Novel DNA Aptameric Sensors to Detect the Toxic Insecticide Fenitrothion
Abstract
:1. Introduction
2. Results and Discussion
2.1. Selection of Fenitrothion-Specific ssDNA Aptamers Using SELEX-Based Strategy
2.2. Refinement of ssDNA Aptamers and Sequencing of Candidate Aptamers Obtained via SELEX
2.3. Prediction of Secondary Structures of Selected ssDNA Aptamers
2.4. Evaluation of Aptamer-FAM Fluorescence Quenching Efficiency
2.5. Evaluation of Target Specificity of Aptameric Sensors
2.6. Development of a Label-Free Method using ThT Displacement to Detect Fenitrothion
2.6.1. ThT Displacement Assay
2.6.2. Recognition Specificity of FenA2-ThT Sensor
2.6.3. Label-Free Detection of Fenitrothion from Plant Tissue Extracts
3. Materials and Methods
3.1. DNA Oligonucleotides snd Chemical Reagents
3.2. Reagents and Buffers for SELEX
3.3. Selection of Desired Candidate ssDNA Using SELEX Process
3.4. Cloning and Sequencing of Selected Candidate ssDNA Aptamers
3.5. Bioinformatic Analysis to Study Sequence Similarity and Predict The Secondary Structure of The Candidate Aptamers
3.6. Measurement of Binding Affinity
3.6.1. The FAM Assays
3.6.2. Label-Free Detection of Fenitrothion using ThT Dye Displacement
3.6.3. Measurement of Specificity of Both Assays
3.7. Detection of Fenitrothion from Plant Extract
4. Conclusions
Supplementary Materials
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
Abbreviations
MRE | Molecular Recognition Element |
BSA | Bovine Serum Albumin |
LOD | Limit of Detection |
ssDNA | Single-stranded DNA |
FAM | 6-Carboxyfluorescein |
ThT | Thioflavin T |
6-FAM | 6-Fluorescein |
USEPA | United States Environmental Protection Agency |
SELEX | Systemic Evolution of Ligand by Exponential Enrichment |
WHO | World Health Organization |
FAO | Food and Agriculture Organization |
Biotin-TEG | Biotin-Tetraethylene Glycol |
References
- Atwood, D.; Paisley-Jones, C. Pesticides Industry Sales and Usage 2008–2012 Market Estimates; US Environmental Protection Agency: Washington, DC, USA, 2017.
- WHO; FAO. Specifications and Evaluations for Public Health Pesticides Fenitrothion O,O-Dimethyl O-4-Nitro-m-Tolyl Phosphorothioate; WHO: Geneva, Switzerland; FAO: Rome, Italy, 2019. [Google Scholar]
- Wang, N.; Naito, H.; Nakajim, T. The toxicity of fenitrothion and permethrin. In Insecticides-Pest Engineering; InTech: London, UK, 2012. [Google Scholar]
- Bates, N.; Campbell, A. Organophosphate insecticides. In Handbook of Poisoning in Dogs and Cats; John Wiley & Sons: Hoboken, NJ, USA, 2008; pp. 199–204. ISBN 9780470699010. [Google Scholar]
- Espinoza-Navarro, O.; Ponce-LaRosa, C.; Bustos-Obregón, E. Organophosphorous pesticides: Their effects on biosentinel species and humans. control and application in Chile. Int. J. Morphol. 2017, 35, 1069–1074. [Google Scholar] [CrossRef] [Green Version]
- Fukuto, T.R. Mechanism of action of organophosphorus and carbamate insecticides. Environ. Health Perspect. 1990, 87, 245–254. [Google Scholar] [CrossRef]
- WHO; FAO. Pesticide Residues in Food, 2018; WHO: Geneva, Switzerland; FAO: Rome, Italy, 2018; Volume 234, ISBN 9789251311561. [Google Scholar]
- Belzunces, L.P.; Tchamitchian, S.; Brunet, J.-L. Neural effects of insecticides in the honeybee. Apidologie 2012, 43, 348–370. [Google Scholar] [CrossRef] [Green Version]
- Poulsen, A.H.; Kawaguchi, S.; Leppänen, M.T.; Kukkonen, J.V.; Nash, S.M.B. Altered developmental timing in early life stages of Antarctic krill (Euphausia superba) exposed to p,p′-DDE. Sci. Total Environ. 2011, 409, 5268–5276. [Google Scholar] [CrossRef]
- Abdel-Ghany, R.; Mohammed, E.; Anis, S.; Barakat, W. Impact of exposure to fenitrothion on vital organs in rats. J. Toxicol. 2016, 2016, 1–18. [Google Scholar] [CrossRef] [Green Version]
- Lajmanovich, R.C.; Attademo, A.M.; Peltzer, P.M.; Junges, C.M. Inhibition and recovery of cholinesterases in Odontophrynus americanus tadpoles exposed to fenitrothion. J. Environ. Biol. 2009, 30, 923–926. [Google Scholar]
- Malhat, F.M. Residues and dissipation of fenitrothion in green bean (Phaseolus vulgaris) and soil. Int. J. Sch. Res. Not. 2012, 2012, 1–4. [Google Scholar] [CrossRef] [Green Version]
- Paul, B.S.; Vadlamudi, V.P. Teratogenic studies of fenitrothion on white leghorn chick embryos. Bull. Environ. Contam. Toxicol. 1976, 15, 223–229. [Google Scholar] [CrossRef] [PubMed]
- Prante, M.; Schüling, T.; Roth, B.; Bremer, K.; Walter, J. Characterization of an Aptamer directed against 25-hydroxyvitamin D for the development of a competitive aptamer-based Assay. Biosensors 2019, 9, 134. [Google Scholar] [CrossRef] [Green Version]
- Thiviyanathan, V.; Gorenstein, D.G. Aptamers and the next generation of diagnostic reagents. Proteomics Clin. Appl. 2012, 6, 563–573. [Google Scholar] [CrossRef] [Green Version]
- Sun, H.; Zhu, X.; Lu, P.Y.; Rosato, R.R.; Tan, W.; Zu, Y. Oligonucleotide aptamers: New Tools for targeted cancer therapy. Mol. Ther. Nucleic Acids 2014, 3, e182. [Google Scholar] [CrossRef]
- Iqbal, S.S.; Mayo, M.W.; Bruno, J.G.; Bronk, B.V.; A Batt, C.; Chambers, J.P. A review of molecular recognition technologies for detection of biological threat agents. Biosens. Bioelectron. 2000, 15, 549–578. [Google Scholar] [CrossRef]
- Yüce, M.; Ullah, N.; Budak, H. Trends in aptamer selection methods and applications. Analyst 2015, 140, 5379–5399. [Google Scholar] [CrossRef]
- Keefe, A.D.; Pai, S.; Ellington, A. Aptamers as therapeutics. Nat. Rev. Drug Discov. 2010, 9, 537–550. [Google Scholar] [CrossRef]
- Park, J.-W.; Lee, S.J.; Choi, E.-J.; Kim, J.; Song, J.-Y.; Gu, M.B. An ultra-sensitive detection of a whole virus using dual aptamers developed by immobilization-free screening. Biosens. Bioelectron. 2014, 51, 324–329. [Google Scholar] [CrossRef]
- Schmitz, A.; Weber, A.; Bayin, M.; Breuers, S.; Fieberg, V.; Famulok, M.; Mayer, G. A SARS-CoV-2 Spike Binding DNA Aptamer that Inhibits Pseudovirus Infection by an RBD-Independent Mechanism. Angew. Chem. 2021, 60, 10279–10285. [Google Scholar] [CrossRef] [PubMed]
- Mayer, G.; Ahmed, M.-S.L.; Dolf, A.; Endl, E.; Knolle, P.A.; Famulok, M. Fluorescence-activated cell sorting for aptamer SELEX with cell mixtures. Nat. Protoc. 2010, 5, 1993–2004. [Google Scholar] [CrossRef]
- Liu, M.; Khan, A.; Wang, Z.; Liu, Y.; Yang, G.; Deng, Y.; He, N. Aptasensors for pesticide detection. Biosens. Bioelectron. 2019, 130, 174–184. [Google Scholar] [CrossRef] [PubMed]
- Yang, K.-A.; Pei, R.; Stojanovic, M.N. In vitro selection and amplification protocols for isolation of aptameric sensors for small molecules. Methods 2016, 106, 58–65. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Coonahan, E.S.; Yang, K.-A.; Pecic, S.; De Vos, M.; Wellems, T.E.; Fay, M.P.; Andersen, J.F.; Tarning, J.; Long, C.A. Structure-switching aptamer sensors for the specific detection of piperaquine and mefloquine. Sci. Transl. Med. 2021, 13, 1535. [Google Scholar] [CrossRef]
- Walter, J.-G.; Heilkenbrinker, A.; Austerjost, J.; Timur, S.; Stahl, F.; Schepe, T. Aptasensors for small molecule detection. Zeitschrift Naturforschung B 2012, 67, 976–986. [Google Scholar] [CrossRef] [Green Version]
- Kadam, U.S.; Lossie, A.C.; Schulz, B.; Irudayaraj, J. Gene expression analysis using conventional and imaging methods. In DNA and RNA Nanobiotechnologies in Medicine: Diagnosis and Treatment of Diseases; Springer: Berlin, Germany, 2013; pp. 141–162. ISBN 9783642368530. [Google Scholar]
- Perez-Gonzalez, C.; Lafontaine, D.A.; Penedo, J.C. Fluorescence-based strategies to investigate the structure and dynamics of aptamer-ligand complexes. Front. Chem. 2016, 4, 33. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Kadam, U.; Moeller, C.A.; Irudayaraj, J.; Schulz, B. Effect of T-DNA insertions on mRNA transcript copy numbers upstream and downstream of the insertion site in Arabidopsis thaliana explored by surface enhanced Raman spectroscopy. Plant Biotechnol. J. 2014, 12, 568–577. [Google Scholar] [CrossRef] [PubMed]
- Kadam, U.; Schulz, B.; Lrudayaraj, J.; Irudayaraj, J. Detection and quantification of alternative splice sites in Arabidopsis genes AtDCL2 and AtPTB2 with highly sensitive surface enhanced Raman spectroscopy (SERS) and gold nanoprobes. FEBS Lett. 2014, 588, 1637–1643. [Google Scholar] [CrossRef] [Green Version]
- Wu, K.; Ma, C.; Zhao, H.; He, H.; Chen, H. Label-Free G-Quadruplex aptamer fluorescence assay for ochratoxin a using a Thioflavin T probe. Toxins 2018, 10, 198. [Google Scholar] [CrossRef] [Green Version]
- Doria, F.; Pirota, V.; Petenzi, M.; Teulade-Fichou, M.-P.; Verga, D.; Freccero, M. Oxadiazole/Pyridine-based ligands: A structural tuning for enhancing G-quadruplex binding. Molecules 2018, 23, 2162. [Google Scholar] [CrossRef] [Green Version]
- Xing, Y.-P.; Liu, C.; Zhou, X.-H.; Shi, H.-C. Label-free detection of kanamycin based on a G-quadruplex DNA aptamer-based fluorescent intercalator displacement assay. Sci. Rep. 2015, 5, 8125. [Google Scholar] [CrossRef]
- Komarova, N.; Kuznetsov, A. Inside the Black Box: What Makes SELEX Better? Molecules 2019, 24, 3598. [Google Scholar] [CrossRef] [Green Version]
- Gawande, B.N.; Rohloff, J.C.; Carter, J.D.; von Carlowitz, I.; Zhang, C.; Schneider, D.J.; Janjic, N. Selection of DNA aptamers with two modified bases. Proc. Natl. Acad. Sci. USA 2017, 114, 2898–2903. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Zuker, M. Mfold web server for nucleic acid folding and hybridization prediction. Nucleic Acids Res. 2003, 31, 3406–3415. [Google Scholar] [CrossRef]
- Hu, J.; Easley, C. A simple and rapid approach for measurement of dissociation constants of DNA aptamers against proteins and small molecules via automated microchip electrophoresis. Analyst 2011, 136, 3461–3468. [Google Scholar] [CrossRef] [PubMed]
- Xu, S.; Li, Q.; Xiang, J.; Yang, Q.; Sun, H.; Guan, A.; Wang, L.; Liu, Y.; Yu, L.; Shi, Y.; et al. Thioflavin T as an efficient fluorescence sensor for selective recognition of RNA G-quadruplexes. Sci. Rep. 2016, 6, 24793. [Google Scholar] [CrossRef] [Green Version]
- Turaev, A.V.; Tsvetkov, V.B.; Tankevich, M.V.; Smirnov, I.P.; Aralov, A.V.; Pozmogova, G.E.; Varizhuk, A. Benzothiazole-based cyanines as fluorescent “light-up” probes for duplex and quadruplex DNA. Biochimie 2019, 162, 216–228. [Google Scholar] [CrossRef] [PubMed]
- Zhu, J.; Yan, Z.; Zhou, W.; Liu, C.; Wang, J.; Wang, E. Lighting up the Thioflavin T by Parallel-stranded TG(GA)n DNA homoduplexes. ACS Sens. 2018, 3, 1118–1125. [Google Scholar] [CrossRef] [PubMed]
- Chen, T.-X.; Ning, F.; Liu, H.-S.; Wu, K.-F.; Li, W.; Ma, C.-B. Label-free fluorescent strategy for sensitive detection of tetracycline based on triple-helix molecular switch and G-quadruplex. Chin. Chem. Lett. 2017, 28, 1380–1384. [Google Scholar] [CrossRef]
- Hudson, S.A.; Ecroyd, H.; Kee, T.W.; Carver, J.A. The thioflavin T fluorescence assay for amyloid fibril detection can be biased by the presence of exogenous compounds. FEBS J. 2009, 276, 5960–5972. [Google Scholar] [CrossRef] [Green Version]
- Yang, Z.; Qian, J.; Yang, X.; Jiang, D.; Du, X.; Wang, K.; Mao, H.; Wang, K. A facile label-free colorimetric aptasensor for acetamiprid based on the peroxidase-like activity of hemin-functionalized reduced graphene oxide. Biosens. Bioelectron. 2015, 65, 39–46. [Google Scholar] [CrossRef] [PubMed]
- Ji, D.; Lyu, K.; Zhao, H.; Kwok, C.K. Circular L-RNA aptamer promotes target recognition and controls gene activity. Nucleic Acids Res. 2021, 49, 7280–7291. [Google Scholar] [CrossRef] [PubMed]
- Armbruster, D.; Pry, T. Limit of blank, limit of detection and limit of quantitation. Clin. Biochem. Rev. 2008, 29, S49–S52. [Google Scholar]
Round | Positive Selection | Negative Selection |
---|---|---|
1 to 10 | 100 µM of fenitrothion | - |
11 and 15 | 100 µM of fenitrothion | 1 malathion µM, 1 µM of paraoxon, 1 µM of parathion |
16 to 18 | 1 µM, 10 µM, 100 µM of fenitrothion | 1 malathion µM, 1 µM of paraoxon, 1 µM of parathion |
Name | Sequence |
---|---|
ssDNA Library | 5′- GGAGGCTCTCGGGACGAC(N30)GTCGTCCCGCCTTTAGGATTTACAG-3′ |
Capture strand | 5′- GTCGTCCCGAGAGCCATA-Biotin-TEG-3′ |
Forward Primer | 5′-GGAGGCTCTCGGGACGAC-3′ |
Reverse Primer | 5′-CTGTAAATCCTAAAGGCGGGACGAC-3′ |
Biotinylated-Reverse Primer | 5′-Biotin-CTGTAAATCCTAAAG GCGGGACGAC-3′ |
Name | Sequence (5′ to 3′) | Number of Copies |
---|---|---|
FenA1 | ctctcgggacgac CACAGGGAGTAAGAGGCCGCCAGATTGTAA gtcgtccc | 15 |
FenA2 | ctctcgggacgac GGGCCGAGTAGTCTCCACGATTGATCGGAA gtcgtccc | 14 |
FenA3 | ctctcgggacgac CGCAGGTCAGGTTGAGAGGATCCCGATTGCT gtcgtccc | 8 |
FenA4 | ctctcgggacgac CGCAGGTTGTCTGAGCCGACAGGTTGCAT gtcgtccc | 5 |
FenA5 | ctctcgggacgac CGCAGGGCGTGAGAGCCGGAACGGTGCATC gtcgtccc | 5 |
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations. |
© 2021 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Trinh, K.H.; Kadam, U.S.; Song, J.; Cho, Y.; Kang, C.H.; Lee, K.O.; Lim, C.O.; Chung, W.S.; Hong, J.C. Novel DNA Aptameric Sensors to Detect the Toxic Insecticide Fenitrothion. Int. J. Mol. Sci. 2021, 22, 10846. https://doi.org/10.3390/ijms221910846
Trinh KH, Kadam US, Song J, Cho Y, Kang CH, Lee KO, Lim CO, Chung WS, Hong JC. Novel DNA Aptameric Sensors to Detect the Toxic Insecticide Fenitrothion. International Journal of Molecular Sciences. 2021; 22(19):10846. https://doi.org/10.3390/ijms221910846
Chicago/Turabian StyleTrinh, Kien Hong, Ulhas Sopanrao Kadam, Jinnan Song, Yuhan Cho, Chang Ho Kang, Kyun Oh Lee, Chae Oh Lim, Woo Sik Chung, and Jong Chan Hong. 2021. "Novel DNA Aptameric Sensors to Detect the Toxic Insecticide Fenitrothion" International Journal of Molecular Sciences 22, no. 19: 10846. https://doi.org/10.3390/ijms221910846