Platelet-Released Growth Factors Induce Genes Involved in Extracellular Matrix Formation in Human Fibroblasts
Abstract
:1. Introduction
2. Results
2.1. PRGF Mediates the Induction of ECM-Associated Factors in Human Primary Fibroblasts
2.2. The PRGF-Mediated Induction of ECM-Related Genes in PRGF-Treated Fibroblasts Is Time-Dependent
2.3. The PRGF-Mediated Induction of ECM-Related Factors in Human Fibroblasts Is Influenced by the Epidermal Growth Factor Receptor (EGFR)
2.4. PRGF Induces ECM-Related Factors in Ex Vivo Skin Explants
2.5. PRGF Treatment Induced Proliferation and Migration of Primary Human Fibroblasts
3. Discussion
3.1. TGFBI
3.2. FN1
3.3. MMP9
3.4. TGM2
3.5. FERMT1
3.6. COL1A1
3.7. ADAM19
3.8. SERPINE1
3.9. LOXL3
4. Material and Methods
4.1. Preparation of PRGF
4.2. Culture and Stimulation of Primary Human Fibroblasts
4.3. Real-Time PCR
4.4. Enzyme-Linked Immunosorbent Assay (ELISA) Analysis
4.5. Scratch Assay
4.6. Expression Analysis of ECM-Related Genes in Ex Vivo Skin Explants
4.7. Whole Transcriptome Sequencing (RNA-Seq)
4.8. Statistics
Supplementary Materials
Author Contributions
Funding
Acknowledgments
Conflicts of Interest
References
- Etulain, J. Platelets in wound healing and regenerative medicine. Platelets 2018, 29, 556–568. [Google Scholar] [CrossRef] [PubMed]
- Anitua, E.; Andia, I.; Ardanza, B.; Nurden, P.; Nurden, A.T. Autologous platelets as a source of proteins for healing and tissue regeneration. Thromb. Haemost. 2004, 91, 4–15. [Google Scholar] [CrossRef]
- Steenvoorde, P.; van Doorn, L.P.; Naves, C.; Oskam, J. Use of autologous platelet-rich fibrin on hard-to-heal wounds. J. Wound Care 2008, 17, 60–63. [Google Scholar] [CrossRef]
- Bayer, A.; Höntsch, G.; Kaschwich, M.; Dell, A.; Siggelkow, M.; Berndt, R.; Rusch, R.; Harder, J.; Gläser, R.; Cremer, J. Vivostat Platelet-Rich Fibrin® for Complicated or Chronic Wounds-A Pilot Study. Biomedicines 2020, 8, 276. [Google Scholar] [CrossRef]
- Bayer, A.; Lammel, J.; Rademacher, F.; Groß, J.; Siggelkow, M.; Lippross, S.; Klüter, T.; Varoga, D.; Tohidnezhad, M.; Pufe, T.; et al. Platelet-released growth factors induce the antimicrobial peptide human beta-defensin-2 in primary keratinocytes. Exp. Dermatol. 2016. [Google Scholar] [CrossRef]
- Bayer, A.; Lammel, J.; Tohidnezhad, M.; Lippross, S.; Behrendt, P.; Klüter, T.; Pufe, T.; Cremer, J.; Jahr, H.; Rademacher, F.; et al. The Antimicrobial Peptide Human Beta-Defensin-3 Is Induced by Platelet-Released Growth Factors in Primary Keratinocytes. Mediat. Inflamm. 2017, 2017, 6157491. [Google Scholar] [CrossRef] [Green Version]
- Bayer, A.; Lammel, J.; Lippross, S.; Klüter, T.; Behrendt, P.; Tohidnezhad, M.; Pufe, T.; Cremer, J.; Jahr, H.; Rademacher, F.; et al. Platelet-released growth factors induce psoriasin in keratinocytes: Implications for the cutaneous barrier. Ann. Anat. Anat. Anz. Off. Organ Anat. Ges. 2017, 213, 25–32. [Google Scholar] [CrossRef] [PubMed]
- Bayer, A.; Tohidnezhad, M.; Lammel, J.; Lippross, S.; Behrendt, P.; Klüter, T.; Pufe, T.; Jahr, H.; Cremer, J.; Rademacher, F.; et al. Platelet-Released Growth Factors Induce Differentiation of Primary Keratinocytes. Mediat. Inflamm. 2017, 2017, 5671615. [Google Scholar] [CrossRef] [PubMed]
- Bayer, A.; Tohidnezhad, M.; Berndt, R.; Lippross, S.; Behrendt, P.; Klüter, T.; Pufe, T.; Jahr, H.; Cremer, J.; Rademacher, F.; et al. Platelet-released growth factors inhibit proliferation of primary keratinocytes in vitro. Ann. Anat. 2018, 215, 1–7. [Google Scholar] [CrossRef] [PubMed]
- Bayer, A.; Wijaya, B.; Möbus, L.; Rademacher, F.; Rodewald, M.; Tohidnezhad, M.; Pufe, T.; Drücke, D.; Gläser, R.; Harder, J. Platelet-Released Growth Factors and Platelet-Rich Fibrin Induce Expression of Factors Involved in Extracellular Matrix Organization in Human Keratinocytes. Int. J. Mol. Sci. 2020, 21, 4404. [Google Scholar] [CrossRef]
- Anitua, E.; Aguirre, J.J.; Algorta, J.; Ayerdi, E.; Cabezas, A.I.; Orive, G.; Andia, I. Effectiveness of autologous preparation rich in growth factors for the treatment of chronic cutaneous ulcers. J. Biomed. Mater. Res. Part B Appl. Biomater. 2008, 84, 415–421. [Google Scholar] [CrossRef]
- Orcajo, B.; Muruzabal, F.; Isasmendi, M.C.; Gutierrez, N.; Sánchez, M.; Orive, G.; Anitua, E. The use of plasma rich in growth factors (PRGF-Endoret) in the treatment of a severe mal perforant ulcer in the foot of a person with diabetes. Diabetes Res. Clin. Pract. 2011, 93, e65–e67. [Google Scholar] [CrossRef] [PubMed]
- Skonier, J.; Bennett, K.; Rothwell, V.; Kosowski, S.; Plowman, G.; Wallace, P.; Edelhoff, S.; Disteche, C.; Neubauer, M.; Marquardt, H.; et al. beta ig-h3: A transforming growth factor-beta-responsive gene encoding a secreted protein that inhibits cell attachment in vitro and suppresses the growth of CHO cells in nude mice. DNA Cell Biol. 1994, 13, 571–584. [Google Scholar] [CrossRef]
- Bae, J.-S.; Lee, S.-H.; Kim, J.-E.; Choi, J.-Y.; Park, R.-W.; Yong Park, J.; Park, H.-S.; Sohn, Y.-S.; Lee, D.-S.; Bae Lee, E.; et al. βig-h3 supports keratinocyte adhesion, migration, and proliferation through α3β1 integrin. Biochem. Biophys. Res. Commun. 2002, 294, 940–948. [Google Scholar] [CrossRef]
- Ween, M.P.; Oehler, M.K.; Ricciardelli, C. Transforming Growth Factor-Beta-Induced Protein (TGFBI)/(βig-H3): A Matrix Protein with Dual Functions in Ovarian Cancer. Int. J. Mol. Sci. 2012, 13, 10461–10477. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Aitkenhead, M.; Wang, S.-J.; Nakatsu, M.N.; Mestas, J.; Heard, C.; Hughes, C.C.W. Identification of Endothelial Cell Genes Expressed in an in Vitro Model of Angiogenesis: Induction of ESM-1, βig-h3, and NrCAM. Microvasc. Res. 2002, 63, 159–171. [Google Scholar] [CrossRef] [PubMed]
- Maeng, Y.-S.; Lee, G.-H.; Lee, B.; Choi, S.-I.; Kim, T.; Kim, E.K. Role of TGFBIp in Wound Healing and Mucin Expression in Corneal Epithelial Cells. Yonsei Med. J. 2017, 58, 423. [Google Scholar] [CrossRef] [PubMed]
- Cha, J.; Kwak, T.; Butmarc, J.; Kim, T.-A.; Yufit, T.; Carson, P.; Kim, S.-J.; Falanga, V. Fibroblasts from non-healing human chronic wounds show decreased expression of βig-h3, a TGF-β inducible protein. J. Dermatol. Sci. 2008, 50, 15–23. [Google Scholar] [CrossRef]
- Thapa, N.; Lee, B.-H.; Kim, I.-S. TGFBIp/βig-h3 protein: A versatile matrix molecule induced by TGF-β. Int. J. Biochem. Cell Biol. 2007, 39, 2183–2194. [Google Scholar] [CrossRef]
- Etich, J.; Koch, M.; Wagener, R.; Zaucke, F.; Fabri, M.; Brachvogel, B. Gene Expression Profiling of the Extracellular Matrix Signature in Macrophages of Different Activation Status: Relevance for Skin Wound Healing. Int. J. Mol. Sci. 2019, 20, 5086. [Google Scholar] [CrossRef] [Green Version]
- Halper, J.; Kjaer, M. Basic Components of Connective Tissues and Extracellular Matrix: Elastin, Fibrillin, Fibulins, Fibrinogen, Fibronectin, Laminin, Tenascins and Thrombospondins. In Advances in Experimental Medicine and Aiology, Progress in Heritable Soft Connective Tissue Diseases; Springer: Berlin/Heidelberg, Germany, 2014; Volume 802, pp. 31–47. [Google Scholar]
- Stoffels, J.M.J.; Zhao, C.; Baron, W. Fibronectin in tissue regeneration: Timely disassembly of the scaffold is necessary to complete the build. Cell. Mol. Life Sci. 2013, 70, 4243–4253. [Google Scholar] [CrossRef]
- Larsen, M.; Artym, V.V.; Green, J.A.; Yamada, K.M. The matrix reorganized: Extracellular matrix remodeling and integrin signaling. Curr. Opin. Cell Biol. 2006, 18, 463–471. [Google Scholar] [CrossRef]
- Larivière, B.; Rouleau, M.; Picard, S.; Beaulieu, A.D. Human plasma fibronectin potentiates the mitogenic activity of platelet-derived growth factor and complements its wound healing effects. Wound Rep. Reg. 2003, 11, 79–89. [Google Scholar] [CrossRef]
- Clark, R.A.F. Regulation of Fibroplasia in Cutaneous Wound Repair. Am. J. Med. Sci. 1993, 306, 42–48. [Google Scholar] [CrossRef]
- Tonnesen, M.G.; Feng, X.; Clark, R.A.F. Angiogenesis in Wound Healing. J. Investig. Dermatol. Symp. Proc. 2000, 5, 40–46. [Google Scholar] [CrossRef] [Green Version]
- Clark, R.A.F. Fibronectin Matrix Deposition and Fibronectin Receptor Expression in Healing and Normal Skin. J. Investig. Dermatol. 1990, 94, s128–s134. [Google Scholar] [CrossRef] [Green Version]
- Brotchie, H.; Wakefield, D. Fibronectin: Tructure, function and significance in wound healing. Australas. J. Dermatol. 1990, 31, 47–56. [Google Scholar] [CrossRef]
- Clark, R.A. Potential roles of fibronectin in cutaneous wound repair. Arch. Dermatol. 1988, 124, 201–206. [Google Scholar] [CrossRef]
- Igisu, K. The role of fibronectin in the process of wound healing. Thromb. Res. 1986, 44, 455–465. [Google Scholar] [CrossRef]
- Grinnell, F. Fibronectin and wound healing. J. Cell. Biochem. 1984, 26, 107–116. [Google Scholar] [CrossRef]
- Wysocki, A.B. Fibronectin in acute and chronic wounds. J. ET Nurs. 1992, 19, 166–170. [Google Scholar] [PubMed]
- Huang, H. Matrix Metalloproteinase-9 (MMP-9) as a Cancer Biomarker and MMP-9 Biosensors: Recent Advances. Sensors 2018, 18, 3249. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Mohan, R.; Chintala, S.K.; Jung, J.C.; Villar, W.V.L.; McCabe, F.; Russo, L.A.; Lee, Y.; McCarthy, B.E.; Wollenberg, K.R.; Jester, J.V.; et al. Matrix Metalloproteinase Gelatinase B (MMP-9) Coordinates and Effects Epithelial Regeneration. J. Biol. Chem. 2002, 277, 2065–2072. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Salo, T.; Mäkelä, M.; Kylmäniemi, M.; Autio-Harmainen, H.; Larjava, H. Expression of matrix metalloproteinase-2 and -9 during early human wound healing. Lab. Investig. A J. Tech. Methods Pathol. 1994, 70, 176–182. [Google Scholar]
- Vandooren, J.; Van den Steen, P.E.; Opdenakker, G. Biochemistry and molecular biology of gelatinase B or matrix metalloproteinase-9 (MMP-9): The next decade. Crit. Rev. Biochem. Mol. Biol. 2013, 48, 222–272. [Google Scholar] [CrossRef] [PubMed]
- Nurminskaya, M.V.; Belkin, A.M. Cellular Functions of Tissue Transglutaminase. In International Review of Cell and Molecular Biology; Elsevier: Amsterdam, The Netherlands, 2012; Volume 294, pp. 1–97. [Google Scholar]
- Greenberg, C.; Greenberg, C.S. TGM2 and implications for human disease: Role of alternative splicing. Front. Biosci. 2013, 18, 504. [Google Scholar] [CrossRef] [Green Version]
- Odii, B.O.; Coussons, P. Biological Functionalities of Transglutaminase 2 and the Possibility of Its Compensation by Other Members of the Transglutaminase Family. Sci. World J. 2014, 2014, 714561. [Google Scholar] [CrossRef] [Green Version]
- Lee, C.S.; Park, H.H. Structural aspects of transglutaminase 2: Functional, structural, and regulatory diversity. Apoptosis 2017, 22, 1057–1068. [Google Scholar] [CrossRef]
- Verderio, E.A.M.; Johnson, T.; Griffin, M. Tissue transglutaminase in normal and abnormal wound healing: Review article. Amino Acids 2004, 26, 387–404. [Google Scholar] [CrossRef]
- Stephens, P.; Grenard, P.; Aeschlimann, P.; Langley, M.; Blain, E.; Errington, R.; Kipling, D.; Thomas, D.; Aeschlimann, D. Crosslinking and G-protein functions of transglutaminase 2 contribute differentially to fibroblast wound healing responses. J. Cell Sci. 2004, 117, 3389–3403. [Google Scholar] [CrossRef] [Green Version]
- Telci, D.; Griffin, M. Tissue transglutaminase (TG2)—A wound response enzyme. Front. Biosci. 2006, 11, 867. [Google Scholar] [CrossRef] [Green Version]
- Akimov, S.S.; Krylov, D.; Fleischman, L.F.; Belkin, A.M. Tissue Transglutaminase Is an Integrin-Binding Adhesion Coreceptor for Fibronectin. J. Cell Biol. 2000, 148, 825–838. [Google Scholar] [CrossRef] [Green Version]
- Wang, Z.; Perez, M.; Lee, E.-S.; Kojima, S.; Griffin, M. The functional relationship between transglutaminase 2 and transforming growth factor β1 in the regulation of angiogenesis and endothelial–mesenchymal transition. Cell Death Dis. 2017, 8, e3032. [Google Scholar] [CrossRef] [Green Version]
- Rognoni, E.; Widmaier, M.; Jakobson, M.; Ruppert, R.; Ussar, S.; Katsougkri, D.; Böttcher, R.T.; Lai-Cheong, J.E.; Rifkin, D.B.; McGrath, J.A.; et al. Kindlin-1 controls Wnt and TGF-β availability to regulate cutaneous stem cell proliferation. Nat. Med. 2014, 20, 350–359. [Google Scholar] [CrossRef] [Green Version]
- Shen, C.; Sun, L.; Zhu, N.; Qi, F. Kindlin-1 contributes to EGF-induced re-epithelialization in skin wound healing. Int. J. Mol. Med. 2017, 39, 949–959. [Google Scholar] [CrossRef] [Green Version]
- Rognoni, E.; Ruppert, R.; Fässler, R. The kindlin family: Functions, signaling properties and implications for human disease. J. Cell Sci. 2016, 129, 17–27. [Google Scholar] [CrossRef] [Green Version]
- Michael, M.; Begum, R.; Chan, G.K.; Whitewood, A.J.; Matthews, D.R.; Goult, B.T.; McGrath, J.A.; Parsons, M. Kindlin-1 Regulates Epidermal Growth Factor Receptor Signaling. J. Investig. Dermatol. 2019, 139, 369–379. [Google Scholar] [CrossRef]
- Ussar, S.; Moser, M.; Widmaier, M.; Rognoni, E.; Harrer, C.; Genzel-Boroviczeny, O.; Fässler, R. Loss of Kindlin-1 Causes Skin Atrophy and Lethal Neonatal Intestinal Epithelial Dysfunction. PLoS Genet. 2008, 4, e1000289. [Google Scholar] [CrossRef] [Green Version]
- Wong, H.H.; Seet, S.H.; Bascom, C.C.; Isfort, R.J.; Bard, F. Red-COLA1: A human fibroblast reporter cell line for type I collagen transcription. Sci. Rep. 2020, 10, 19723. [Google Scholar] [CrossRef]
- Worthen, C.A.; Cui, Y.; Orringer, J.S.; Johnson, T.M.; Voorhees, J.J.; Fisher, G.J. CD26 Identifies a Subpopulation of Fibroblasts that Produce the Majority of Collagen during Wound Healing in Human Skin. J. Investig. Dermatol. 2020, 140, 2515–2524.e3. [Google Scholar] [CrossRef]
- Anitua, E.; Pino, A.; Orive, G. Plasma rich in growth factors promotes dermal fibroblast proliferation, migration and biosynthetic activity. J. Wound Care 2016, 25, 680–687. [Google Scholar] [CrossRef]
- Qi, B.; Newcomer, R.G.; Sang, Q.-X.A. ADAM19/adamalysin 19 structure, function, and role as a putative target in tumors and inflammatory diseases. Curr. Pharm. Des. 2009, 15, 2336–2348. [Google Scholar] [CrossRef]
- Chesneau, V.; Becherer, J.D.; Zheng, Y.; Erdjument-Bromage, H.; Tempst, P.; Blobel, C.P. Catalytic properties of ADAM19. J. Biol. Chem. 2003, 278, 22331–22340. [Google Scholar] [CrossRef] [Green Version]
- Rabieian, R.; Boshtam, M.; Zareei, M.; Kouhpayeh, S.; Masoudifar, A.; Mirzaei, H. Plasminogen Activator Inhibitor Type-1 as a Regulator of Fibrosis. J. Cell. Biochem. 2018, 119, 17–27. [Google Scholar] [CrossRef]
- Ghosh, A.K.; Vaughan, D.E. PAI-1 in tissue fibrosis. J. Cell. Physiol. 2012, 227, 493–507. [Google Scholar] [CrossRef] [Green Version]
- Providence, K.M.; Higgins, S.P.; Mullen, A.; Battista, A.; Samarakoon, R.; Higgins, C.E.; Wilkins-Port, C.E.; Higgins, P.J. SERPINE1 (PAI-1) is deposited into keratinocyte migration "trails" and required for optimal monolayer wound repair. Arch. Dermatol. Res. 2008, 300, 303–310. [Google Scholar] [CrossRef] [Green Version]
- Li, F.; Goncalves, J.; Faughnan, K.; Steiner, M.G.; Pagan-Charry, I.; Esposito, D.; Chin, B.; Providence, K.M.; Higgins, P.J.; Staiano-Coico, L. Targeted inhibition of wound-induced PAI-1 expression alters migration and differentiation in human epidermal keratinocytes. Exp. Cell Res. 2000, 258, 245–253. [Google Scholar] [CrossRef]
- Providence, K.M.; Higgins, P.J. PAI-1 expression is required for epithelial cell migration in two distinct phases of in vitro wound repair. J. Cell. Physiol. 2004, 200, 297–308. [Google Scholar] [CrossRef]
- De Laurentino, T.S.; da Soares, R.S.; Marie, S.K.N.; Oba-Shinjo, S.M. LOXL3 Function Beyond Amino Oxidase and Role in Pathologies, Including Cancer. Int. J. Mol. Sci. 2019, 20, 3587. [Google Scholar] [CrossRef] [Green Version]
- Lee, J.-E.; Kim, Y. A tissue-specific variant of the human lysyl oxidase-like protein 3 (LOXL3) functions as an amine oxidase with substrate specificity. J. Biol. Chem. 2006, 281, 37282–37290. [Google Scholar] [CrossRef] [Green Version]
- Olczyk, P.; Mencner, Ł.; Komosinska-Vassev, K. The role of the extracellular matrix components in cutaneous wound healing. BioMed Res. Int. 2014, 2014, 747584. [Google Scholar] [CrossRef] [Green Version]
- Xue, M.; Jackson, C.J. Extracellular Matrix Reorganization During Wound Healing and Its Impact on Abnormal Scarring. Adv. Wound Care 2015, 4, 119–136. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Yazawa, M.; Ogata, H.; Nakajima, T.; Mori, T.; Watanabe, N.; Handa, M. Basic studies on the clinical applications of platelet-rich plasma. Cell Transplant. 2003, 12, 509–518. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Ågren, M.S.; Rasmussen, K.; Pakkenberg, B.; Jørgensen, B. Growth factor and proteinase profile of Vivostat ® platelet-rich fibrin linked to tissue repair. Vox Sang. 2014, 107, 37–43. [Google Scholar] [CrossRef]
- Weibric, G.; Buch, R.S.R.; Kleis, W.K.G.; Hafner, G.; Hitzler, W.E.; Wagner, W. Quantification of thrombocyte growth factors in platelet concentrates produced by discontinuous cell separation. Growth Factors 2002, 20, 93–97. [Google Scholar] [CrossRef]
- Anitua, E.; Sánchez, M.; Zalduendo, M.M.; de la Fuente, M.; Prado, R.; Orive, G.; Andía, I. Fibroblastic response to treatment with different preparations rich in growth factors. Cell Prolif. 2009, 42, 162–170. [Google Scholar] [CrossRef]
- Roth, S.A.; Simanski, M.; Rademacher, F.; Schröder, L.; Harder, J. The pattern recognition receptor NOD2 mediates Staphylococcus aureus-induced IL-17C expression in keratinocytes. J. Investig. Dermatol. 2014, 134, 374–380. [Google Scholar] [CrossRef] [Green Version]
- Kim, D.; Pertea, G.; Trapnell, C.; Pimentel, H.; Kelley, R.; Salzberg, S.L. TopHat2: Accurate alignment of transcriptomes in the presence of insertions, deletions and gene fusions. Genome Biol. 2013, 14, R36. [Google Scholar] [CrossRef] [Green Version]
- Langmead, B.; Salzberg, S.L. Fast gapped-read alignment with Bowtie 2. Nat. Methods 2012, 9, 357–359. [Google Scholar] [CrossRef] [Green Version]
- Li, H.; Handsaker, B.; Wysoker, A.; Fennell, T.; Ruan, J.; Homer, N.; Marth, G.; Abecasis, G.; Durbin, R. 1000 Genome Project Data Processing Subgroup The Sequence Alignment/Map format and SAMtools. Bioinformatics 2009, 25, 2078–2079. [Google Scholar] [CrossRef] [Green Version]
- Anders, S.; Pyl, P.T.; Huber, W. HTSeq-a Python framework to work with high-throughput sequencing data. Bioinformatics 2015, 31, 166–169. [Google Scholar] [CrossRef]
- Love, M.I.; Huber, W.; Anders, S. Moderated estimation of fold change and dispersion for RNA-seq data with DESeq2. Genome Biol. 2014, 15, 550. [Google Scholar] [CrossRef] [Green Version]
- Zhu, A.; Ibrahim, J.G.; Love, M.I. Heavy-tailed prior distributions for sequence count data: Removing the noise and preserving large differences. Bioinformatics 2019, 35, 2084–2092. [Google Scholar] [CrossRef]
- Yu, G.; Wang, L.-G.; Han, Y.; He, Q.-Y. clusterProfiler: An R package for comparing biological themes among gene clusters. Omics A J. Integr. Biol. 2012, 16, 284–287. [Google Scholar] [CrossRef] [PubMed]
- Ashburner, M.; Ball, C.A.; Blake, J.A.; Botstein, D.; Butler, H.; Cherry, J.M.; Davis, A.P.; Dolinski, K.; Dwight, S.S.; Eppig, J.T.; et al. Gene ontology: Tool for the unification of biology. The Gene Ontology Consortium. Nat. Genet. 2000, 25, 25–29. [Google Scholar] [CrossRef] [Green Version]
Gene | Forward Primer | Reverse Primer |
---|---|---|
Transforming Growth Factor Beta Induced, TGFBI | ACCCAGAAGCCCTGAGAG | TGCAGCCCACCTCCAGTG |
Fibronectin 1, FN1 | ACAACGTCATAGTGGAGGCA | CATCCGTAGGTTGGTTCAAG |
Matrix Metalloproteinase 9, MMP9 | GACACGCACGACGTCTTCCA | CACTGCAGGATGTCATAGGTCA |
Transglutaminase 2, TGM2 | CTCAACCTGGAGCCTTTCTC | AGGGCCCGCACCTTGATGA |
Fermitin Family Member 1, FERMT1 | GATTCCAGTGACAACATGGAG | TCAAACTCGATGACCACCTG |
Lysyl Oxidase Like 3, LOXL3 | TACAGCGAGCTGGTGAATGG | CAGATGCGGCCTGTTCCA |
A Disintegrin And Metallo-proteinase 19, ADAM19 | GCAATGCCTCTAATTGTACCCTG | GAGCCAACAGCTTACACTGG |
Serpin Family E Member 1, SERPINE1 | CCTGGTTCTGCCCAAGTTCT | CGTGGAGAGGCTCTTGGT |
Ki67 | TGACTTCCTTCCATTCTGAAGAC | TGGGTCTGTTATTGATGAGCC |
Ribosomal protein L38, RPL38 | TCAAGGACTTCCTGCTCACA | AAAGGTATCTGCTGCATCGAA |
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations. |
© 2021 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Bayer, A.; Wijaya, B.; Rademacher, F.; Möbus, L.; Preuß, M.; Singh, M.; Tohidnezhad, M.; Kubo, Y.; Rodewald, M.; Behrendt, P.; et al. Platelet-Released Growth Factors Induce Genes Involved in Extracellular Matrix Formation in Human Fibroblasts. Int. J. Mol. Sci. 2021, 22, 10536. https://doi.org/10.3390/ijms221910536
Bayer A, Wijaya B, Rademacher F, Möbus L, Preuß M, Singh M, Tohidnezhad M, Kubo Y, Rodewald M, Behrendt P, et al. Platelet-Released Growth Factors Induce Genes Involved in Extracellular Matrix Formation in Human Fibroblasts. International Journal of Molecular Sciences. 2021; 22(19):10536. https://doi.org/10.3390/ijms221910536
Chicago/Turabian StyleBayer, Andreas, Bernard Wijaya, Franziska Rademacher, Lena Möbus, Mark Preuß, Michael Singh, Mersedeh Tohidnezhad, Yusuke Kubo, Meno Rodewald, Peter Behrendt, and et al. 2021. "Platelet-Released Growth Factors Induce Genes Involved in Extracellular Matrix Formation in Human Fibroblasts" International Journal of Molecular Sciences 22, no. 19: 10536. https://doi.org/10.3390/ijms221910536