Impact of Wheat Streak Mosaic Virus on Peroxisome Proliferation, Redox Reactions, and Resistance Responses in Wheat
Abstract
1. Introduction
2. Results
2.1. Comparison of Phenotypic Response to WSMV in var. Patras and Pamir
2.2. Impact of Viral Infection of Peroxisome Proliferation
2.3. Impact of WSMV Infection on ROS Stress
3. Discussion
3.1. WSMV Immunity and Redox Homeostasis
3.2. Peroxisome Proliferation Is a Component of Viral Immure Response
3.3. Non-Oxidative Stress Related Elements of Plant Immunity
4. Materials and Methods
4.1. Sampling
4.2. Enzyme-Linked Immunosorbent Assay
4.3. RNA Extraction, RT-PCR and qRT-PCR
4.4. Biochemical Assays
4.5. Measuring Peroxisome Abundance
4.6. Yield Analysis
4.7. Statistical Analysis
5. Conclusions
Supplementary Materials
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Hernandez, J.A.G.; Gullner, M.J.; Clemente-Moreno, A.; Kunstler, C.; Juhasz, P.; Diaz-Vivancos, L.; Kiraly, L. Oxidative Stress and Antioxidative Responses in Plant-Virus Interactions. Physiol. Mol. Plant Pathol. 2015, 94, 134–148. [Google Scholar] [CrossRef]
- Kiraly, L.; Albert, R.; Zsemberi, O.; Schwarczinger, I.; Hafez, Y.M.; Künstler, A. Reactive Oxygen Species Contribute to Symptomless, Extreme Resistance to Potato Virus X in Tobacco. Phytopathology 2021. [Google Scholar] [CrossRef]
- Zhao, J.; Zhang, X.; Hong, Y.; Liu, Y. Chloroplast in Plant-Virus Interaction. Front. Microbiol. 2016, 7, 1565. [Google Scholar] [CrossRef] [PubMed]
- Caverzan, A.; Casassola, A.; Brammer, S.P. Antioxidant Responses of Wheat Plants under Stress. Genet. Mol. Biol. 2016, 39, 1–6. [Google Scholar] [CrossRef] [PubMed]
- Domingos, P.; Prado, A.M.; Wang, A.; Gehring, C.; Feijo, J.A. Nitric Oxide: A Multitasked Signaling Gas in Plants. Mol. Plant 2015, 8, 506–520. [Google Scholar] [CrossRef] [PubMed]
- Corpas, F.J.; del Rio, L.A.; Palma, J.M. Plant Peroxisomes at the Crossroad of NO and H2O2 Metabolism. J. Integr. Plant Biol. 2019, 61, 803–816. [Google Scholar] [CrossRef]
- Sahhafi, S.R.; Fatemeh, B.; Assad, M.T. Evaluation of Some Biochemical Responses in Resistance of Fifteen Bread Wheat (Triticum aestivum L.) Genotypes to Wheat Streak Mosaic Virus. J. Agric. Sci. 2012, 4, 75–82. [Google Scholar] [CrossRef]
- Song, X.S.; Wang, Y.J.; Mao, W.H.; Shi, K.; Zhou, Y.H. Effect of Cucumber Mosaic Virus Infection on Electron Transport and Antioxidant System in Chloroplasts and Mitochondria of Cucumber and Tomato Leaves. Physiol. Plant 2009, 135, 246–257. [Google Scholar] [CrossRef]
- Inaba, J.; Kim, B.M.; Shimura, H.; Masuta, C. Virus-Induced Necrosis Is a Consequence of Direct Protein-Protein Interaction between a Viral RNA Silencing Suppressor and a Host Catalase. Plant Physiol. 2011, 156, 2026–2036. [Google Scholar] [CrossRef] [PubMed]
- Foyer, C.H.; Noctor, G. Redox Sensing and Signaling Associated with Reactive Oxygen Species in Chloroplasts, Peroxisomes and Mitochondria. Physiol. Plant 2003, 119, 355–364. [Google Scholar] [CrossRef]
- Pan, R.; Liu, J.; Wang, S.; Hu, J. Peroxisomes: Versatile Organelles with Diverse Roles in Plants. New Phytol. 2020, 226, 1410–1427. [Google Scholar] [CrossRef]
- Sandalio, L.M.; Romero-Puertas, M.C. Peroxisomes Sense and Respond to Environmental Cues by Regulating ROS and RNS Signaling Networks. Ann. Bot. 2015, 116, 475–485. [Google Scholar] [CrossRef] [PubMed]
- Cook, K.C.; Moreno, J.A.; Jean Beltran, P.M.; Cristea, I.M. Peroxisome Plasticity at the Virus-Host Interface. Trends Microbiol. 2019, 27, 906–914. [Google Scholar] [CrossRef] [PubMed]
- Yang, M.; Li, Z.; Zhang, K.; Zhang, X.; Zhang, Y.; Wang, X.; Han, C.; Yu, J.; Xu, K.; Li, D. Barley Stripe Mosaic Virus γb Interacts with Glycolate Oxidase and Inhibits Peroxisomal ROS Production to Facilitate Virus Infection. Mol. Plant 2018, 11, 338–341. [Google Scholar] [CrossRef]
- Rochon, D.; Singh, B.; Reade, R.; Theilmann, J.; Ghoshal, K.; Alam, S.B.; Maghodia, A. The p33 Auxiliary Replicase Protein of Cucumber Necrosis Virus Targets Peroxisomes and Infection Induces De Novo Peroxisome Formation from the Endoplasmic Reticulum. Virology 2014, 452, 133–142. [Google Scholar] [CrossRef]
- Pathak, K.B.; Sasvari, Z.; Nagy, P.D. The Host Pex19p Plays a Role in Peroxisomal Localization of Tombusvirus Replication Proteins. Virology 2008, 379, 294–305. [Google Scholar] [CrossRef]
- Nagy, P.D. Tombusvirus-Host Interactions: Co-Opted Evolutionarily Conserved Host Factors Take Center Court. Annu. Rev. Virol. 2016, 3, 491–515. [Google Scholar] [CrossRef]
- Kovalev, N.; Inaba, J.I.; Li, Z.; Nagy, P.D. The Role of Co-Opted ESCRT Proteins and Lipid Factors in Protection of Tombusviral Double-Stranded RNA Replication Intermediate against Reconstituted RNAi in Yeast. PLoS Pathog. 2017, 13, 1006520. [Google Scholar] [CrossRef]
- Koch, J.; Pranjic, K.; Huber, A.; Ellinger, A.; Hartig, A.; Kragler, F.; Brocard, C. PEX11 Family Members are Membrane Elongation Factors that Coordinate Peroxisome Proliferation and Maintenance. J. Cell Sci. 2010, 123, 3389–3400. [Google Scholar] [CrossRef] [PubMed]
- Hu, J.; Baker, A.; Bartel, B.; Linka, N.; Mullen, R.T.; Reumann, S.; Zolman, B.K. Plant Peroxisomes: Biogenesis and Function. Plant Cell 2012, 24, 2279–2303. [Google Scholar] [CrossRef]
- Schrader, M.; Bonekamp, N.A.; Islinger, M. Fission and Proliferation of Peroxisomes. Biochim. Biophys. Acta 2012, 1822, 1343–1357. [Google Scholar] [CrossRef] [PubMed]
- Lingard, M.J.; Trelease, R.N. Five Arabidopsis Peroxin 11 Homologs Individually Promote Peroxisome Elongation, Duplication or Aggregation. J. Cell Sci. 2006, 119, 1961–1972. [Google Scholar] [CrossRef][Green Version]
- Orth, T.; Reumann, S.; Zhang, X.; Fan, F.; Wenzel, D.; Quan, S.; Hu, J. The PEROXIN11 Protein Family Controls Peroxisome Proliferation in Arabidopsis. Plant Cell 2007, 19, 333–350. [Google Scholar] [CrossRef] [PubMed]
- Zhang, X.C.; Hu, J.P. FISSION1A and FISSION1B Proteins Mediate the Fission of Peroxisomes and Mitochondria in Arabidopsis. Mol. Plant 2008, 1, 1036–1047. [Google Scholar] [CrossRef] [PubMed]
- Zhang, X.; Hu, J. The Arabidopsis Chloroplast Division Protein DYNAMIN-RELATED PROTEIN5B Also Mediates Peroxisome Division. Plant Cell 2010, 22, 431–442. [Google Scholar] [CrossRef]
- Incarbone, M.; Zimmermann, A.; Hammann, P.; Erhardt, M.; Michel, F.; Dunoyer, P. Neutralization of Mobile Antiviral Small RNA through Peroxisomal Import. Nat. Plants 2017, 3, 17094. [Google Scholar] [CrossRef] [PubMed]
- Dodds, P.N.; Rathjen, J.P. Plant Immunity: Towards an Integrated View of Plant–Pathogen Interactions. Nat. Rev. Genet. 2010, 11, 539–548. [Google Scholar] [CrossRef]
- Zipfel, C. Plant Pattern-Recognition Receptors. Trends. Immunol. 2014, 35, 345–351. [Google Scholar] [CrossRef]
- Böhm, H.; Albert, I.; Fan, L.; Reinhard, A.; Nürnberger, T. Immune Receptor Complexes at the Plant Cell Surface. Curr. Opin. Plant Biol. 2014, 20, 47–54. [Google Scholar] [CrossRef]
- Jain, D.; Khurana, J.P. Role of Pathogenesis-Related (PR) Proteins in Plant Defense Mechanism. In Molecular Aspects of Plant-Pathogen Interaction; Singh, A., Singh, I., Eds.; Springer: Singapore, 2018; pp. 265–281. [Google Scholar] [CrossRef]
- Foyer, C.H.; Bloom, A.J.; Queval, G.; Noctor, G. Photorespiratory Metabolism: Genes, Mutants, Energetics, and Redox Signaling. Annu. Rev. Plant Biol. 2010, 60, 455–484. [Google Scholar] [CrossRef]
- Gupta, P.; Ravi, I.; Sharma, V. Induction of B-1,3-Glucanase and Chitinase Activity in the Defense Response of Eruca sativa Plants against the Fungal Pathogen Alternaria brassicicola. J. Plant Interact. 2013, 8, 155–161. [Google Scholar] [CrossRef]
- Mishchenko, L.T.; Dunich, A.A.; Mishchenko, I.A.; Petrenkova, V.P.; Mukha, T.I. Monitoring of Economically Important Wheat Viruses under Weather Conditions Change in Ukraine and Investigation of Seed Transmission of Wheat Streak Mosaic Virus. Bulg. J. Agri. Sci. 2018, 24, 660–669. [Google Scholar]
- Mishchenko, L.T.; Dunich, A.A.; Skrypkina, I.Y.; Kozub, N.O. Phylogenetic Analysis of Two Ukrainian Isolates of Wheat Streak Mosaic Virus. Biopolym. Cell 2019, 35, 64–77. [Google Scholar] [CrossRef]
- Singh, K.; Wegulo, S.N.; Skoracka, A.; Kundu, J.K. Wheat Streak Mosaic Virus: A Century Old Virus with Rising Importance Worldwide. Mol. Plant Pathol. 2018, 19, 2193–2206. [Google Scholar] [CrossRef] [PubMed]
- Kuźniak, E.; Kopczewski, T. The Chloroplast Reactive Oxygen Species-Redox System in Plant Immunity and Disease. Front. Plant Sci. 2020, 11, 572–686. [Google Scholar] [CrossRef] [PubMed]
- Jabeen, A.; Kiran, T.V.; Subrahmanyam, D.; Lakshmi, D.L.; Bhagyanarayana, G.; Krishnaveni, D. Variations in Chlorophyll and Carotenoid Contents in Tungro Infected Rice Plants. J. Res. Dev. 2017, 5, 1–7. [Google Scholar] [CrossRef]
- Pradhan, G.P.; Xue, Q.; Jessup, K.E.; Hao, B.; Price, J.A.; Rush, C.M. Physiological Responses of Hard Red Winter Wheat to Infection by Wheat Streak Mosaic Virus. Phytopathology 2015, 105, 621–627. [Google Scholar] [CrossRef]
- Fahy, D.; Sanad, M.N.; Duscha, K.; Lyons, M.; Liu, F.; Bozhkov, P.; Kunz, H.H.; Hu, J.; Neuhaus, H.E.; Steel, P.G.; et al. Impact of Salt Stress, Cell Death, and Autophagy on Peroxisomes: Quantitative and Morphological Analyses Using Small Fluorescent Probe N-BODIPY. Sci. Rep. 2017, 7, 39069. [Google Scholar] [CrossRef]
- Yang, Y.; Shah, J.; Klessig, D.F. Signal Perception and Transduction in Plant Defense Responses. Genes Dev. 1997, 11, 1621–1639. [Google Scholar] [CrossRef]
- Gechev, T.; Petrov, V. Reactive Oxygen Species and Abiotic Stress in Plants. Int. J. Mol. Sci. 2020, 21, 7433. [Google Scholar] [CrossRef]
- Künstler, A.; Hafez, Y.M.; Kiraly, L. Transient Suppression of a Catalase and an Alternative Oxidase Gene during Virus-Induced Local Lesion Formation (Hypersensitive Response) is Independent of the Extent of Leaf Necrotization. Acta Phytopathol. Entomol. Hung. 2007, 42, 185–196. [Google Scholar] [CrossRef]
- Bolouri-Moghaddam, M.R.; den Ende, W.V. Sugars and Plant Innate Immunity. J. Exp. Bot. 2012, 63, 3989–3998. [Google Scholar] [CrossRef]
- Arias, M.C.; Luna, C.; Rodriguez, M.; Lenardon, S.; Taleisnik, E. Sunflower Chlorotic Mottle Virus in Compatible Interactions with Sunflower: ROS Generation and Antioxidant Response. Eur. J. Plant Pathol. 2005, 113, 223–232. [Google Scholar] [CrossRef]
- Madhusudhan, K.N.; Srikanta, B.M.; Shylaja, M.D.; Prakash, H.S.; Shetty, H.S. Changes in Antioxidant Enzymes, Hydrogen Peroxide, Salicylic Acid and Oxidative Stress in Compatible and Incompatible Host-Tobamovirus Interaction. J. Plant Interact. 2009, 4, 157–166. [Google Scholar] [CrossRef]
- Zhu, F.; Zhu, P.-X.; Xu, F.; Che, Y.-P.; Ma, Y.-M.; Ji, Z.-L. Alpha-Momorcharin Enhances Nicotiana benthamiana Resistance to Tobacco Mosaic Virus Infection through Modulation of Reactive Oxygen Species. Mol. Plant Pathol. 2020, 21, 1212–1226. [Google Scholar] [CrossRef]
- Paulmann, M.K.; Kunert, G.; Zimmermann, M.R.; Theis, N.; Ludwig, A.; Meichsner, D.; Oelmüller, R.; Gershenzon, J.; Habekuss, A.; Ordon, F.; et al. Barley Yellow Dwarf Virus Infection Leads to Higher Chemical Defense Signals and Lower Electrophysiological Reactions in Susceptible Compared to Tolerant Barley Genotypes. Front. Plant Sci. 2018, 9, 145. [Google Scholar] [CrossRef]
- Fodor, J.; Hideg, E.; Kecskes, A.; Kiraly, Z. In Vivo Detection of Tobacco Mosaic Virus-Induced Local and Systemic Oxidative Burst by Electron Paramagnetic Resonance Spectroscopy. Plant Cell Physiol. 2001, 42, 775–779. [Google Scholar] [CrossRef][Green Version]
- Clarke, S.F.; Guy, P.L.; Burritt, D.J.; Jameson, P.E. Changes in the Activities of Antioxidant Enzymes in Response to Virus Infection and Hormone Treatment. Physiol. Plant. 2002, 114, 157–164. [Google Scholar] [CrossRef]
- Hernandez, J.A.; Díaz-Vivancosa, P.; Rubioa, M.; Olmosb, E.; Ros Barceló, A.; Martínez-Gómez, P. Long-Term Plum Pox Virus Infection Produces an Oxidative Stress in a Susceptible Apricot, Prunus armeniaca, Cultivar but Not in a Resistant Cultivar. Physiol. Plant. 2006, 126, 140–152. [Google Scholar] [CrossRef]
- Luthje, S.; Martinez-Cortes, T. Membrane-Bound Class III Peroxidases: Unexpected Enzymes with Exciting Functions. Int. J. Mol. Sci. 2018, 19, 2876. [Google Scholar] [CrossRef]
- Daudi, A.; Cheng, Z.; O’Brien, J.A.; Mammarella, N.; Khan, S.; Ausubel, F.M.; Bolwell, G.P. The Apoplastic Oxidative Burst Peroxidase in Arabidopsis is a Major Component of Pattern-Triggered Immunity. Plant Cell 2012, 24, 275–287. [Google Scholar] [CrossRef] [PubMed]
- Passardi, F.; Penel, C.; Dunand, C. Performing the Paradoxical: How Plant Peroxidases Modify the Cell Wall. Trends Plant Sci. 2004, 9, 534–540. [Google Scholar] [CrossRef] [PubMed]
- Fu, L.J.; Shi, K.; Gu, M.; Zhou, Y.H.; Dong, D.K. Systemic Induction and Role of Mitochondrial Alternative Oxidase and Nitric Oxide in a Compatible Tomato-Tobacco Mosaic Virus Interaction. Mol. Plant-Microbe Interact. 2010, 23, 39–48. [Google Scholar] [CrossRef] [PubMed]
- Durner, J.; Wendehenne, D.; Klessig, D.F. Defense Gene Induction in Tobacco by Nitric Oxide, Cyclic GMP, and Cyclic ADP-Ribose. Proc. Natl. Acad. Sci. USA 1998, 95, 10328–10333. [Google Scholar] [CrossRef]
- Liao, Y.W.K.; Sun, Z.H.; Zhou, Y.H.; Shi, K.; Li, X.; Zhang, G.Q.; Xia, X.J.; Chen, Z.X.; Yu, J.Q. The Role of Hydrogen Peroxide and Nitric Oxide in the Induction of Plant-Encoded RNA-Dependent RNA Polymerase 1 in the Basal Defense Against Tobacco Mosaic Virus. PLoS ONE 2013, 8, 76090. [Google Scholar] [CrossRef]
- Zou, L.J.; Deng, X.G.; Zhang, L.E.; Zhu, T.; Tan, W.R.; Muhammad, A.; Zhu, L.J.; Zhang, C.; Zhang, D.W.; Lin, H.H. Nitric Oxide as a Signaling Molecule in Brassinosteroid-Mediated Virus Resistance to Cucumber Mosaic Virus in Arabidopsis thaliana. Physiol. Plant. 2018, 163, 196–210. [Google Scholar] [CrossRef]
- Cao, N.; Zhan, B.; Zhou, X. Nitric Oxide as a Downstream Molecule in Brassinosteroid-Mediated Virus Suscebility to Maize Mottle Virus in Maize. Viruses 2019, 11, 368. [Google Scholar] [CrossRef]
- Boiko, A.L.; Silaeva, A.M.; Mishchenko, L.T.; Reshetnik, G.V. Peculiarities of Ultrastructural Organization of the Winter Wheat Mesophyll Cells under Conditions of Virus Infection. Tsitologiya I Genet. 1997, 31, 71–79. [Google Scholar]
- Reunov, A.V.; Lega, S.N.; Nagorskaia, V.P.; Lapshina, L.A. Observation of Cells Tolerant of Tobacco Mosaic Virus in Virus-Induced Local Lesions in Datura stramonium L. Leaves. Tsitologiia 2011, 53, 83–89. [Google Scholar]
- Sarkar, T.S.; Majumdar, U.; Roy, A.; Maiti, D.; Goswamy, A.M.; Bhattacharjee, A.; Subrata, K.G.; Ghosh, S. Production of Nitric Oxide in Host-Virus Interaction. A Case Study with a Compatible Begomovirus-Kenaf Host-Pathosystem. Plant Signal. Behav. 2010, 5, 668–676. [Google Scholar] [CrossRef]
- Palma, J.M.; Garrido, M.; Rodriguezgarcia, M.I.; Delrio, L.A. Peroxisome Proliferation and Oxidative Stress Mediated by Activated Oxygen Species in Plant Peroxisomes. Arch. Biochem. Biophys. 1991, 287, 68–74. [Google Scholar] [CrossRef]
- Jones, A.T.; Catherall, P.L. The Relationship between Growth Rate and the Expression of Tolerance to Barley Yellow Dwarf Virus in Barley. Ann. Appl. Biol. 1970, 65, 37–145. [Google Scholar] [CrossRef]
- Crosbie, E.S.; Matthews, R.E.F. Effects of TYMV Infection on Leaf Pigmentsin Brassica pekinensis Rupr. Physiol. Plant Pathol. 1974, 4, 379–387. [Google Scholar] [CrossRef]
- Jensen, S.G. Metabolism and Carbohydrate Composition in Barley Yellow Dwarf Virus-Infected Wheat. Phytopathology 1972, 62, 587–592. [Google Scholar] [CrossRef]
- Gonçalves, M.C.; Vega, J.; Oliveira, J.G.; Gomes, M.M.A. Sugarcane Yellow Leaf Virus Infection Leads to Alterations in Photosynthetic Efficiency and Carbohydrate Accumulation in Sugarcane Leaves. Fitopatol. Bras. 2005, 30, 10–16. [Google Scholar] [CrossRef]
- Choudhury, F.K.; Devireddy, A.R.; Azad, R.K.; Shulaev, V.; Mittler, R. Local and Systemic Metabolic Responses during Light-Induced Rapid Systemic Signaling. Plant Physiol. 2018, 178, 1461–1472. [Google Scholar] [CrossRef] [PubMed]
- Zanini, A.A.; Feo, L.D.; Luna, D.F.; Paccioretti, P.; Collavino, A.; Rodriguez, M.S. Cassava Common Mosaic Virus Infection Alterations in Chloroplast Ultrastructure and Carbohydrate Metabolism of Cassava Plants. Plant Pathol. 2021, 70, 195–205. [Google Scholar] [CrossRef]
- Xu, K.; Nagy, P.D. Dissecting Virus-Plant Interactions through Proteomics Approaches. Curr. Proteom. 2010, 7, 316–327. [Google Scholar] [CrossRef] [PubMed]
- Herbers, K.; Tacke, E.; Hazirezaei, M.; Krause, K.P.; Melzer, M.; Rohde, W.; Sonnewald, U. Expression of a Luteoviral Movement Protein in Transgenic Plants Leads to Carbohydrate Accumulation and Reduced Photo-Synthetic Capacity in Source Leaves. Plant J. 1997, 12, 1045–1056. [Google Scholar] [CrossRef] [PubMed]
- Watson, M.A.; Watson, D.J. The Effect of Infection with Beet Mosaic Viruses on the Carbohydrate Content of Sugar-Beet Leaves, and on Translocation. Ann. Appl. Biol. 1951, 38, 276–289. [Google Scholar] [CrossRef]
- Shalitin, D.; Wolf, S. Cucumber Mosaic Virus Infection Affects Sugar Transport in Melon Plants. Plant Physiol. 2000, 123, 597–604. [Google Scholar] [CrossRef] [PubMed]
- Tuazin, A.S.; Giardina, T. Sucrose and Invertases, a Part of the Plant Defense Response to the Biotic Stresses. Front. Plant Sci. 2014, 5, 293. [Google Scholar] [CrossRef] [PubMed]
- Solfanelli, C.; Poggi, A.; Loreti, E.; Alpi, A.; Perata, P. Sucrosespecific Induction of the Anthocyanin Biosynthetic Pathway in Arabidopsis. Plant Physiol. 2006, 140, 637–646. [Google Scholar] [CrossRef]
- Zavaliev, R.; Ueki, S.; Epel, B.L.; Citovsky, V. Biology of Callose (Beta-1,3-Glucan) Turnover at Plasmodesmata. Protoplasma 2011, 248, 117–130. [Google Scholar] [CrossRef] [PubMed]
- Moore, A.E.; Stone, B.A. Effect of Infection with TMV and Other Viruses on the Level of a Beta-1, 3-Glucan Hydrolase in Leaves of Nicotiana glutinosa. Virology 1972, 50, 791–798. [Google Scholar] [CrossRef]
- Ji, C.; Kuc, J. Purification and Characterization of an Acidic Beta-1, 3-Glucanase from Cucumber and Its Relationship to Systemic Disease Resistance Induced by Colletotrichum lagenarium and Tobacco Necrosis Virus. Mol. Plant-Microb. Interact. 1995, 8, 899–905. [Google Scholar] [CrossRef] [PubMed]
- Agudelo-Romero, P.; Carbonell, P.; de la Iglesia, F.; Carrera, J.; Rodrigo, G.; Jaramillo, A.; Perez-Amador, M.A.; Elena, S.F. Changes in the Gene Expression Profile of Arabidopsis thaliana After Infection with Tobacco Etch Virus. Virol. J. 2008, 5, 92. [Google Scholar] [CrossRef]
- Ascencio-Ibanez, J.T.; Sozzani, R.; Lee, T.J.; Chu, T.M.; Wolfinger, R.D.; Cella, R.; Hanley-Bowdoin, L. Global Analysis of Arabidopsis Gene Expression Uncovers a Complex Array of Changes Impacting Pathogen Response and Cell Cycle during Geminivirus Infection. Plant Physiol. 2008, 148, 436–454. [Google Scholar] [CrossRef]
- Babu, M.; Griffiths, J.S.; Huang, T.S.; Wang, A. Altered Gene Expression Changes in Arabidopsis Leaf Tissues and Protoplasts in Response to Plum pox Virus Infection. BMC Genom. 2008, 9, 325. [Google Scholar] [CrossRef]
- Dobnik, D.; Baebler, S.; Kogovšek, P.; Pompe-Novak, M.; Štebih, D.; Panter, G.; Janež, N.; Morisset, D.; Žel, J.; Gruden, K. β-1,3-Glucanase Class III Promotes Spread of PVYNTN and Improves in Planta Protein Production. Plant Biotechnol. Rep. 2013, 7, 547–555. [Google Scholar] [CrossRef]
- Iglesias, V.A.; Meins Jr., F. Movement of Plant Viruses Is Delayed in a β-1, 3-Glucanase-Deficient Mutant Showing a Reduced Plasmodesmatal Size Exclusion Limit and Enhanced Callose Deposition. Plant J. 2000, 21, 157–166. [Google Scholar] [CrossRef]
- Lusso, M.; Kuc, J. Increased Activities of Ribonuclease and Protease After Challenge in Tobacco Plants with Induced Systemic Resistance. Physiol. Mol. Plant Pathol. 1995, 47, 419–428. [Google Scholar] [CrossRef]
- Wu, S.; Wang, H.; Yang, Z.; Kong, L. Expression Comparisons of Pathogenesis-Related (PR) Genes in Wheat in Response to Infection/Infestation by Fusarium, Yellow Dwarf Virus (YDV) Aphid-Transmitted and Hessian Fly. J. Integr. Agric. 2014, 13, 926–936. [Google Scholar] [CrossRef]
- Crowther, J.R. ELISA: Theory and Practice; Humana Press: New York, NY, USA, 1995; p. 218. [Google Scholar]
- Sanad, M.N.M.E.; Smertenko, A.; Garland-Campbell, K.A. Differential Dynamic Changes of Reduced Trait Model for Analyzing the Plastic Response to Drought Phases: A Case Study in Spring Wheat. Front. Plant Sci. 2019, 10, 504. [Google Scholar] [CrossRef] [PubMed]
- Giménez, M.J.; Pistón, F.; Atienza, S.G. Identification of Suitable Reference Genes for Normalization of qPCR Data in Comparative Transcriptomics Analyses in the Triticeae. Planta 2011, 233, 163–173. [Google Scholar] [CrossRef]
- Kjeldahl, J. A New Method for the Determination of Nitrogen in Organic Substances. Z. Für Anal. Chem. 1983, 22, 366–383. [Google Scholar] [CrossRef]
- Hedge, J.E.; Hofreiter, B.T. Carbohydrates. In Methods in Carbohydrate Chemistry; Whistler, R.L., Be Miller, J.N., Eds.; Academic Press: New York, NY, USA, 1962; pp. 17–22. [Google Scholar]
- Dashek, W.V.; Miglani, G.S. Vacuoles and Protein Bodies. In Plant Cells and Their Organelles; Dashek, W.V., Miglani, G.S., Eds.; John Wiley & Sons Ltd.: Hoboken, NJ, USA, 2017; pp. 351–370. [Google Scholar] [CrossRef]
- Chepel, V.; Lisun, V.; Skrypnik, L. Changes in the Content of Some Groups of Phenolic Compounds and Biological Activity of Extracts of Various Parts of Heather (Calluna vulgaris (L.) Hull) at Different Growth Stages. Plants 2020, 9, 926. [Google Scholar] [CrossRef] [PubMed]
- Aebi, H. Catalase In Vitro. Methods Enzym. 1984, 105, 121–126. [Google Scholar] [CrossRef]
- Onsa, G.H.; Saari, N.; Selamat, J.; Bakar, J. Purification and Characterization of Membrane-Bound Peroxidases from Metroxylon sagu. Food Chem. 2004, 85, 365–376. [Google Scholar] [CrossRef]
- Rotruck, T.T.; Ganther, H.E.; Swanson, A.B.; Hafeman, D.G.; Hoeckstra, W.G. Selenium: Biochemical Role as a Component of Glutathione Peroxidase. Science 1973, 179, 588–590. [Google Scholar] [CrossRef]
- Nakano, Y.; Asada, K. Hydrogen Peroxide is Scavenged by Ascorbate Specific Peroxidase in Spinach Chloroplasts. Plant Cell Physiol. 1981, 22, 867–880. [Google Scholar] [CrossRef]
- Hu, M.L. Measurement of Protein Thiol Groups and Glutathione in Plasma. Methods Enzym. 1994, 233, 380–385. [Google Scholar] [CrossRef]
- Hodges, D.M.; De Long, J.M.; Forney, C.F.; Prange, R.K. Improving the Thiobarbituric Acid-Reactive-Substances Assay for Estimating Lipid Peroxidation in Plant Tissues Containing Anthocyanin and Other Interfering Compounds. Planta 1999, 207, 604–611. [Google Scholar] [CrossRef]
- Zhou, B.; Guo, Z.; Xing, J.; Huang, B. Nitric Oxide is Involved in Abscisic Acid-Induced Antioxidant Activities in Stylosanthes guianensis. J. Exp. Bot. 2005, 56, 3223–3228. [Google Scholar] [CrossRef] [PubMed]
Gene Name | Forward Primer | Reverse Primer |
---|---|---|
WSMV | TGCGGAACTTATCGACAACA | AATCACACGCTGCCACAATA |
PEX11-A | CGCTAGGGGACGTGACTAA | CAGCGCCGACAGCAATC |
PEX11-B | CAACCCGTTCTGCAACCAC | TTCCTATACCACCCAGCCCA |
PEXX11-C | GAAGAACGCGATGCTGTCAA | TAAAAGGCAATCCTGCCAAG |
DRP-3A | GACCTGCGGAGACAATGATAAC | GTTGGTCCTCTCGAAGATAGA |
DRP-3B | TGGACGAGATACCGCTTGAA | CACTGAAAGGTTGTTGCTGC |
FIS-1A | TCCAAGCAGACTGATGATGTG | TGGGCTGGTGGTTTTATCAAGA |
Rnase L Inhibitor Like Protein (RLI) | CGATTCAGAGCAGCGTATTGTTG | AGTTGGTCGGGTCTCTTCTAAATG |
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations. |
© 2021 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Mishchenko, L.; Nazarov, T.; Dunich, A.; Mishchenko, I.; Ryshchakova, O.; Motsnyi, I.; Dashchenko, A.; Bezkrovna, L.; Fanin, Y.; Molodchenkova, O.; et al. Impact of Wheat Streak Mosaic Virus on Peroxisome Proliferation, Redox Reactions, and Resistance Responses in Wheat. Int. J. Mol. Sci. 2021, 22, 10218. https://doi.org/10.3390/ijms221910218
Mishchenko L, Nazarov T, Dunich A, Mishchenko I, Ryshchakova O, Motsnyi I, Dashchenko A, Bezkrovna L, Fanin Y, Molodchenkova O, et al. Impact of Wheat Streak Mosaic Virus on Peroxisome Proliferation, Redox Reactions, and Resistance Responses in Wheat. International Journal of Molecular Sciences. 2021; 22(19):10218. https://doi.org/10.3390/ijms221910218
Chicago/Turabian StyleMishchenko, Lidiya, Taras Nazarov, Alina Dunich, Ivan Mishchenko, Olga Ryshchakova, Ivan Motsnyi, Anna Dashchenko, Lidiya Bezkrovna, Yaroslav Fanin, Olga Molodchenkova, and et al. 2021. "Impact of Wheat Streak Mosaic Virus on Peroxisome Proliferation, Redox Reactions, and Resistance Responses in Wheat" International Journal of Molecular Sciences 22, no. 19: 10218. https://doi.org/10.3390/ijms221910218
APA StyleMishchenko, L., Nazarov, T., Dunich, A., Mishchenko, I., Ryshchakova, O., Motsnyi, I., Dashchenko, A., Bezkrovna, L., Fanin, Y., Molodchenkova, O., & Smertenko, A. (2021). Impact of Wheat Streak Mosaic Virus on Peroxisome Proliferation, Redox Reactions, and Resistance Responses in Wheat. International Journal of Molecular Sciences, 22(19), 10218. https://doi.org/10.3390/ijms221910218