifampicin is an antibiotic targeting RNA polymerase. It is mainly used to treat Mycobacterium infection [63]. Resistance of M. tuberculosis to rifampicin is associated with mutations in the rpoB gene [64]. rpoD and rpoN genes encode sigma factors, which are essential regulators of transcription initiation in bacteria that confer promoter recognition specificity on the RNA polymerase core enzyme [65]. These results suggest that downregulation of the RNA polymerase subunit by hesperetin might also be concerned with the inhibition of H. pylori growth. Moreover, the diminution of transcription means that various proteins produced by H. pylori can also be reduced, consistent with the results of the present study.
Downregulation of the urease subunit by hesperetin may contribute to the inhibition of initial colonization of H. pylori in the gastric mucosa and survival in a highly acidic environment (Figure 3). Urease-negative mutant H. pylori could not colonize nude mice or gnotobiotic piglets, indicating that urease activity is indispensable for the colonization of H. pylori [66,67]. Decreased expression of UreA and UreB by hesperetin reduced the urease activity of H. pylori (Figure 3D). Ammonia produced by H. pylori urease can directly damage gastric epithelial cells and induce an immune response [68,69]. Moreover, CO2 generated by urease is used by H. pylori to inhibit peroxynitrite and protect H. pylori from oxidative damage, thus increasing the survival rate [70,71]. This means that urease reduced by hesperetin might not only weaken the immune response during H. pylori infection, but also potentially interfere with survival in H. pylori.
In addition, downregulation of the flagella-related genes flhA, flaA, and flgE by hesperetin might contribute to the inhibition of colonization by inhibiting the migration of H. pylori to the gastric epithelium (Figure 4). The flhA mutant Campylobacter jejuni could not produce flagella. Thus, its colonization is markedly reduced [72]. It has been reported that the H. pylori mutant with mutations of the flaA and flaB genes important for the formation of flagellin constituting flagella lacks motility [13,73]. Although mutant H. pylori with mutations of flgE, which encodes flagella hook protein, can produce flagella, it lacks motility [74]. These results suggest that downregulation of flagella components by hesperetin might also be involved in the inhibition of H. pylori colonization.
Hesperetin inhibited the expression of sabA, alpA, alpB, hpaA, and hopZ genes known as H. pylori adherence-related genes. It also interrupted the adhesion of H. pylori to gastric epithelial cells (Figure 5). The adhesion ability of H. pylori has been proposed as one of the mechanisms of chronic gastritis and gastric cancer caused by H. pylori [75]. Chronic infection of H. pylori increases inflammation and sialyl-Lewis X expression [17,76]. SabA adhesin mediates H. pylori binding to inflamed gastric mucosa by recognizing the sialyl-Lewis a and sialyl-Lewis x antigens [77]. According to Lu et al., alpA and alpB can induce gastric damage by inducing intracellular signaling cascades after H. pylori attaches to epithelial cells. Infecting gastric epithelial cells with alpA and alpB mutant H. pylori can lead to decreased IL-6 and IL-8 induction [21]. In wild-type and hpaA mutant H. pylori-infected mice, the hpaA mutant strain could not establish colonization [19]. These results suggest that inhibition of H. pylori adhesion by hesperetin can reduce long-term infection and inflammatory response of H. pylori, consistent with the results of the present study.
Hesperetin inhibited the translocation of CagA and VacA into host cells (Figure 6B). This might have occurred due to the downregulation of CagA and VacA expression and their secretory system in H. pylori (Figure 6C–E). The T4SS of H. pylori mediates the injection of CagA into gastric epithelial cells, causing inflammation and gastric cancer [78]. Expression levels of virB2, virB4-9, and virD4 genes were decreased by hesperetin (Figure 6D,E). VirB4, VirB6, VirB8, VirB11, and VirD4 proteins constitute the inner membrane complex of T4SS. In particular, VirB4, VirB11, and VirD4 proteins are inner membrane ATPases required for the assembly of the secretion system, substrate translocation, and pilus formation [79,80]. VirB7, VirB9, and VirB10 compose translocation channels across bacterial membranes. They play an important role in the translocation of CagA [28,29]. The external pilus of T4SS, which directly binds to host cells, is composed of VirB2 and VirB5 proteins. In particular, VirB5 protein is necessary for CagA injection. It induces IL-8 [27,81]. Secretion of the VacA protein is mediated by Sec-dependent T5aSS [31]. In this study, expression levels of SecA gene and protein were downregulated by hesperetin treatment (Figure 6C–E). In summary, hesperetin not only inhibited the production of CagA and VacA secreted by H. pylori, but also downregulated components of T4SS and T5aSS. Thus, the amounts of CagA and VacA proteins translocated into host cells were also reduced.
In this study, inhibitory effects of hesperetin on H. pylori growth and H. pylori-induced inflammation were ascertained. MICs of hesperetin were validated against H. pylori reference strains and clinical isolates. Hesperetin inhibited the growth of H. pylori by downregulating the replication and transcription machineries of H. pylori. Hesperetin also reduced urease activity by downregulating urease subunit proteins. Hesperetin reduced H. pylori motility and adherence activity by downregulating genes constituting flagella and adhesion-related genes required for the successful colonization of H. pylori. CagA and VacA as representative virulence factors of H. pylori and secretion systems for secreting these proteins were downregulated by hesperetin, which causes decreased translocation of CagA and VacA to host cells.
Further studies using animal infection models are needed to evaluate the stability of hesperetin, as well as the success of using it for H. pylori eradication, its anti-inflammatory effect, and its inhibitory effect on the cancer progression caused by long-term H. pylori infection.

4. Materials and Methods

4.1. Bacterial Culture and Collection of H. pylori Clinical Isolates

H. pylori reference strains of ATCC 49503, ATCC 43504, ATCC 51932, and ATCC 700392 were purchased from the American Type Culture Collection (ATCC; Manassas, VA, USA). H. pylori SS1 strain was obtained from the Korean Type Culture Collection at Gyeongsang National University (Jinju, Korea). H. pylori were incubated on Brucella agar plates (BD Biosciences, Braintree, MA, USA) supplemented with 10% bovine serum (BRL Life Technologies, Grand Island, NY, USA) at 37 °C for 72 h under a humidified condition with 5% CO2. The number of bacterial particles in the H. pylori suspension was set to McFarland 0.33 and cultured in Mueller–Hinton broth supplemented with 10% bovine serum at 37 °C for 72 h under a humidified condition with 5% CO2. Gastric biopsy specimens for the isolation of H. pylori were collected at Yong-In Severance Hospital, Korea. H. pylori clinical strains were isolated from 46 patients undergoing gastroscopic examinations to confirm the infection of H. pylori.

4.2. Mammalian Cell Culture

AGS gastric adenocarcinoma cells (ATCC CRL-1739) were cultured in Dulbecco’s modified Eagle’s medium (DMEM; BRL Life Technologies) supplemented with 10% fetal bovine serum (FBS; BRL Life Technologies) and streptomycin–penicillin (100 μg/mL and 100 IU/mL; BRL Life Technologies). AGS cells were incubated at 37 °C in a humidified atmosphere with 5% CO2.

4.3. Determination of MIC

For the agar dilution test, 10 μL of bacterial suspension was placed on Mueller–Hinton agar supplemented with 10% bovine serum including hesperetin at indicated concentrations (0, 6.25, 12.5, 25, and 50 μM). The final concentration of dimethyl sulfoxide (DMSO) was calculated and treated consistently in all media. Bacteria were incubated for 72 h and MIC was determined based on the lowest concentration showing growth inhibition. For the broth dilution test, various concentrations (0~200 μM) of hesperetin were used for treatment and bacteria were incubated for 72 h. The final DMSO concentration was calculated and treated consistently in all media. The final optical density (600 nm) of the bacterial suspension was measured by spectrophotometry.

4.4. Reverse Transcriptase–Polymerase Chain Reaction (RT-PCR)

H. pylori ATCC 49503 strain was grown in Mueller–Hinton broth for 72 h with different concentrations (0, 6.25, 12.5, 25, and 50 μM) of hesperetin. Cultured H. pylori were washed twice with sterile saline and subjected to total RNA extraction using TRIzol reagent as described in the manufacturer’s instructions. The PCR primer sequences that were used in this study are listed in Table 2 [39,49,50,51,52,53,54,55]. Elongation factor P (efp) was used as an internal control. The final PCR products were analyzed using 2% agarose gel electrophoresis, stained with ethidium bromide (EtBr) for 10 min, and destained with distilled water for 20 min. Band intensities of PCR products were analyzed with ImageLab software (Bio-Rad, Hercules, CA, USA).

4.5. Western Blotting

Bacteria and AGS cells were washed twice with sterile phosphate-buffered saline (PBS) and lysed with radioimmunoprecipitation assay (RIPA) lysis buffer (Millipore, Billerica, MA, USA) containing a protease inhibitor cocktail (Calbiochem, San Diego, CA, USA). Protein concentrations were determined based on the Lowry method. Antibodies to detect CagA, VacA, and β-actin were purchased from Santa Cruz Biotechnology (Dallas, TX, USA). A polyclonal antibody against the whole H. pylori (ATCC 49503) and SecA were produced, as previously described [82]. The polyclonal antibody against whole H. pylori was used as an internal control to compare the amount of H. pylori protein. β-Actin was used as an internal control for mammalian cell proteins.

4.6. Urease Activity Test

H. pylori ATCC 49503 strain was grown in Mueller–Hinton broth with different concentrations (0, 6.25, 12.5, 25, and 50 μM) of hesperetin for 72 h. After that, the supernatants were collected. To each sample, 5 μL of 20% urea was added and the samples were incubated at 37 °C for 10 min. Urease activity was confirmed by measuring the amount of ammonia using an Asan Set Ammonia kit (Asan Pharmaceutical, Seoul, Korea) according to the manufacturer’s instructions. Ammonia concentrations in the specimens were calculated using the standard curve.

4.7. Motility Test

H. pylori ATCC 49503 strain grown in Brucella agar was collected and resuspended in 0.85% sterile saline. The number of bacterial particles in the H. pylori suspension was set to McFarland 0.33. H. pylori was inoculated using a needle into the motility medium, which was Mueller–Hinton broth supplemented with 10% bovine serum, 0.4% agar, and hesperetin at the indicated concentrations (0, 6.25, 12.5, 25, and 50 μM) in 6-well plates. After 5 days, the diameter H. pylori grown on the pate was measured.

4.8. Adhesion Activity Test

AGS cells were seeded into DMEM containing 10% FBS without antibiotics for an infection. H. pylori cultured in a Mueller–Hinton broth and treated with hesperetin at the indicated concentrations (0, 6.25, 12.5, 25, and 50 μM) was added to AGS cells at 100 MOI and incubated at 37 °C for 30 min in a shaking incubator. After that, AGS cells were washed thrice with PBS and fixed with 1% paraformaldehyde. Cell complexity was then analyzed using a flow cytometer.

4.9. Statistical Analysis

Data in bar graphs are presented as mean ± standard error of mean (SEM). All statistical analyses were performed using GraphPad Prism 7.0 software (GraphPad Software, San Diego, CA, USA). All data were analyzed by unpaired Student’s t-test, and p < 0.05 was considered to be statistically significant (* p < 0.05, ** p < 0.01, and *** p < 0.001).

Author Contributions

H.W.K. carried out all experiments; H.J.W. wrote the manuscript; J.Y.Y. aided in interpreting the results; J.-B.K. conceived the study and was in charge of the overall direction; S.-H.K. oversaw the manuscript, designed the figures, and supervised the project. All authors have read and agreed to the published version of the manuscript.

Funding

This research was funded by the National Research Foundation of Korea (NRF) grant funded by the Korean government (Ministry of Sciences and ICT; No. 2019R1G1A1100451).

Institutional Review Board Statement

The experiment for clinical isolates of H. pylori was conducted after obtaining Institutional Review Board approval at Yonsei University Mirae Campus (IRB No. 1041849-201705-BR-056-01).

Informed Consent Statement

Not applicable.

Data Availability Statement

The data that support the findings of this study are available from the corresponding author upon reasonable request.

Conflicts of Interest

The authors have no conflict of interest relevant to this study to disclose.

References

  1. Zamani, M.; Ebrahimtabar, F.; Zamani, V.; Miller, W.H.; Alizadeh-Navaei, R.; Shokri-Shirvani, J.; Derakhshan, M.H. Systematic review with meta-analysis: The worldwide prevalence of Helicobacter pylori infection. Aliment. Pharmacol. Ther. 2018, 47, 868–876. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  2. Kotilea, K.; Bontems, P.; Touati, E. epidemiology, diagnosis and risk factors of Helicobacter pylori infection. Adv. Exp. Med. Biol. 2019, 1149, 17–33. [Google Scholar] [CrossRef] [PubMed]
  3. Leja, M.; Grinberga-Derica, I.; Bilgilier, C.; Steininger, C. Review: Epidemiology of Helicobacter pylori infection. Helicobacter 2019, 24 (Suppl. S1), e12635. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  4. Leipe, D.D.; Aravind, L.; Grishin, N.V.; Koonin, E.V. The bacterial replicative helicase DnaB evolved from a RecA duplication. Genome Res. 2000, 10, 5–16. [Google Scholar]
  5. Messer, W. The bacterial replication initiator DnaA. DnaA and OriC, the bacterial mode to initiate DNA replication. FEMS Microbiol. Rev. 2002, 26, 355–374. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  6. Maciag, M.; Kochanowska, M.; Lyzen, R.; Wegrzyn, G.; Szalewska-Palasz, A. ppGpp inhibits the activity of Escherichia coli DnaG primase. Plasmid 2010, 63, 61–67. [Google Scholar] [CrossRef]
  7. Nitharwal, R.G.; Verma, V.; Dasgupta, S.; Dhar, S.K. Helicobacter pylori chromosomal DNA replication: Current status and future perspectives. FEBS Lett. 2011, 585, 7–17. [Google Scholar] [CrossRef] [Green Version]
  8. Li, X.T.; Thomason, L.C.; Sawitzke, J.A.; Costantino, N.; Court, D.L. Bacterial DNA polymerases participate in oligonucleotide recombination. Mol. Microbiol. 2013, 88, 906–920. [Google Scholar] [CrossRef]
  9. Campbell, E.A.; Korzheva, N.; Mustaev, A.; Murakami, K.; Nair, S.; Goldfarb, A.; Darst, S.A. Structural mechanism for rifampicin inhibition of bacterial RNA polymerase. Cell 2001, 104, 901–912. [Google Scholar] [CrossRef]
  10. Aihara, E.; Closson, C.; Matthis, A.L.; Schumacher, M.A.; Engevik, A.C.; Zavros, Y.; Ottemann, K.M.; Montrose, M.H. Motility and chemotaxis mediate the preferential colonization of gastric injury sites by Helicobacter pylori. PLoS Pathog. 2014, 10, e1004275. [Google Scholar] [CrossRef] [Green Version]
  11. Ottemann, K.M.; Lowenthal, A.C. Helicobacter pylori uses motility for initial colonization and to attain robust infection. Infect. Immun. 2002, 70, 1984–1990. [Google Scholar] [CrossRef] [Green Version]
  12. Allan, E.; Dorrell, N.; Foynes, S.; Anyim, M.; Wren, B.W. Mutational analysis of genes encoding the early flagellar components of Helicobacter pylori: Evidence for transcriptional regulation of flagellin A biosynthesis. J. Bacteriol. 2000, 182, 5274–5277. [Google Scholar] [CrossRef] [Green Version]
  13. Schirm, M.; Soo, E.C.; Aubry, A.J.; Austin, J.; Thibault, P.; Logan, S.M. Structural, genetic and functional characterization of the flagellin glycosylation process in Helicobacter pylori. Mol. Microbiol. 2003, 48, 1579–1592. [Google Scholar] [CrossRef] [PubMed]
  14. Loconte, V.; Kekez, I.; Matkovic-Calogovic, D.; Zanotti, G. Structural characterization of FlgE2 protein from Helicobacter pylori hook. FEBS J. 2017, 284, 4328–4342. [Google Scholar] [CrossRef] [Green Version]
  15. Tsang, J.; Hoover, T.R. Basal body structures differentially affect transcription of RpoN- and FliA-dependent flagellar genes in Helicobacter pylori. J. Bacteriol. 2015, 197, 1921–1930. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  16. Benktander, J.; Angstrom, J.; Breimer, M.E.; Teneberg, S. Redefinition of the carbohydrate binding specificity of Helicobacter pylori BabA adhesin. J. Biol. Chem. 2012, 287, 31712–31724. [Google Scholar] [CrossRef] [Green Version]
  17. Yamaoka, Y. Increasing evidence of the role of Helicobacter pylori SabA in the pathogenesis of gastroduodenal disease. J. Infect. Dev. Ctries. 2008, 2, 174–181. [Google Scholar] [CrossRef] [Green Version]
  18. Yamaoka, Y.; Kikuchi, S.; El-Zimaity, H.M.; Gutierrez, O.; Osato, M.S.; Graham, D.Y. Importance of Helicobacter pylori oipA in clinical presentation, gastric inflammation, and mucosal interleukin 8 production. Gastroenterology 2002, 123, 414–424. [Google Scholar] [CrossRef]
  19. Carlsohn, E.; Nystrom, J.; Bolin, I.; Nilsson, C.L.; Svennerholm, A.M. HpaA is essential for Helicobacter pylori colonization in mice. Infect. Immun. 2006, 74, 920–926. [Google Scholar] [CrossRef] [Green Version]
  20. de Jonge, R.; Durrani, Z.; Rijpkema, S.G.; Kuipers, E.J.; van Vliet, A.H.M.; Kusters, J.G. Role of the Helicobacter pylori outer-membrane proteins AlpA and AlpB in colonization of the guinea pig stomach. J. Med. Microbiol. 2004, 53, 375–379. [Google Scholar] [CrossRef] [PubMed]
  21. Lu, H.; Wu, J.Y.; Beswick, E.J.; Ohno, T.; Odenbreit, S.; Haas, R.; Reyes, V.E.; Kita, M.; Graham, D.Y.; Yamaoka, Y. Functional and intracellular signaling differences associated with the Helicobacter pylori AlpAB adhesin from Western and East Asian strains. J. Biol. Chem. 2007, 282, 6242–6254. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  22. Voland, P.; Hafsi, N.; Zeitner, M.; Laforsch, S.; Wagner, H.; Prinz, C. Antigenic properties of HpaA and Omp18, two outer membrane proteins of Helicobacter pylori. Infect. Immun. 2003, 71, 3837–3843. [Google Scholar] [CrossRef] [Green Version]
  23. Kennemann, L.; Brenneke, B.; Andres, S.; Engstrand, L.; Meyer, T.F.; Aebischer, T.; Josenhans, C.; Suerbaum, S. In vivo sequence variation in HopZ, a phase-variable outer membrane protein of Helicobacter pylori. Infect. Immun. 2012, 80, 4364–4373. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  24. Peck, B.; Ortkamp, M.; Diehl, K.D.; Hundt, E.; Knapp, B. Conservation, localization and expression of HopZ, a protein involved in adhesion of Helicobacter pylori. Nucleic Acids Res. 1999, 27, 3325–3333. [Google Scholar] [CrossRef] [Green Version]
  25. Backert, S.; Blaser, M.J. The role of CagA in the gastric biology of Helicobacter pylori. Cancer Res. 2016, 76, 4028–4031. [Google Scholar] [CrossRef] [Green Version]
  26. Merino, E.; Flores-Encarnacion, M.; Aguilar-Gutierrez, G.R. Functional interaction and structural characteristics of unique components of Helicobacter pylori T4SS. FEBS J. 2017, 284, 3540–3549. [Google Scholar] [CrossRef] [Green Version]
  27. Backert, S.; Tegtmeyer, N.; Fischer, W. Composition, structure and function of the Helicobacter pylori cag pathogenicity island encoded type IV secretion system. Future Microbiol. 2015, 10, 955–965. [Google Scholar] [CrossRef] [Green Version]
  28. Kutter, S.; Buhrdorf, R.; Haas, J.; Schneider-Brachert, W.; Haas, R.; Fischer, W. Protein subassemblies of the Helicobacter pylori Cag type IV secretion system revealed by localization and interaction studies. J. Bacteriol. 2008, 190, 2161–2171. [Google Scholar] [CrossRef] [Green Version]
  29. Tanaka, J.; Suzuki, T.; Mimuro, H.; Sasakawa, C. Structural definition on the surface of Helicobacter pylori type IV secretion apparatus. Cell Microbiol. 2003, 5, 395–404. [Google Scholar] [CrossRef]
  30. Jones, K.R.; Whitmire, J.M.; Merrell, D.S. A tale of two toxins: Helicobacter pylori CagA and VacA modulate host pathways that impact disease. Front. Microbiol. 2010, 1, 115. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  31. Liechti, G.; Goldberg, J.B. Outer membrane biogenesis in Escherichia coli, Neisseria meningitidis, and Helicobacter pylori: Paradigm deviations in H. pylori. Front. Cell Infect. Microbiol. 2012, 2, 29. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  32. Parhiz, H.; Roohbakhsh, A.; Soltani, F.; Rezaee, R.; Iranshahi, M. Antioxidant and anti-inflammatory properties of the citrus flavonoids hesperidin and hesperetin: An updated review of their molecular mechanisms and experimental models. Phytother. Res. 2015, 29, 323–331. [Google Scholar] [CrossRef] [PubMed]
  33. Khan, A.; Ikram, M.; Hahm, J.R.; Kim, M.O. Antioxidant and Anti-Inflammatory Effects of Citrus Flavonoid Hesperetin: Special Focus on Neurological Disorders. Antioxidants 2020, 9, 609. [Google Scholar] [CrossRef] [PubMed]
  34. Mandalari, G.; Bennett, R.N.; Bisignano, G.; Trombetta, D.; Saija, A.; Faulds, C.B.; Gasson, M.J.; Narbad, A. Antimicrobial activity of flavonoids extracted from bergamot (Citrus bergamia Risso) peel, a byproduct of the essential oil industry. J. Appl. Microbiol. 2007, 103, 2056–2064. [Google Scholar] [CrossRef]
  35. Iranshahi, M.; Rezaee, R.; Parhiz, H.; Roohbakhsh, A.; Soltani, F. Protective effects of flavonoids against microbes and toxins: The cases of hesperidin and hesperetin. Life Sci. 2015, 137, 125–132. [Google Scholar] [CrossRef] [PubMed]
  36. Lee, Y.H.; Lee, N.K.; Paik, H.D. Antimicrobial characterization of inula britannica against Helicobacter pylori on gastric condition. J. Microbiol. Biotechnol. 2016, 26, 1011–1017. [Google Scholar] [CrossRef]
  37. Gonzalez, A.; Salillas, S.; Velazquez-Campoy, A.; Espinosa Angarica, V.; Fillat, M.F.; Sancho, J.; Lanas, A. Identifying potential novel drugs against Helicobacter pylori by targeting the essential response regulator HsrA. Sci. Rep. 2019, 9, 11294. [Google Scholar] [CrossRef] [Green Version]
  38. Krzyżek, P.; Migdał, P.; Paluch, E.; Karwańska, M.; Wieliczko, A.; Gościniak, G. Myricetin as an Antivirulence Compound Interfering with a Morphological Transformation into Coccoid Forms and Potentiating Activity of Antibiotics against Helicobacter pylori. Int. J. Mol. Sci. 2021, 22, 2695. [Google Scholar] [CrossRef]
  39. Yeon, M.J.; Lee, M.H.; Kim, D.H.; Yang, J.Y.; Woo, H.J.; Kwon, H.J.; Moon, C.; Kim, S.H.; Kim, J.B. Anti-inflammatory effects of Kaempferol on Helicobacter pylori—Induced inflammation. Biosci. Biotechnol. Biochem. 2019, 83, 166–173. [Google Scholar] [CrossRef]
  40. Kusters, J.G.; van Vliet, A.H.; Kuipers, E.J. Pathogenesis of Helicobacter pylori infection. Clin. Microbiol. Rev. 2006, 19, 449–490. [Google Scholar] [CrossRef] [Green Version]
  41. Nakamura, H.; Yoshiyama, H.; Takeuchi, H.; Mizote, T.; Okita, K.; Nakazawa, T. Urease plays an important role in the chemotactic motility of Helicobacter pylori in a viscous environment. Infect. Immun. 1998, 66, 4832–4837. [Google Scholar] [CrossRef] [Green Version]
  42. Yoshiyama, H.; Nakazawa, T. Unique mechanism of Helicobacter pylori for colonizing the gastric mucus. Microbes Infect. 2000, 2, 55–60. [Google Scholar] [CrossRef]
  43. Chang, C.C.; Kuo, W.S.; Chen, Y.C.; Perng, C.L.; Lin, H.J.; Ou, Y.H. Fragmentation of CagA reduces hummingbird phenotype induction by Helicobactor pylori. PLoS ONE 2016, 11, e0150061. [Google Scholar] [CrossRef] [PubMed]
  44. Rassow, J. Helicobacter pylori vacuolating toxin A and apoptosis. Cell Commun. Signal. 2011, 9, 26. [Google Scholar] [CrossRef] [Green Version]
  45. Zou, Y.; Qian, X.; Liu, X.; Song, Y.; Song, C.; Wu, S.; An, Y.; Yuan, R.; Wang, Y.; Xie, Y. The effect of antibiotic resistance on Helicobacter pylori eradication efficacy: A systematic review and meta-analysis. Helicobacter 2020, 25, e12714. [Google Scholar] [CrossRef] [PubMed]
  46. Dang, B.N.; Graham, D.Y. Helicobacter pylori infection and antibiotic resistance: A WHO high priority? Nat. Rev. Gastroenterol. Hepatol. 2017, 14, 383–384. [Google Scholar] [CrossRef]
  47. Shirai, N.; Furuta, T.; Sugimoto, M.; Nakamura, A. High dose dual PPI/AMPC therapy for the treatment of Helicobacter pylori infection after failure of usual standard triple PPI/AMPC/CAM therapy. Nihon Rinsho 2005, 63 (Suppl. S11), 438–441. [Google Scholar]
  48. Bae, E.A.; Han, M.J.; Kim, D.H. In vitro anti-Helicobacter pylori activity of some flavonoids and their metabolites. Planta Med. 1999, 65, 442–443. [Google Scholar] [CrossRef]
  49. Lee, M.H.; Kwon, H.J.; Kim, D.H.; Yang, J.Y.; Cho, Y.; Woo, H.J.; Yeon, M.J.; Park, M.; Moon, C.; Kim, S.-H.; et al. Kinetin inhibits growth of Helicobacter pylori by down-regulation of replication genes. Int. J. Clin. Exp. Med. 2017, 10, 795–801. [Google Scholar]
  50. Tharmalingam, N.; Kim, S.H.; Park, M.; Woo, H.J.; Kim, H.W.; Yang, J.Y.; Rhee, K.J.; Kim, J.B. Inhibitory effect of piperine on Helicobacter pylori growth and adhesion to gastric adenocarcinoma cells. Infect. Agent Cancer 2014, 9, 43. [Google Scholar] [CrossRef] [Green Version]
  51. Clayton, C.; Kleanthous, K.; Tabaqchali, S. Detection and identification of Helicobacter pylori by the polymerase chain reaction. J. Clin. Pathol. 1991, 44, 515–516. [Google Scholar] [CrossRef] [Green Version]
  52. Shen, F.; Hobley, L.; Doherty, N.; Loh, J.T.; Cover, T.L.; Sockett, R.E.; Hardie, K.R.; Atherton, J.C. In Helicobacter pylori auto-inducer-2, but not LuxS/MccAB catalysed reverse transsulphuration, regulates motility through modulation of flagellar gene transcription. BMC Microbiol. 2010, 10, 210. [Google Scholar] [CrossRef]
  53. Wang, J.; Wang, W.H.; Li, J.; Liu, F.X. Celecoxib inhibits Helicobacter pylori colonization-related factors. World J. Gastroenterol. 2010, 16, 846–853. [Google Scholar] [CrossRef] [PubMed]
  54. Boonjakuakul, J.K.; Canfield, D.R.; Solnick, J.V. Comparison of Helicobacter pylori virulence gene expression in vitro and in the rhesus macaque. Infect. Immun. 2005, 73, 4895–4904. [Google Scholar] [CrossRef] [Green Version]
  55. Jolley, K.A.; Maiden, M.C. BIGSdb: Scalable analysis of bacterial genome variation at the population level. BMC Bioinform. 2010, 11, 595. [Google Scholar] [CrossRef] [Green Version]
  56. Paschalis, V.; Le Chatelier, E.; Green, M.; Nouri, H.; Kepes, F.; Soultanas, P.; Janniere, L. Interactions of the Bacillus subtilis DnaE polymerase with replisomal proteins modulate its activity and fidelity. Open Biol. 2017, 7, 170146. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  57. Trojanowski, D.; Kolodziej, M.; Holowka, J.; Muller, R.; Zakrzewska-Czerwinska, J. Watching DNA replication inhibitors in action: Exploiting time-lapse microfluidic microscopy as a tool for target-drug interaction studies in Mycobacterium. Antimicrob. Agents Chemother. 2019, 63, e00739-19. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  58. Yin, Z.; Wang, Y.; Whittell, L.R.; Jergic, S.; Liu, M.; Harry, E.; Dixon, N.E.; Kelso, M.J.; Beck, J.L.; Oakley, A.J. DNA replication is the target for the antibacterial effects of nonsteroidal anti-inflammatory drugs. Chem. Biol. 2014, 21, 481–487. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  59. Machaba, K.E.; Cele, F.N.; Mhlongo, N.N.; Soliman, M.E. Sliding clamp of DNA polymerase III as a drug target for TB therapy: Comprehensive conformational and binding analysis from molecular dynamic simulations. Cell Biochem. Biophys. 2016, 74, 473–481. [Google Scholar] [CrossRef]
  60. Dong, Z.; Onrust, R.; Skangalis, M.; O’Donnell, M. DNA polymerase III accessory proteins. I. holA and holB encoding delta and delta’. J. Biol. Chem. 1993, 268, 11758–11765. [Google Scholar] [CrossRef]
  61. Borin, B.N.; Tang, W.; Krezel, A.M. Helicobacter pylori RNA polymerase alpha-subunit C-terminal domain shows features unique to epsilon-proteobacteria and binds NikR/DNA complexes. Protein Sci. 2014, 23, 454–463. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  62. Dailidiene, D.; Tan, S.; Ogura, K.; Zhang, M.; Lee, A.H.; Severinov, K.; Berg, D.E. Urea sensitization caused by separation of Helicobacter pylori RNA polymerase beta and beta’ subunits. Helicobacter 2007, 12, 103–111. [Google Scholar] [CrossRef]
  63. Li, J.; Xin, J.; Zhang, L.; Jiang, L.; Cao, H.; Li, L. Rapid detection of rpoB mutations in rifampin resistant M. tuberculosis from sputum samples by denaturing gradient gel electrophoresis. Int. J. Med. Sci. 2012, 9, 148–156. [Google Scholar] [CrossRef] [Green Version]
  64. Jamieson, F.B.; Guthrie, J.L.; Neemuchwala, A.; Lastovetska, O.; Melano, R.G.; Mehaffy, C. Profiling of rpoB mutations and MICs for rifampin and rifabutin in Mycobacterium tuberculosis. J. Clin. Microbiol. 2014, 52, 2157–2162. [Google Scholar] [CrossRef] [Green Version]
  65. Schulz, S.; Eckweiler, D.; Bielecka, A.; Nicolai, T.; Franke, R.; Dotsch, A.; Hornischer, K.; Bruchmann, S.; Duvel, J.; Haussler, S. Elucidation of sigma factor-associated networks in Pseudomonas aeruginosa reveals a modular architecture with limited and function-specific crosstalk. PLoS Pathog. 2015, 11, e1004744. [Google Scholar] [CrossRef] [Green Version]
  66. Tsuda, M.; Karita, M.; Morshed, M.G.; Okita, K.; Nakazawa, T. A urease-negative mutant of Helicobacter pylori constructed by allelic exchange mutagenesis lacks the ability to colonize the nude mouse stomach. Infect. Immun. 1994, 62, 3586–3589. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  67. Karita, M.; Tsuda, M.; Nakazawa, T. Essential role of urease in vitro and in vivo Helicobacter pylori colonization study using a wild-type and isogenic urease mutant strain. J. Clin. Gastroenterol. 1995, 21 (Suppl. S1), S160–S163. [Google Scholar]
  68. Smoot, D.T.; Mobley, H.L.T.; Chippendale, G.R.; Lewison, J.F.; Resau, J.H. Helicobacter pylori urease activity is toxic to human gastric epithelial-cells. Infect. Immun. 1990, 58, 1992–1994. [Google Scholar] [CrossRef] [Green Version]
  69. de Jesus Souza, M.; de Moraes, J.A.; Da Silva, V.N.; Helal-Neto, E.; Uberti, A.F.; Scopel-Guerra, A.; Olivera-Severo, D.; Carlini, C.R.; Barja-Fidalgo, C. Helicobacter pylori urease induces pro-inflammatory effects and differentiation of human endothelial cells: Cellular and molecular mechanism. Helicobacter 2019, 24, e12573. [Google Scholar] [CrossRef] [PubMed]
  70. Schmalstig, A.A.; Benoit, S.L.; Misra, S.K.; Sharp, J.S.; Maier, R.J. Noncatalytic antioxidant role for Helicobacter pylori urease. J. Bacteriol. 2018, 200, e00124-18. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  71. Bryk, R.; Griffin, P.; Nathan, C. Peroxynitrite reductase activity of bacterial peroxiredoxins. Nature 2000, 407, 211–215. [Google Scholar] [CrossRef] [PubMed]
  72. Carrillo, C.D.; Taboada, E.; Nash, J.H.; Lanthier, P.; Kelly, J.; Lau, P.C.; Verhulp, R.; Mykytczuk, O.; Sy, J.; Findlay, W.A.; et al. Genome-wide expression analyses of Campylobacter jejuni NCTC11168 reveals coordinate regulation of motility and virulence by flhA. J. Biol. Chem. 2004, 279, 20327–20338. [Google Scholar] [CrossRef] [Green Version]
  73. Kao, C.Y.; Chen, J.W.; Wang, S.; Sheu, B.S.; Wu, J.J. The Helicobacter pylori J99 jhp0106 gene, under the control of the CsrA/RpoN regulatory system, modulates flagella formation and motility. Front. Microbiol. 2017, 8, 483. [Google Scholar] [CrossRef] [Green Version]
  74. O’Toole, P.W.; Kostrzynska, M.; Trust, T.J. Non-motile mutants of Helicobacter pylori and Helicobacter mustelae defective in flagellar hook production. Mol. Microbiol. 1994, 14, 691–703. [Google Scholar] [CrossRef] [PubMed]
  75. Huang, Y.; Wang, Q.L.; Cheng, D.D.; Xu, W.T.; Lu, N.H. Adhesion and invasion of gastric mucosa epithelial cells by Helicobacter pylori. Front. Cell. Infect. Microbiol. 2016, 6, 159. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  76. Aspholm, M.; Olfat, F.O.; Norden, J.; Sonden, B.; Lundberg, C.; Sjostrom, R.; Altraja, S.; Odenbreit, S.; Haas, R.; Wadstrom, T.; et al. SabA is the H. pylori hemagglutinin and is polymorphic in binding to sialylated glycans. PLoS Pathog. 2006, 2, e110. [Google Scholar] [CrossRef] [Green Version]
  77. Magalhaes, A.; Reis, C.A. Helicobacter pylori adhesion to gastric epithelial cells is mediated by glycan receptors. Braz. J. Med. Biol. Res. 2010, 43, 611–618. [Google Scholar] [CrossRef] [Green Version]
  78. Hatakeyama, M. Helicobacter pylori CagA and gastric cancer: A paradigm for hit-and-run carcinogenesis. Cell Host Microbe 2014, 15, 306–316. [Google Scholar] [CrossRef] [Green Version]
  79. Shariq, M.; Kumar, N.; Kumari, R.; Kumar, A.; Subbarao, N.; Mukhopadhyay, G. Biochemical analysis of CagE: A virB4 homologue of Helicobacter pylori Cag-T4SS. PLoS ONE 2015, 10, e0142606. [Google Scholar] [CrossRef]
  80. Olbermann, P.; Josenhans, C.; Moodley, Y.; Uhr, M.; Stamer, C.; Vauterin, M.; Suerbaum, S.; Achtman, M.; Linz, B. A global overview of the genetic and functional diversity in the Helicobacter pylori cag pathogenicity island. PLoS Genet. 2010, 6, e1001069. [Google Scholar] [CrossRef] [Green Version]
  81. Tafreshi, M.; Guan, J.; Gorrell, R.J.; Chew, N.; Xin, Y.; Deswaerte, V.; Rohde, M.; Daly, R.J.; Peek, R.M., Jr.; Jenkins, B.J.; et al. Helicobacter pylori type IV secretion system and its adhesin subunit, CagL, mediate potent inflammatory responses in primary human endothelial cells. Front. Cell. Infect. Microbiol. 2018, 8, 22. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  82. Sharma, S.A.; Tummuru, M.K.; Blaser, M.J.; Kerr, L.D. Activation of IL-8 gene expression by Helicobacter pylori is regulated by transcription factor nuclear factor-κB in gastric epithelial cells. J. Immunol. 1998, 160, 2401–2407. [Google Scholar] [PubMed]
Figure 1. Antibacterial activity of hesperetin against H. pylori. (A) Chemical structure of hesperetin. (B) Minimal inhibitory concentrations of hesperetin against five H. pylori reference strains (ATCC 49503, ATCC 43504, ATCC 51932, ATCC 700392, and SS1) were determined by the agar dilution method. (C) The minimal inhibitory concentration of hesperetin against H. pylori ATCC 49503 strain was confirmed by the broth dilution method. Data are presented as mean ± SEM. Results from triplicate experiments were analyzed by Student’s t-test (* p < 0.05 and *** p < 0.001).
Figure 1. Antibacterial activity of hesperetin against H. pylori. (A) Chemical structure of hesperetin. (B) Minimal inhibitory concentrations of hesperetin against five H. pylori reference strains (ATCC 49503, ATCC 43504, ATCC 51932, ATCC 700392, and SS1) were determined by the agar dilution method. (C) The minimal inhibitory concentration of hesperetin against H. pylori ATCC 49503 strain was confirmed by the broth dilution method. Data are presented as mean ± SEM. Results from triplicate experiments were analyzed by Student’s t-test (* p < 0.05 and *** p < 0.001).
Ijms 22 10035 g001
Figure 2. Downregulation of replication and transcription genes of H. pylori. RNA was subjected to RT-PCR to detect mRNA expression levels of genes of (A) the replication machinery (dnaA, dnaB, dnaE, dnaN, dnaQ, polA, and holB) and (B) the transcription machinery (rpoA, rpoB, rpoD, and rpoN). The expression of efp was used as an internal control. (C) Each band intensity was normalized to efp. Data are presented as mean ± SEM of triplicate experiments and were analyzed by Student’s t-test (* p < 0.05, ** p < 0.01, and *** p < 0.001).
Figure 2. Downregulation of replication and transcription genes of H. pylori. RNA was subjected to RT-PCR to detect mRNA expression levels of genes of (A) the replication machinery (dnaA, dnaB, dnaE, dnaN, dnaQ, polA, and holB) and (B) the transcription machinery (rpoA, rpoB, rpoD, and rpoN). The expression of efp was used as an internal control. (C) Each band intensity was normalized to efp. Data are presented as mean ± SEM of triplicate experiments and were analyzed by Student’s t-test (* p < 0.05, ** p < 0.01, and *** p < 0.001).
Ijms 22 10035 g002
Figure 3. Downregulation of the inhibitory effect of hesperetin on the expression and activity of urease in H. pylori. (A) H. pylori was treated with the indicated concentrations (0, 6.25, 12.5, 25 and 50 μM) of hesperetin. Collected RNA was subjected to RT-PCR to detect mRNA expression levels of urease subunits (ureA and ureB). The expression of efp was used as an internal control. (B) Each band intensity was normalized to efp. (C) Bacterial lysates were subjected to Western blotting to detect UreA and UreB proteins. A rabbit anti-H. pylori polyclonal antibody was used as an internal control. (D) After 72 h, the supernatant was collected and urease activity was determined by measuring the amount of ammonia. Data are presented as mean ± SEM of triplicate experiments and were analyzed by Student’s t-test (*** p < 0.001).
Figure 3. Downregulation of the inhibitory effect of hesperetin on the expression and activity of urease in H. pylori. (A) H. pylori was treated with the indicated concentrations (0, 6.25, 12.5, 25 and 50 μM) of hesperetin. Collected RNA was subjected to RT-PCR to detect mRNA expression levels of urease subunits (ureA and ureB). The expression of efp was used as an internal control. (B) Each band intensity was normalized to efp. (C) Bacterial lysates were subjected to Western blotting to detect UreA and UreB proteins. A rabbit anti-H. pylori polyclonal antibody was used as an internal control. (D) After 72 h, the supernatant was collected and urease activity was determined by measuring the amount of ammonia. Data are presented as mean ± SEM of triplicate experiments and were analyzed by Student’s t-test (*** p < 0.001).
Ijms 22 10035 g003
Figure 4. Downregulation of the inhibitory effect of hesperetin on the expression of flagella genes and motility of H. pylori. (A) H. pylori was treated with hesperetin at indicated concentrations (0, 6.25, 12.5, 25, and 50 μM). The collected RNA was subjected to RT-PCR to detect mRNA expression levels of flagella genes (flhA, flaA, flaB, and flgE). The expression of efp was used as an internal control. (B) Each band intensity was normalized to efp. (C) Mueller–Hinton semi-solid agar containing 0.4% agar and hesperetin at the indicated concentrations (0, 6.25, 12.5, 25, and 50 μM). The negative control was a motility medium not inoculated with H. pylori. H. pylori was inoculated using a needle and cultured in a CO2 incubator at 37 °C for 5 days. After incubation, the radius of H. pylori growth spread was measured. (D) Data are presented as mean ± SEM of triplicate experiments and were analyzed by Student’s t-test (*** p < 0.001).
Figure 4. Downregulation of the inhibitory effect of hesperetin on the expression of flagella genes and motility of H. pylori. (A) H. pylori was treated with hesperetin at indicated concentrations (0, 6.25, 12.5, 25, and 50 μM). The collected RNA was subjected to RT-PCR to detect mRNA expression levels of flagella genes (flhA, flaA, flaB, and flgE). The expression of efp was used as an internal control. (B) Each band intensity was normalized to efp. (C) Mueller–Hinton semi-solid agar containing 0.4% agar and hesperetin at the indicated concentrations (0, 6.25, 12.5, 25, and 50 μM). The negative control was a motility medium not inoculated with H. pylori. H. pylori was inoculated using a needle and cultured in a CO2 incubator at 37 °C for 5 days. After incubation, the radius of H. pylori growth spread was measured. (D) Data are presented as mean ± SEM of triplicate experiments and were analyzed by Student’s t-test (*** p < 0.001).
Ijms 22 10035 g004
Figure 5. Downregulation of the inhibitory effect of hesperetin on the expression of adherence genes and adhesion of H. pylori. (A) H. pylori was treated with hesperetin at indicated concentrations (0, 6.25, 12.5, 25, and 50 μM). The collected RNA was subjected to RT-PCR to detect mRNA expression levels of adherence genes (sabA, alpA, alpB, hpaA, and hopZ). The expression of efp was used as an internal control. (B) Each band intensity was normalized to efp. (C) H. pylori was pretreated with hesperetin at the indicated concentrations (0, 6.25, 12.5, 25, and 50 μM). AGS cells were infected with H. pylori (100 MOI) for 30 min in a shaking incubator. After incubation, the cell complexity was analyzed using a flow cytometer. Data are presented as mean ± SEM of triplicate experiments and were analyzed by Student’s t-test (*** p < 0.001).
Figure 5. Downregulation of the inhibitory effect of hesperetin on the expression of adherence genes and adhesion of H. pylori. (A) H. pylori was treated with hesperetin at indicated concentrations (0, 6.25, 12.5, 25, and 50 μM). The collected RNA was subjected to RT-PCR to detect mRNA expression levels of adherence genes (sabA, alpA, alpB, hpaA, and hopZ). The expression of efp was used as an internal control. (B) Each band intensity was normalized to efp. (C) H. pylori was pretreated with hesperetin at the indicated concentrations (0, 6.25, 12.5, 25, and 50 μM). AGS cells were infected with H. pylori (100 MOI) for 30 min in a shaking incubator. After incubation, the cell complexity was analyzed using a flow cytometer. Data are presented as mean ± SEM of triplicate experiments and were analyzed by Student’s t-test (*** p < 0.001).
Ijms 22 10035 g005
Figure 6. Inhibitory effect of hesperetin on CagA and VacA translocation to the gastric cell line. (A) AGS gastric cancer cells were treated with hesperetin at indicated concentrations (0, 3.13, 6.25, 12.5, 25, 50, 100, and 200 μM) for 24 h. Cell viability was then measured by the WST assay. AGS cells were infected with H. pylori (100 MOI) and treated with hesperetin at indicated concentrations (0, 6.25, 12.5, 25 and 50 μM) for 24 h. (B) After 24 h of incubation, cell lysates were subjected to Western blotting to detect translocated CagA and VacA proteins. β-Actin was used as an internal control. H. pylori was treated with hesperetin at the indicated concentrations (0, 6.25, 12.5, 25, and 50 μM) for 72 h. (C) Bacterial lysates were subjected to Western blotting to detect CagA, VacA, and SecA. A rabbit anti-H. pylori polyclonal antibody was used as an internal control. (D) The collected RNA was subjected to RT-PCR to detect mRNA expression levels of cagA, T4SS components, vacA, and secA genes. The expression of efp was used as an internal control. (E) Each band intensity was normalized to efp. Data are presented as mean ± SEM from three independent experiments and were analyzed by unpaired Student’s t-test (* p < 0.05, ** p < 0.01, and *** p < 0.001).
Figure 6. Inhibitory effect of hesperetin on CagA and VacA translocation to the gastric cell line. (A) AGS gastric cancer cells were treated with hesperetin at indicated concentrations (0, 3.13, 6.25, 12.5, 25, 50, 100, and 200 μM) for 24 h. Cell viability was then measured by the WST assay. AGS cells were infected with H. pylori (100 MOI) and treated with hesperetin at indicated concentrations (0, 6.25, 12.5, 25 and 50 μM) for 24 h. (B) After 24 h of incubation, cell lysates were subjected to Western blotting to detect translocated CagA and VacA proteins. β-Actin was used as an internal control. H. pylori was treated with hesperetin at the indicated concentrations (0, 6.25, 12.5, 25, and 50 μM) for 72 h. (C) Bacterial lysates were subjected to Western blotting to detect CagA, VacA, and SecA. A rabbit anti-H. pylori polyclonal antibody was used as an internal control. (D) The collected RNA was subjected to RT-PCR to detect mRNA expression levels of cagA, T4SS components, vacA, and secA genes. The expression of efp was used as an internal control. (E) Each band intensity was normalized to efp. Data are presented as mean ± SEM from three independent experiments and were analyzed by unpaired Student’s t-test (* p < 0.05, ** p < 0.01, and *** p < 0.001).
Ijms 22 10035 g006
Table 1. MICs of hesperetin against H. pylori clinical isolates.
Table 1. MICs of hesperetin against H. pylori clinical isolates.
Hesperetin
Concentration (μM)
Number of Strains (%)
6.254(8.7%)
12.53(6.5%)
253(6.5%)
5032(69.6%)
1004(8.7%)
Total46(100%)
Table 2. List of primer sequences and PCR conditions used for RT-PCR.
Table 2. List of primer sequences and PCR conditions used for RT-PCR.
PrimersSequences (5′–3′)Product
Length (bp)
Annealing
Temperature (°C)
CyclesReference
ForwardReverse
DnaAGGGCATGACTTAGCGGTTATTAACGAATTGCACGCCAAC1285527[49]
DnaBAATGGGCCGTTTATCGTCTCCAAATCCGCTTGCAACTACG2315527
DnaEAATCCACCGGCTCCAAATACGCCAAACAAGTGTGGGAGTA1845527
DnaNGTTAGCGGTGGTTGAAAACGCGGTTTCGCTATGCTCAGAA2335527
DnaQCGCATGAAGCTTTGCAAGAAGCATAGGCTCTATGGCTGAC2445527
HolBTGCAAGCCTTTTTGAACACCCGCGTTTTGGGCTTCTATAC1965522
RpoAAGCGACACGTCTTCAGTAACACAGCACCTTTGATCCCATC2245522[50]
RpoBTTTAGGTAAGCGCGTGGATTAATCAGCTTTGGATGGAACG3015924
RpoDTCATCATCATTGCCGACTGGGTCATGCGCAAACACATTCA1525526
RpoNGCCCTTGAAATCGTGCTTACATGATGAGAGCTACCCGACA2505527
UreAGCCAATGGTAAATTAGTTCTCCTTAATTGTTTTTAC4114020[51]
UreBTCTATCCCTACCCCACAACCCCATCCACGAACACATGGTA2525021
FlhATCATTGGAGGGTTTTTAGTGGGGTGCGAGTGGCGACAAT1556028[52]
FlaATAGACACCACCAACGCTAAATGCATTCTAGGGGGTTGTAT2396230[50]
FlaBGTCAATGGCGTGAATGATTAATTCACGGTCCCAATTTCTA2136030
FlgECCGATCAAATCCTTAACACCAGGCTTAAAAACATGCGAAC3815230
SabAAAAGCATTCAAAACGCCAACCCCGCATAAAGACTCCAAAA1636026[50]
HopZGCGCCGTTACTAGCATGATCAGAAATCTTTCGGCGCGTTT1016026[53]
HpaAGAGCGTGGTGGCTTTGTTAGTTCGCTAGCTGGATGGTAATTCA906026
AlpAGCACGATCGGTAGCCAGACTACACATTCCCCGCATTCAAG906024
AlpBACGCTAAGAAACAGCCCTCAACTCATGCGTAACCCCACATCA826026
BabAATCGATCCACTTCCATCACTGTTACGCTTTTGCCGTCTAT2924840
CagAGTCATAATGGCATAGAACCTGAAATTCCCTAGGGCGTCTAAATAA4075921[39]
VirB2CAGTCGCCTGACCTCTTTTGACGGTCACCAGTCCTGCAAC1566225
VirB4GTTATAGGGGCAACCGGAAGTTGAACGCGTCATTCAAAGC4496237
VirB5TACAAGCGTCTGTGAAGCAGGACCAACCAACAAGTGCTCA4366230
VirB6CCTCAACACCGCCTTTGGTATAGCCGCTAGCAATCTGGTG2256225
VirB7GATTACGCTCATAGGCGATGCTGGCTGACTTCCTTGCAACA2026225
VirB8GTTGATCCTTGCGATCCCTCACGCCGCTGTAACGAGTATTG2186225
VirB9GCATGTCCTCTAGTCGTTCCATATCGTAGATGCGCCTGACC2696225
VirD4CCGCAAGTTTCCATAGTGTCGCGAGTTGGGAAACTGAAGA2636225
SecAAAAAATTTGACGCTGTGATCCCCCCCAAGCTCCTTAATTTC2744727
VacAAAACGACAAGAAAGAGATCAGTCCAGCAAAAGGCCCATCAA2915722[54]
EfpGGCAATTTGGATGAGCGAGCTCCTTCACCTTTTCAAGATACTC5595923[55]
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations.

Share and Cite

MDPI and ACS Style

Kim, H.W.; Woo, H.J.; Yang, J.Y.; Kim, J.-B.; Kim, S.-H. Hesperetin Inhibits Expression of Virulence Factors and Growth of Helicobacter pylori. Int. J. Mol. Sci. 2021, 22, 10035. https://doi.org/10.3390/ijms221810035

AMA Style

Kim HW, Woo HJ, Yang JY, Kim J-B, Kim S-H. Hesperetin Inhibits Expression of Virulence Factors and Growth of Helicobacter pylori. International Journal of Molecular Sciences. 2021; 22(18):10035. https://doi.org/10.3390/ijms221810035

Chicago/Turabian Style

Kim, Hyun Woo, Hyun Jun Woo, Ji Yeong Yang, Jong-Bae Kim, and Sa-Hyun Kim. 2021. "Hesperetin Inhibits Expression of Virulence Factors and Growth of Helicobacter pylori" International Journal of Molecular Sciences 22, no. 18: 10035. https://doi.org/10.3390/ijms221810035

APA Style

Kim, H. W., Woo, H. J., Yang, J. Y., Kim, J.-B., & Kim, S.-H. (2021). Hesperetin Inhibits Expression of Virulence Factors and Growth of Helicobacter pylori. International Journal of Molecular Sciences, 22(18), 10035. https://doi.org/10.3390/ijms221810035

Note that from the first issue of 2016, this journal uses article numbers instead of page numbers. See further details here.

Article Metrics

Back to TopTop