FOLFOX Therapy Induces Feedback Upregulation of CD44v6 through YB-1 to Maintain Stemness in Colon Initiating Cells
Abstract
:1. Introduction
2. Results
2.1. Upregulation of CD44v6 and YB-1 Contributes to Acquired Chemoresistance and Stemness in Colon Cancer SW948 Cells
2.2. Expansion of CD44v6 (+) CICs during Acquisition of FOLFOX Resistance
2.3. Generation of CD44v6 and YB-1 Knockout CICs Using the CRISPR/Cas9 System
2.4. CD44v6 Regulates YB-1 through a PGE2-MTOR Pathway
2.5. CD44v6-YB-1 Signaling Defines the Stemness of CICs
2.6. Analysis of CIC Stemness Associated Genes and Drug-Resistance Proteins in SP Cells
2.7. Nuclear YB-1 Associates with CD44v6 and Functions to Modulate CD44v6 and MDR1 Transcription
2.8. Role of CD44v6-YB-1 in the Tumorigenesis of CICs of Resistant Cells In Vivo
3. Discussion
4. Materials and Methods
4.1. Materials
4.2. Cell Lines
4.3. Generation of FOFOX Resistant (FR) Cells
4.4. Isolation of CICs
4.5. Labeling of Cells with Hoechst 33342
4.6. Establishment of CD44v6 Knockout Mutant and YB-1 Knockout Mutant of CICs by the CRISPR/Cas9 System
4.7. RNA Silencing
4.8. CR1SPR/Cas9 Knockout Mutant Gene Rescue Plasmids
4.9. Cell Growth Survival or Apoptosis Assays
4.10. Tumor Sphere Formation
4.11. Cell Lysis and Immunoblotting
4.12. Coimmunoprecipitation and Pulldown
4.13. Plasmids and Reporter Assays
4.13.1. Reporter Vectors
4.13.2. Transient Transfection and Luciferase Reporter Assay
4.13.3. β-Catenin/TCF Reporter Assays
4.14. Primer Design and PCR
- RNA extraction and cDNA synthesis [177]
- Primer design and semiquantitative RT-PCR [177]
4.15. Quantitative Real-Time RT-PCR (QPCR)
4.16. Chromatin Immunoprecipitation (ChIP) Assay
4.17. In Vivo Tumorigenic Potential of CICs
4.18. Statistics
5. Conclusions
Supplementary Materials
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Conflicts of Interest
Abbreviations
CD44s | Standard isoform of CD44 having no variant exons |
CD44v | CD44 splice variant |
CD44v6 | variant 6 of CD44 |
v6 | CD44v6 |
sh | shRNA |
v6 Mu1 | v6 knockout Mu1 |
v6 Mu2 | v6 knockout Mu2 |
YB-1 Mu3 | YB-1 knockout Mu3 |
YB-1 Mu4 | YB-1 knockout Mu4 |
CIC | Cancer initiating cell |
CRC | Colorectal cancer |
5-FU | 5-Fluorouracil |
OXA | Oxaliplatin |
FOLFOX | 5-FU pls OXA plus leucovorin |
ALDH1 | Aldehyde dehydrogenase 1 |
MDR1 | Multidrug-resistance protein 1 |
IP | Immunoprecipitation |
YB-1 | Y-box binding protein-1 |
WB | Western blotting |
SQ | Subcutaneous |
CTOS | c-Myc, TWIST1, OCT4, and SOX2 |
TF | Transcription Factors |
References
- Siegel, R.L.; Miller, K.D.; Fedewa, S.A.; Ahnen, D.J.; Meester, R.G.S.; Barzi, A.; Jemal, A. Colorectal cancer statistics, 2017. CA Cancer J. Clin. 2017, 67, 177–193. [Google Scholar] [CrossRef]
- Siegel, R.L.; Miller, K.D.; Jemal, A. Cancer statistics, 2016. CA Cancer J. Clin. 2016, 66, 7–30. [Google Scholar] [CrossRef] [Green Version]
- Cunningham, D.; Atkin, W.; Lenz, H.J.; Lynch, H.T.; Minsky, B.; Nordlinger, B.; Starling, N. Colorectal cancer. Lancet 2010, 375, 1030–1047. [Google Scholar] [CrossRef]
- Winawer, S.J. Screening of colorectal cancer. Surg. Oncol. Clin. N. Am. 2005, 14, 699–722. [Google Scholar] [CrossRef] [PubMed]
- Winawer, S.J.; Zauber, A.G.; Ho, M.N.; O’Brien, M.J.; Gottlieb, L.S.; Sternberg, S.S.; Waye, J.D.; Schapiro, M.; Bond, J.H.; Panish, J.F.; et al. Prevention of colorectal cancer by colonoscopic polypectomy. N. Engl. J. Med. 1993, 329, 1977–1981. [Google Scholar] [CrossRef] [PubMed]
- Dallas, N.A.; Xia, L.; Fan, F.; Gray, M.J.; Gaur, P.; van Buren, G., II; Samuel, S.; Kim, M.P.; Lim, S.J.; Ellis, L.M. Chemoresistant colorectal cancer cells, the cancer stem cell phenotype, and increased sensitivity to insulin-like growth factor-I receptor inhibition. Cancer Res. 2009, 69, 1951–1957. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Kelland, L. The resurgence of platinum-based cancer chemotherapy. Nat. Rev. Cancer 2007, 7, 573–584. [Google Scholar] [CrossRef]
- Zhou, M.; Yu, P.; Davin, D.B.H.; Li, Y.; Wang, Y.; Fu, L.; Zhang, J. Is FOLFOXIRI alone or combined with targeted therapy administered as first-line treatment a reasonable choice for most patients with mCRC? Systematic review and network meta-analysis. Oncotarget 2017, 8, 62339–62348. [Google Scholar] [CrossRef]
- Rothenberg, M.L. Efficacy of oxaliplatin in the treatment of colorectal cancer. Oncology 2000, 14, 9–14. [Google Scholar]
- Singh, A.K.; Arya, R.K.; Maheshwari, S.; Singh, A.; Meena, S.; Pandey, P.; Dormond, O.; Datta, D. Tumor heterogeneity and cancer stem cell paradigm: Updates in concept, controversies and clinical relevance. Int. J. Cancer 2015, 136, 1991–2000. [Google Scholar] [CrossRef]
- Valent, P.; Bonnet, D.; De Maria, R.; Lapidot, T.; Copland, M.; Melo, J.V.; Chomienne, C.; Ishikawa, F.; Schuringa, J.J.; Stassi, G.; et al. Cancer stem cell definitions and terminology: The devil is in the details. Nat. Rev. Cancer 2012, 12, 767–775. [Google Scholar] [CrossRef] [PubMed]
- Rich, J.N. Cancer stem cells: Understanding tumor hierarchy and heterogeneity. Medicine 2016, 95, S2–S77. [Google Scholar] [CrossRef] [PubMed]
- Vermeulen, L.; De Sousa, E.M.F.; van der Heijden, M.; Cameron, K.; de Jong, J.H.; Borovski, T.; Tuynman, J.B.; Todaro, M.; Merz, C.; Rodermond, H.; et al. Wnt activity defines colon cancer stem cells and is regulated by the microenvironment. Nat. Cell Biol. 2010, 12, 468–476. [Google Scholar] [CrossRef] [PubMed]
- Vermeulen, L.; Sprick, M.R.; Kemper, K.; Stassi, G.; Medema, J.P. Cancer stem cells—Old concepts, new insights. Cell Death Differ. 2008, 15, 947–958. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Al-Hajj, M.; Wicha, M.S.; Benito-Hernandez, A.; Morrison, S.J.; Clarke, M.F. Prospective identification of tumorigenic breast cancer cells. Proc. Natl. Acad. Sci. USA 2003, 100, 3983–3988. [Google Scholar] [CrossRef] [Green Version]
- Singh, S.K.; Clarke, I.D.; Terasaki, M.; Bonn, V.E.; Hawkins, C.; Squire, J.; Dirks, P.B. Identification of a cancer stem cell in human brain tumors. Cancer Res. 2003, 63, 5821–5828. [Google Scholar]
- Fang, D.; Nguyen, T.K.; Leishear, K.; Finko, R.; Kulp, A.N.; Hotz, S.; Van Belle, P.A.; Xu, X.; Elder, D.E.; Herlyn, M. A tumorigenic subpopulation with stem cell properties in melanomas. Cancer Res. 2005, 65, 9328–9337. [Google Scholar] [CrossRef] [Green Version]
- Tirino, V.; Desiderio, V.; d’Aquino, R.; De Francesco, F.; Pirozzi, G.; Graziano, A.; Galderisi, U.; Cavaliere, C.; De Rosa, A.; Papaccio, G.; et al. Detection and characterization of CD133+ cancer stem cells in human solid tumours. PLoS ONE 2008, 3, e3469. [Google Scholar] [CrossRef]
- Tirino, V.; Desiderio, V.; Paino, F.; De Rosa, A.; Papaccio, F.; Fazioli, F.; Pirozzi, G.; Papaccio, G. Human primary bone sarcomas contain CD133+ cancer stem cells displaying high tumorigenicity in vivo. FASEB J. 2011, 25, 2022–2030. [Google Scholar] [CrossRef]
- Collins, A.T.; Berry, P.A.; Hyde, C.; Stower, M.J.; Maitland, N.J. Prospective identification of tumorigenic prostate cancer stem cells. Cancer Res. 2005, 65, 10946–10951. [Google Scholar] [CrossRef] [Green Version]
- Bapat, S.A.; Mali, A.M.; Koppikar, C.B.; Kurrey, N.K. Stem and progenitor-like cells contribute to the aggressive behavior of human epithelial ovarian cancer. Cancer Res. 2005, 65, 3025–3029. [Google Scholar] [CrossRef] [Green Version]
- Takaishi, S.; Okumura, T.; Tu, S.; Wang, S.S.; Shibata, W.; Vigneshwaran, R.; Gordon, S.A.; Shimada, Y.; Wang, T.C. Identification of gastric cancer stem cells using the cell surface marker CD44. Stem Cells 2009, 27, 1006–1020. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Eramo, A.; Lotti, F.; Sette, G.; Pilozzi, E.; Biffoni, M.; Di Virgilio, A.; Conticello, C.; Ruco, L.; Peschle, C.; De Maria, R. Identification and expansion of the tumorigenic lung cancer stem cell population. Cell Death Differ. 2008, 15, 504–514. [Google Scholar] [CrossRef] [PubMed]
- Tirino, V.; Camerlingo, R.; Franco, R.; Malanga, D.; La Rocca, A.; Viglietto, G.; Rocco, G.; Pirozzi, G. The role of CD133 in the identification and characterisation of tumour-initiating cells in non-small-cell lung cancer. Eur. J. Cardio-Thorac. Surg. 2009, 36, 446–453. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Wei, B.; Chen, L.; Li, R.; Tian, J. Stem cells in gastrointestinal cancers: A matter of choice in cell fate determination. Expert Rev. Anticancer Ther. 2010, 10, 1621–1633. [Google Scholar] [CrossRef] [PubMed]
- Todaro, M.; Alea, M.P.; Di Stefano, A.B.; Cammareri, P.; Vermeulen, L.; Iovino, F.; Tripodo, C.; Russo, A.; Gulotta, G.; Medema, J.P.; et al. Colon cancer stem cells dictate tumor growth and resist cell death by production of interleukin-4. Cell Stem Cell 2007, 1, 389–402. [Google Scholar] [CrossRef] [Green Version]
- Todaro, M.; Gaggianesi, M.; Catalano, V.; Benfante, A.; Iovino, F.; Biffoni, M.; Apuzzo, T.; Sperduti, I.; Volpe, S.; Cocorullo, G.; et al. CD44v6 is a marker of constitutive and reprogrammed cancer stem cells driving colon cancer metastasis. Cell Stem Cell 2014, 14, 342–356. [Google Scholar] [CrossRef] [Green Version]
- Natarajan, T.G.; Ganesan, N.; Fitzgerald, K.T. Cancer stem cells and markers: New model of tumorigenesis with therapeutic implications. Cancer Biomark. 2010, 9, 65–99. [Google Scholar] [CrossRef]
- Prasetyanti, P.R.; Medema, J.P. Intra-tumor heterogeneity from a cancer stem cell perspective. Mol. Cancer 2017, 16, 41. [Google Scholar] [CrossRef] [Green Version]
- Sanchez, J.A.; Krumroy, L.; Plummer, S.; Aung, P.; Merkulova, A.; Skacel, M.; DeJulius, K.L.; Manilich, E.; Church, J.M.; Casey, G.; et al. Genetic and epigenetic classifications define clinical phenotypes and determine patient outcomes in colorectal cancer. Br. J. Surg. 2009, 96, 1196–1204. [Google Scholar] [CrossRef]
- Sadanandam, A.; Lyssiotis, C.A.; Homicsko, K.; Collisson, E.A.; Gibb, W.J.; Wullschleger, S.; Ostos, L.C.; Lannon, W.A.; Grotzinger, C.; Del Rio, M.; et al. A colorectal cancer classification system that associates cellular phenotype and responses to therapy. Nat. Med. 2013, 19, 619–625. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Ogino, S.; Fuchs, C.S.; Giovannucci, E. How many molecular subtypes? Implications of the unique tumor principle in personalized medicine. Expert Rev. Mol. Diagn. 2012, 12, 621–628. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Hermann, P.C.; Huber, S.L.; Herrler, T.; Aicher, A.; Ellwart, J.W.; Guba, M.; Bruns, C.J.; Heeschen, C. Distinct populations of cancer stem cells determine tumor growth and metastatic activity in human pancreatic cancer. Cell Stem Cell 2007, 1, 313–323. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Vermeulen, L.; Todaro, M.; Mello, F.d.S.; Sprick, M.R.; Kemper, K.; Alea, M.P.; Richel, D.J.; Stassi, G.; Medema, J.P. Single-cell cloning of colon cancer stem cells reveals a multi-lineage differentiation capacity. Proc. Natl. Acad. Sci. USA 2008, 105, 13427–13432. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Ohata, H.; Ishiguro, T.; Aihara, Y.; Sato, A.; Sakai, H.; Sekine, S.; Taniguchi, H.; Akasu, T.; Fujita, S.; Nakagama, H.; et al. Induction of the stem-like cell regulator CD44 by Rho kinase inhibition contributes to the maintenance of colon cancer-initiating cells. Cancer Res. 2012, 72, 5101–5110. [Google Scholar] [CrossRef] [Green Version]
- Hide, T.; Takezaki, T.; Nakamura, H.; Kuratsu, J.; Kondo, T. Brain tumor stem cells as research and treatment targets. Brain Tumor Pathol. 2008, 25, 67–72. [Google Scholar] [CrossRef]
- Huang, E.H.; Hynes, M.J.; Zhang, T.; Ginestier, C.; Dontu, G.; Appelman, H.; Fields, J.Z.; Wicha, M.S.; Boman, B.M. Aldehyde dehydrogenase 1 is a marker for normal and malignant human colonic stem cells (SC) and tracks SC overpopulation during colon tumorigenesis. Cancer Res. 2009, 69, 3382–3389. [Google Scholar] [CrossRef] [Green Version]
- Phi, L.T.H.; Sari, I.N.; Yang, Y.G.; Lee, S.H.; Jun, N.; Kim, K.S.; Lee, Y.K.; Kwon, H.Y. Cancer Stem Cells (CSCs) in Drug Resistance and their Therapeutic Implications in Cancer Treatment. Stem Cells Int. 2018, 2018, 5416923. [Google Scholar] [CrossRef] [Green Version]
- Houthuijzen, J.M.; Daenen, L.G.; Roodhart, J.M.; Voest, E.E. The role of mesenchymal stem cells in anti-cancer drug resistance and tumour progression. Br. J. Cancer 2012, 106, 1901–1906. [Google Scholar] [CrossRef]
- Fulda, S. Regulation of apoptosis pathways in cancer stem cells. Cancer Lett. 2013, 338, 168–173. [Google Scholar] [CrossRef]
- Blanpain, C. Tracing the cellular origin of cancer. Nat. Cell Biol. 2013, 15, 126–134. [Google Scholar] [CrossRef] [PubMed]
- Brabletz, T.; Jung, A.; Spaderna, S.; Hlubek, F.; Kirchner, T. Opinion: Migrating cancer stem cells—An integrated concept of malignant tumour progression. Nat. Rev. Cancer 2005, 5, 744–749. [Google Scholar] [CrossRef] [PubMed]
- Screaton, G.R.; Bell, M.V.; Jackson, D.G.; Cornelis, F.B.; Gerth, U.; Bell, J.I. Genomic structure of DNA encoding the lymphocyte homing receptor CD44 reveals at least 12 alternatively spliced exons. Proc. Natl. Acad. Sci. USA 1992, 89, 12160–12164. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Zoller, M. CD44: Can a cancer-initiating cell profit from an abundantly expressed molecule? Nat. Rev. Cancer 2011, 11, 254–267. [Google Scholar] [CrossRef] [PubMed]
- Naor, D.; Wallach-Dayan, S.B.; Zahalka, M.A.; Sionov, R.V. Involvement of CD44, a molecule with a thousand faces, in cancer dissemination. Semin. Cancer Biol. 2008, 18, 260–267. [Google Scholar] [CrossRef]
- Wang, Z.; Zhao, K.; Hackert, T.; Zoller, M. CD44/CD44v6 a Reliable Companion in Cancer-Initiating Cell Maintenance and Tumor Progression. Front. Cell Dev. Biol. 2018, 6, 97. [Google Scholar] [CrossRef] [Green Version]
- Zeilstra, J.; Joosten, S.P.; van Andel, H.; Tolg, C.; Berns, A.; Snoek, M.; van de Wetering, M.; Spaargaren, M.; Clevers, H.; Pals, S.T. Stem cell CD44v isoforms promote intestinal cancer formation in Apc(min) mice downstream of Wnt signaling. Oncogene 2014, 33, 665–670. [Google Scholar] [CrossRef] [Green Version]
- Misra, S.; Hascall, V.C.; De Giovanni, C.; Markwald, R.R.; Ghatak, S. Delivery of CD44 shRNA/nanoparticles within cancer cells: Perturbation of hyaluronan/CD44v6 interactions and reduction in adenoma growth in Apc Min/+ MICE. J. Biol. Chem. 2009, 284, 12432–12446. [Google Scholar] [CrossRef] [Green Version]
- Misra, S.; Ghatak, S.; Toole, B.P. Regulation of MDR1 expression and drug resistance by a positive feedback loop involving hyaluronan, phosphoinositide 3-kinase, and ErbB2. J. Biol. Chem. 2005, 280, 20310–20315. [Google Scholar] [CrossRef] [Green Version]
- Misra, S.; Hascall, V.C.; Berger, F.G.; Markwald, R.R.; Ghatak, S. Hyaluronan, CD44, and cyclooxygenase-2 in colon cancer. Connect. Tissue Res. 2008, 49, 219–224. [Google Scholar] [CrossRef]
- Misra, S.; Toole, B.P.; Ghatak, S. Hyaluronan constitutively regulates activation of multiple receptor tyrosine kinases in epithelial and carcinoma cells. J. Biol. Chem. 2006, 281, 34936–34941. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Ghatak, S.; Misra, S.; Toole, B.P. Hyaluronan constitutively regulates ErbB2 phosphorylation and signaling complex formation in carcinoma cells. J. Biol. Chem. 2005, 280, 8875–8883. [Google Scholar] [CrossRef] [Green Version]
- Sherman, L.; Wainwright, D.; Ponta, H.; Herrlich, P. A splice variant of CD44 expressed in the apical ectodermal ridge presents fibroblast growth factors to limb mesenchyme and is required for limb outgrowth. Genes Dev. 1998, 12, 1058–1071. [Google Scholar] [CrossRef] [PubMed]
- Bourguignon, L.Y.; Gilad, E.; Peyrollier, K. Heregulin-mediated ErbB2-ERK signaling activates hyaluronan synthases leading to CD44-dependent ovarian tumor cell growth and migration. J. Biol. Chem. 2007, 282, 19426–19441. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Orian-Rousseau, V.; Chen, L.; Sleeman, J.P.; Herrlich, P.; Ponta, H. CD44 is required for two consecutive steps in HGF/c-Met signaling. Genes Dev. 2002, 16, 3074–3086. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Tremmel, M.; Matzke, A.; Albrecht, I.; Laib, A.M.; Olaku, V.; Ballmer-Hofer, K.; Christofori, G.; Heroult, M.; Augustin, H.G.; Ponta, H.; et al. A CD44v6 peptide reveals a role of CD44 in VEGFR-2 signaling and angiogenesis. Blood 2009, 114, 5236–5244. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Ghatak, S.; Hascall, V.C.; Markwald, R.R.; Feghali-Bostwick, C.; Artlett, C.M.; Gooz, M.; Bogatkevich, G.S.; Atanelishvili, I.; Silver, R.M.; Wood, J.; et al. TGF beta-1 induced CD44v6-NOX4 signaling in pathogenesis of idiopathic pulmonary fibrosis. J. Biol. Chem. 2017, 292, 10490–10519. [Google Scholar] [CrossRef] [Green Version]
- Ghatak, S.; Markwald, R.R.; Hascall, V.C.; Dowling, W.; Lottes, R.G.; Baatz, J.E.; Beeson, G.; Beeson, C.C.; Perrella, M.A.; Thannickal, V.J.; et al. TGF beta-1 regulates CD44v6 expression and activity through ERK-induced EGR1 in pulmonary fibrogenic fibroblasts. J. Biol. Chem. 2017, 292, 752451. [Google Scholar] [CrossRef] [Green Version]
- Bourguignon, L.Y. CD44-mediated oncogenic signaling and cytoskeleton activation during mammary tumor progression. J. Mammary Gland Biol. Neoplasia 2001, 6, 287–297. [Google Scholar] [CrossRef]
- Marhaba, R.; Zoller, M. CD44 in cancer progression: Adhesion, migration and growth regulation. J. Mol. Histol. 2004, 35, 211–231. [Google Scholar] [CrossRef]
- Nishino, M.; Ozaki, M.; Hegab, A.E.; Hamamoto, J.; Kagawa, S.; Arai, D.; Yasuda, H.; Naoki, K.; Soejima, K.; Saya, H.; et al. Variant CD44 expression is enriching for a cell population with cancer stem cell-like characteristics in human lung adenocarcinoma. J. Cancer 2017, 8, 1774–1785. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Zoller, M. Tetraspanins: Push and pull in suppressing and promoting metastasis. Nat. Rev. Cancer 2009, 9, 40–55. [Google Scholar] [CrossRef] [PubMed]
- Gherardi, E.; Birchmeier, W.; Birchmeier, C.; Woude, G.V. Targeting MET in cancer: Rationale and progress. Nat. Rev. Cancer 2012, 12, 89–103. [Google Scholar] [CrossRef] [PubMed]
- LaTulippe, E.; Satagopan, J.; Smith, A.; Scher, H.; Scardino, P.; Reuter, V.; Gerald, W.L. Comprehensive gene expression analysis of prostate cancer reveals distinct transcriptional programs associated with metastatic disease. Cancer Res. 2002, 62, 4499–4506. [Google Scholar] [PubMed]
- Padua, D.; Figueira, P.; Ribeiro, I.; Almeida, R.; Mesquita, P. The Relevance of Transcription Factors in Gastric and Colorectal Cancer Stem Cells Identification and Eradication. Front. Cell Dev. Biol. 2020, 8, 442. [Google Scholar] [CrossRef]
- Farabaugh, S.M.; Boone, D.N.; Lee, A.V. Role of IGF1R in Breast Cancer Subtypes, Stemness, and Lineage Differentiation. Front. Endocrinol. 2015, 6, 59. [Google Scholar] [CrossRef]
- Perino, M.; Veenstra, G.J. Chromatin Control of Developmental Dynamics and Plasticity. Dev. Cell 2016, 38, 610–620. [Google Scholar] [CrossRef] [Green Version]
- Acemel, R.D.; Maeso, I.; Gomez-Skarmeta, J.L. Topologically associated domains: A successful scaffold for the evolution of gene regulation in animals. Wiley Interdiscip Rev Dev Biol. 2017, 6, e265. [Google Scholar] [CrossRef] [Green Version]
- Morris, S.A. Direct lineage reprogramming via pioneer factors; a detour through developmental gene regulatory networks. Development 2016, 143, 2696–2705. [Google Scholar] [CrossRef] [Green Version]
- Niwa, H. How is pluripotency determined and maintained? Development 2007, 134, 635–646. [Google Scholar] [CrossRef] [Green Version]
- Niwa, H. The principles that govern transcription factor network functions in stem cells. Development 2018, 145, dev157420. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Beck, B.; Blanpain, C. Unravelling cancer stem cell potential. Nat. Rev. Cancer 2013, 13, 727–738. [Google Scholar] [CrossRef] [PubMed]
- Peinado, H.; Olmeda, D.; Cano, A. Snail, Zeb and bHLH factors in tumour progression: An alliance against the epithelial phenotype? Nat. Rev. Cancer 2007, 7, 415–428. [Google Scholar] [CrossRef]
- Nichols, J.; Zevnik, B.; Anastassiadis, K.; Niwa, H.; Klewe-Nebenius, D.; Chambers, I.; Scholer, H.; Smith, A. Formation of pluripotent stem cells in the mammalian embryo depends on the POU transcription factor Oct4. Cell 1998, 95, 379–391. [Google Scholar] [CrossRef] [Green Version]
- Niwa, H.; Miyazaki, J.; Smith, A.G. Quantitative expression of Oct-3/4 defines differentiation, dedifferentiation or self-renewal of ES cells. Nat. Genet. 2000, 24, 372–376. [Google Scholar] [CrossRef]
- Avilion, A.A.; Nicolis, S.K.; Pevny, L.H.; Perez, L.; Vivian, N.; Lovell-Badge, R. Multipotent cell lineages in early mouse development depend on SOX2 function. Genes Dev. 2003, 17, 126–140. [Google Scholar] [CrossRef] [Green Version]
- Chambers, I.; Colby, D.; Robertson, M.; Nichols, J.; Lee, S.; Tweedie, S.; Smith, A. Functional expression cloning of Nanog, a pluripotency sustaining factor in embryonic stem cells. Cell 2003, 113, 643–655. [Google Scholar] [CrossRef] [Green Version]
- Mitsui, K.; Tokuzawa, Y.; Itoh, H.; Segawa, K.; Murakami, M.; Takahashi, K.; Maruyama, M.; Maeda, M.; Yamanaka, S. The homeoprotein Nanog is required for maintenance of pluripotency in mouse epiblast and ES cells. Cell 2003, 113, 631–642. [Google Scholar] [CrossRef] [Green Version]
- Takahashi, K.; Yamanaka, S. Induction of pluripotent stem cells from mouse embryonic and adult fibroblast cultures by defined factors. Cell 2006, 126, 663–676. [Google Scholar] [CrossRef] [Green Version]
- Matsuda, T.; Nakamura, T.; Nakao, K.; Arai, T.; Katsuki, M.; Heike, T.; Yokota, T. STAT3 activation is sufficient to maintain an undifferentiated state of mouse embryonic stem cells. EMBO J. 1999, 18, 4261–4269. [Google Scholar] [CrossRef] [Green Version]
- Niwa, H.; Burdon, T.; Chambers, I.; Smith, A. Self-renewal of pluripotent embryonic stem cells is mediated via activation of STAT3. Genes Dev. 1998, 12, 2048–2060. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Kielman, M.F.; Rindapaa, M.; Gaspar, C.; van Poppel, N.; Breukel, C.; van Leeuwen, S.; Taketo, M.M.; Roberts, S.; Smits, R.; Fodde, R. Apc modulates embryonic stem-cell differentiation by controlling the dosage of beta-catenin signaling. Nat. Genet. 2002, 32, 594–605. [Google Scholar] [CrossRef] [PubMed]
- Sato, N.; Meijer, L.; Skaltsounis, L.; Greengard, P.; Brivanlou, A.H. Maintenance of pluripotency in human and mouse embryonic stem cells through activation of Wnt signaling by a pharmacological GSK-3-specific inhibitor. Nat. Med. 2004, 10, 55–63. [Google Scholar] [CrossRef] [PubMed]
- Humphries, H.N.; Wickremesekera, S.K.; Marsh, R.W.; Brasch, H.D.; Mehrotra, S.; Tan, S.T.; Itinteang, T. Characterization of Cancer Stem Cells in Colon Adenocarcinoma Metastasis to the Liver. Front. Surg. 2017, 4, 76. [Google Scholar] [CrossRef]
- Deng, J.J.; Zhang, W.; Xu, X.M.; Zhang, F.; Tao, W.P.; Ye, J.J.; Ge, W. Twist mediates an aggressive phenotype in human colorectal cancer cells. Int. J. Oncol. 2016, 48, 1117–1124. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Lyabin, D.N.; Eliseeva, I.A.; Ovchinnikov, L.P. YB-1 protein: Functions and regulation. Wiley Interdiscip. Rev. RNA 2014, 5, 95–110. [Google Scholar] [CrossRef]
- Lasham, A.; Print, C.G.; Woolley, A.G.; Dunn, S.E.; Braithwaite, A.W. YB-1: Oncoprotein, prognostic marker and therapeutic target? Biochem. J. 2013, 449, 11–23. [Google Scholar] [CrossRef] [Green Version]
- Kosnopfel, C.; Sinnberg, T.; Schittek, B. Y-box binding protein 1—A prognostic marker and target in tumour therapy. Eur. J. Cell Biol. 2014, 93, 61–70. [Google Scholar] [CrossRef]
- Harada, M.; Kotake, Y.; Ohhata, T.; Kitagawa, K.; Niida, H.; Matsuura, S.; Funai, K.; Sugimura, H.; Suda, T.; Kitagawa, M. YB-1 promotes transcription of cyclin D1 in human non-small-cell lung cancers. Genes Cells 2014, 19, 504–516. [Google Scholar] [CrossRef]
- Zhang, X.; Ding, Z.; Mo, J.; Sang, B.; Shi, Q.; Hu, J.; Xie, S.; Zhan, W.; Lu, D.; Yang, M.; et al. GOLPH3 promotes glioblastoma cell migration and invasion via the mTOR-YB1 pathway in vitro. Mol. Carcinog. 2015, 54, 1252–1263. [Google Scholar] [CrossRef]
- Wu, Y.; Wang, K.Y.; Li, Z.; Liu, Y.P.; Izumi, H.; Yamada, S.; Uramoto, H.; Nakayama, Y.; Ito, K.; Kohno, K. Y-box binding protein 1 expression in gastric cancer subtypes and association with cancer neovasculature. Clin. Transl. Oncol. 2015, 17, 152–159. [Google Scholar] [CrossRef]
- Jung, K.; Wu, F.; Wang, P.; Ye, X.; Abdulkarim, B.S.; Lai, R. YB-1 regulates Sox2 to coordinately sustain stemness and tumorigenic properties in a phenotypically distinct subset of breast cancer cells. BMC Cancer 2014, 14, 328. [Google Scholar] [CrossRef] [Green Version]
- Wu, Y.; Yamada, S.; Izumi, H.; Li, Z.; Shimajiri, S.; Wang, K.Y.; Liu, Y.P.; Kohno, K.; Sasaguri, Y. Strong YB-1 expression is associated with liver metastasis progression and predicts shorter disease-free survival in advanced gastric cancer. J. Surg. Oncol. 2012, 105, 724–730. [Google Scholar] [CrossRef] [PubMed]
- Ardito, F.; Arena, V.; Vellone, M.; Grande, G.; Pennacchia, I.; Majellaro, F.; Giovannini, I.; Vecchio, F.M.; Nuzzo, G.; Giuliante, F. Strong YB-1 expression predicts liver recurrence following resection for colorectal metastases. J. Gastrointest. Surg. 2014, 18, 1987–1993. [Google Scholar] [CrossRef] [PubMed]
- Yan, X.; Yan, L.; Zhou, J.; Liu, S.; Shan, Z.; Jiang, C.; Tian, Y.; Jin, Z. High expression of Y-box-binding protein 1 is associated with local recurrence and predicts poor outcome in patients with colorectal cancer. Int. J. Clin. Exp. Pathol. 2014, 7, 8715–8723. [Google Scholar]
- To, K.; Fotovati, A.; Reipas, K.M.; Law, J.H.; Hu, K.; Wang, J.; Astanehe, A.; Davies, A.H.; Lee, L.; Stratford, A.L.; et al. Y-box binding protein-1 induces the expression of CD44 and CD49f leading to enhanced self-renewal, mammosphere growth, and drug resistance. Cancer Res. 2010, 70, 2840–2851. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Hong, S.P.; Wen, J.; Bang, S.; Park, S.; Song, S.Y. CD44-positive cells are responsible for gemcitabine resistance in pancreatic cancer cells. Int. J. Cancer 2009, 125, 2323–2331. [Google Scholar] [CrossRef] [PubMed]
- Evdokimova, V.; Tognon, C.; Ng, T.; Ruzanov, P.; Melnyk, N.; Fink, D.; Sorokin, A.; Ovchinnikov, L.P.; Davicioni, E.; Triche, T.J.; et al. Translational activation of snail1 and other developmentally regulated transcription factors by YB-1 promotes an epithelial-mesenchymal transition. Cancer Cell 2009, 15, 402–415. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Bargou, R.C.; Jurchott, K.; Wagener, C.; Bergmann, S.; Metzner, S.; Bommert, K.; Mapara, M.Y.; Winzer, K.J.; Dietel, M.; Dorken, B.; et al. Nuclear localization and increased levels of transcription factor YB-1 in primary human breast cancers are associated with intrinsic MDR1 gene expression. Nat. Med. 1997, 3, 447–450. [Google Scholar] [CrossRef] [PubMed]
- Misra, S.; Ghatak, S.; Zoltan-Jones, A.; Toole, B.P. Regulation of multidrug resistance in cancer cells by hyaluronan. J. Biol. Chem. 2003, 278, 25285–25288. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Bourguignon, L.Y.; Earle, C.; Wong, G.; Spevak, C.C.; Krueger, K. Stem cell marker (Nanog) and Stat-3 signaling promote MicroRNA-21 expression and chemoresistance in hyaluronan/CD44-activated head and neck squamous cell carcinoma cells. Oncogene 2012, 31, 149–160. [Google Scholar] [CrossRef] [Green Version]
- Misra, S.; Obeid, L.M.; Hannun, Y.A.; Minamisawa, S.; Berger, F.G.; Markwald, R.R.; Toole, B.P.; Ghatak, S. Hyaluronan constitutively regulates activation of COX-2-mediated cell survival activity in intestinal epithelial and colon carcinoma cells. J. Biol. Chem. 2008, 283, 14335–14344. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Lv, L.; Liu, H.G.; Dong, S.Y.; Yang, F.; Wang, Q.X.; Guo, G.L.; Pan, Y.F.; Zhang, X.H. Upregulation of CD44v6 contributes to acquired chemoresistance via the modulation of autophagy in colon cancer SW480 cells. Tumor Biol. 2016, 37, 8811–8824. [Google Scholar] [CrossRef]
- Chatterjee, M.; Rancso, C.; Stuhmer, T.; Eckstein, N.; Andrulis, M.; Gerecke, C.; Lorentz, H.; Royer, H.D.; Bargou, R.C. The Y-box binding protein YB-1 is associated with progressive disease and mediates survival and drug resistance in multiple myeloma. Blood 2008, 111, 3714–3722. [Google Scholar] [CrossRef] [PubMed]
- Dean, M.; Fojo, T.; Bates, S. Tumour stem cells and drug resistance. Nat. Rev. Cancer 2005, 5, 275–284. [Google Scholar] [CrossRef] [PubMed]
- Dalerba, P.; Cho, R.W.; Clarke, M.F. Cancer stem cells: Models and concepts. Annu. Rev. Med. 2007, 58, 267–284. [Google Scholar] [CrossRef] [Green Version]
- Horst, D.; Kriegl, L.; Engel, J.; Kirchner, T.; Jung, A. Prognostic significance of the cancer stem cell markers CD133, CD44, and CD166 in colorectal cancer. Cancer Invest. 2009, 27, 844–850. [Google Scholar] [CrossRef]
- Hsu, P.D.; Lander, E.S.; Zhang, F. Development and applications of CRISPR-Cas9 for genome engineering. Cell 2014, 157, 1262–1278. [Google Scholar] [CrossRef] [Green Version]
- Hsu, P.D.; Scott, D.A.; Weinstein, J.A.; Ran, F.A.; Konermann, S.; Agarwala, V.; Li, Y.; Fine, E.J.; Wu, X.; Shalem, O.; et al. DNA targeting specificity of RNA-guided Cas9 nucleases. Nat. Biotechnol. 2013, 31, 827–832. [Google Scholar] [CrossRef]
- Yang, F.; Cui, P.; Lu, Y.; Zhang, X. Requirement of the transcription factor YB-1 for maintaining the stemness of cancer stem cells and reverting differentiated cancer cells into cancer stem cells. Stem Cell Res. Ther. 2019, 10, 233. [Google Scholar] [CrossRef]
- Zhang, H.; Cheng, S.; Zhang, M.; Ma, X.; Zhang, L.; Wang, Y.; Rong, R.; Ma, J.; Xia, S.; Du, M.; et al. Prostaglandin E2 promotes hepatocellular carcinoma cell invasion through upregulation of YB-1 protein expression. Int. J. Oncol. 2014, 44, 769–780. [Google Scholar] [CrossRef] [PubMed]
- Lakshman, M.; Subramaniam, V.; Rubenthiran, U.; Jothy, S. CD44 promotes resistance to apoptosis in human colon cancer cells. Exp. Mol. Pathol. 2004, 77, 18–25. [Google Scholar] [CrossRef] [PubMed]
- Lakshman, M.; Subramaniam, V.; Wong, S.; Jothy, S. CD44 promotes resistance to apoptosis in murine colonic epithelium. J. Cell Physiol. 2005, 203, 583–588. [Google Scholar] [CrossRef] [PubMed]
- Dylla, S.J.; Beviglia, L.; Park, I.K.; Chartier, C.; Raval, J.; Ngan, L.; Pickell, K.; Aguilar, J.; Lazetic, S.; Smith-Berdan, S.; et al. Colorectal cancer stem cells are enriched in xenogeneic tumors following chemotherapy. PLoS ONE 2008, 3, e2428. [Google Scholar] [CrossRef]
- Zhou, Y.; Xia, L.; Wang, H.; Oyang, L.; Su, M.; Liu, Q.; Lin, J.; Tan, S.; Tian, Y.; Liao, Q.; et al. Cancer stem cells in progression of colorectal cancer. Oncotarget 2018, 9, 33403–33415. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Zhang, H.; Zhang, X.; Wu, X.; Li, W.; Su, P.; Cheng, H.; Xiang, L.; Gao, P.; Zhou, G. Interference of Frizzled 1 (FZD1) reverses multidrug resistance in breast cancer cells through the Wnt/beta-catenin pathway. Cancer Lett. 2012, 323, 106–113. [Google Scholar] [CrossRef]
- Cheng, X.; Xu, X.; Chen, D.; Zhao, F.; Wang, W. Therapeutic potential of targeting the Wnt/beta-catenin signaling pathway in colorectal cancer. Biomed. Pharmacother. 2019, 110, 473–481. [Google Scholar] [CrossRef]
- Nagahama, Y.; Ueno, M.; Miyamoto, S.; Morii, E.; Minami, T.; Mochizuki, N.; Saya, H.; Takakura, N. PSF1, a DNA replication factor expressed widely in stem and progenitor cells, drives tumorigenic and metastatic properties. Cancer Res. 2010, 70, 1215–1224. [Google Scholar] [CrossRef] [Green Version]
- Kessenbrock, K.; Wang, C.Y.; Werb, Z. Matrix metalloproteinases in stem cell regulation and cancer. Matrix Biol. 2015, 44–46, 184–190. [Google Scholar] [CrossRef]
- Lin, S.Y.; Makino, K.; Xia, W.; Matin, A.; Wen, Y.; Kwong, K.Y.; Bourguignon, L.; Hung, M.C. Nuclear localization of EGF receptor and its potential new role as a transcription factor. Nat. Cell Biol. 2001, 3, 802–808. [Google Scholar] [CrossRef]
- Lee, J.L.; Wang, M.J.; Chen, J.Y. Acetylation and activation of STAT3 mediated by nuclear translocation of CD44. J. Cell Biol. 2009, 185, 949–957. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Peng, H.; Moffett, J.; Myers, J.; Fang, X.; Stachowiak, E.K.; Maher, P.; Kratz, E.; Hines, J.; Fluharty, S.J.; Mizukoshi, E.; et al. Novel nuclear signaling pathway mediates activation of fibroblast growth factor-2 gene by type 1 and type 2 angiotensin II receptors. Mol. Biol. Cell 2001, 12, 449–462. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Wang, S.C.; Lien, H.C.; Xia, W.; Chen, I.F.; Lo, H.W.; Wang, Z.; Ali-Seyed, M.; Lee, D.F.; Bartholomeusz, G.; Ou-Yang, F.; et al. Binding at and transactivation of the COX-2 promoter by nuclear tyrosine kinase receptor ErbB-2. Cancer Cell 2004, 6, 251–261. [Google Scholar] [CrossRef] [Green Version]
- Reilly, J.F.; Maher, P.A. Importin beta-mediated nuclear import of fibroblast growth factor receptor: Role in cell proliferation. J. Cell Biol. 2001, 152, 1307–1312. [Google Scholar] [CrossRef] [Green Version]
- Miletti-Gonzalez, K.E.; Murphy, K.; Kumaran, M.N.; Ravindranath, A.K.; Wernyj, R.P.; Kaur, S.; Miles, G.D.; Lim, E.; Chan, R.; Chekmareva, M.; et al. Identification of function for CD44 intracytoplasmic domain (CD44-ICD): Modulation of matrix metalloproteinase 9 (MMP-9) transcription via novel promoter response element. J. Biol. Chem. 2012, 287, 18995–19007. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Heckman, C.A.; Mehew, J.W.; Boxer, L.M. NF-kappaB activates Bcl-2 expression in t(14;18) lymphoma cells. Oncogene 2002, 21, 3898–3908. [Google Scholar] [CrossRef] [Green Version]
- Smith, S.M.; Lyu, Y.L.; Cai, L. NF-kappaB affects proliferation and invasiveness of breast cancer cells by regulating CD44 expression. PLoS ONE 2014, 9, e106966. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Lee, R.J.; Albanese, C.; Fu, M.; D’Amico, M.; Lin, B.; Watanabe, G.; Haines, G.K., III; Siegel, P.M.; Hung, M.C.; Yarden, Y.; et al. Cyclin D1 is required for transformation by activated Neu and is induced through an E2F-dependent signaling pathway. Mol. Cell. Biol. 2000, 20, 672–683. [Google Scholar] [CrossRef] [Green Version]
- Kuwano, M.; Shibata, T.; Watari, K.; Ono, M. Oncogenic Y-box binding protein-1 as an effective therapeutic target in drug-resistant cancer. Cancer Sci. 2019, 110, 1536–1543. [Google Scholar] [CrossRef]
- Takahashi, K.; Okita, K.; Nakagawa, M.; Yamanaka, S. Induction of pluripotent stem cells from fibroblast cultures. Nat. Protoc. 2007, 2, 3081–3089. [Google Scholar] [CrossRef]
- Maherali, N.; Sridharan, R.; Xie, W.; Utikal, J.; Eminli, S.; Arnold, K.; Stadtfeld, M.; Yachechko, R.; Tchieu, J.; Jaenisch, R.; et al. Directly reprogrammed fibroblasts show global epigenetic remodeling and widespread tissue contribution. Cell Stem Cell 2007, 1, 55–70. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Celesti, G.; Di Caro, G.; Bianchi, P.; Grizzi, F.; Basso, G.; Marchesi, F.; Doni, A.; Marra, G.; Roncalli, M.; Mantovani, A.; et al. Presence of Twist1-positive neoplastic cells in the stroma of chromosome-unstable colorectal tumors. Gastroenterology 2013, 145, 647–657.e15. [Google Scholar] [CrossRef] [PubMed]
- Muller, M.; Hermann, P.C.; Liebau, S.; Weidgang, C.; Seufferlein, T.; Kleger, A.; Perkhofer, L. The role of pluripotency factors to drive stemness in gastrointestinal cancer. Stem Cell Res. 2016, 16, 349–357. [Google Scholar] [CrossRef] [Green Version]
- Thiery, J.P.; Acloque, H.; Huang, R.Y.; Nieto, M.A. Epithelial-mesenchymal transitions in development and disease. Cell 2009, 139, 871–890. [Google Scholar] [CrossRef]
- Fan, Y.L.; Zheng, M.; Tang, Y.L.; Liang, X.H. A new perspective of vasculogenic mimicry: EMT and cancer stem cells (Review). Oncol. Lett. 2013, 6, 1174–1180. [Google Scholar] [CrossRef] [Green Version]
- Liu, Y.S.; Hsu, H.C.; Tseng, K.C.; Chen, H.C.; Chen, S.J. Lgr5 promotes cancer stemness and confers chemoresistance through ABCB1 in colorectal cancer. Biomed. Pharmacother. 2013, 67, 791–799. [Google Scholar] [CrossRef] [PubMed]
- Izumi, D.; Ishimoto, T.; Miyake, K.; Eto, T.; Arima, K.; Kiyozumi, Y.; Uchihara, T.; Kurashige, J.; Iwatsuki, M.; Baba, Y.; et al. Colorectal Cancer Stem Cells Acquire Chemoresistance Through the Upregulation of F-Box/WD Repeat-Containing Protein 7 and the Consequent Degradation of c-Myc. Stem Cells 2017, 35, 2027–2036. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Rodda, D.J.; Chew, J.L.; Lim, L.H.; Loh, Y.H.; Wang, B.; Ng, H.H.; Robson, P. Transcriptional regulation of nanog by OCT4 and SOX2. J. Biol. Chem. 2005, 280, 24731–24737. [Google Scholar] [CrossRef] [Green Version]
- De Carlo, F.; Witte, T.R.; Hardman, W.E.; Claudio, P.P. Omega-3 eicosapentaenoic acid decreases CD133 colon cancer stem-like cell marker expression while increasing sensitivity to chemotherapy. PLoS ONE 2013, 8, e69760. [Google Scholar] [CrossRef] [PubMed]
- Wu, C.; Alman, B.A. Side population cells in human cancers. Cancer Lett. 2008, 268, 1–9. [Google Scholar] [CrossRef]
- Challen, G.A.; Little, M.H. A side order of stem cells: The SP phenotype. Stem Cells 2006, 24, 3–12. [Google Scholar] [CrossRef] [PubMed]
- Haraguchi, N.; Inoue, H.; Tanaka, F.; Mimori, K.; Utsunomiya, T.; Sasaki, A.; Mori, M. Cancer stem cells in human gastrointestinal cancers. Hum. Cell 2006, 19, 24–29. [Google Scholar] [CrossRef]
- Xiong, B.; Ma, L.; Hu, X.; Zhang, C.; Cheng, Y. Characterization of side population cells isolated from the colon cancer cell line SW480. Int. J. Oncol. 2014, 45, 1175–1183. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Chen, D. Tumor formation and drug resistance properties of human glioblastoma side population cells. Mol. Med. Rep. 2015, 11, 4309–4314. [Google Scholar] [CrossRef]
- Melo, F.d.S.e.; Kurtova, A.V.; Harnoss, J.M.; Kljavin, N.; Hoeck, J.D.; Hung, J.; Anderson, J.E.; Storm, E.E.; Modrusan, Z.; Koeppen, H.; et al. A distinct role for Lgr5(+) stem cells in primary and metastatic colon cancer. Nature 2017, 543, 676–680. [Google Scholar] [CrossRef] [PubMed]
- Bu, Y.; Cao, D. The origin of cancer stem cells. Front. Biosci. 2012, 4, 819–830. [Google Scholar]
- Schuijers, J.; Clevers, H. Adult mammalian stem cells: The role of Wnt, Lgr5 and R-spondins. EMBO J. 2012, 31, 2685–2696. [Google Scholar] [CrossRef]
- Sterlacci, W.; Savic, S.; Fiegl, M.; Obermann, E.; Tzankov, A. Putative stem cell markers in non-small-cell lung cancer: A clinicopathologic characterization. J. Thorac. Oncol. 2014, 9, 41–49. [Google Scholar] [CrossRef] [Green Version]
- Gupta, P.B.; Chaffer, C.L.; Weinberg, R.A. Cancer stem cells: Mirage or reality? Nat. Med. 2009, 15, 1010–1012. [Google Scholar] [CrossRef]
- Valastyan, S.; Weinberg, R.A. Tumor metastasis: Molecular insights and evolving paradigms. Cell 2011, 147, 275–292. [Google Scholar] [CrossRef] [Green Version]
- Gupta, G.P.; Massague, J. Cancer metastasis: Building a framework. Cell 2006, 127, 679–695. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Steeg, P.S. Tumor metastasis: Mechanistic insights and clinical challenges. Nat. Med. 2006, 12, 895–904. [Google Scholar] [CrossRef] [PubMed]
- Bonnet, D.; Dick, J.E. Human acute myeloid leukemia is organized as a hierarchy that originates from a primitive hematopoietic cell. Nat. Med. 1997, 3, 730–737. [Google Scholar] [CrossRef] [PubMed]
- Dalerba, P.; Dylla, S.J.; Park, I.K.; Liu, R.; Wang, X.; Cho, R.W.; Hoey, T.; Gurney, A.; Huang, E.H.; Simeone, D.M.; et al. Phenotypic characterization of human colorectal cancer stem cells. Proc. Natl. Acad. Sci. USA 2007, 104, 10158–10163. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Basu, S.; Haase, G.; Ben-Ze’ev, A. Wnt signaling in cancer stem cells and colon cancer metastasis. F1000Res 2016, 5, 1–10. [Google Scholar] [CrossRef] [Green Version]
- Cleophas, M.C.; Joosten, L.A.; Stamp, L.K.; Dalbeth, N.; Woodward, O.M.; Merriman, T.R. ABCG2 polymorphisms in gout: Insights into disease susceptibility and treatment approaches. Pharmgenomics Pers. Med. 2017, 10, 129–142. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Gao, W.; Chen, L.; Ma, Z.; Du, Z.; Zhao, Z.; Hu, Z.; Li, Q. Isolation and phenotypic characterization of colorectal cancer stem cells with organ-specific metastatic potential. Gastroenterology 2013, 145, 636–646.e5. [Google Scholar] [CrossRef]
- Malanchi, I.; Santamaria-Martinez, A.; Susanto, E.; Peng, H.; Lehr, H.A.; Delaloye, J.F.; Huelsken, J. Interactions between cancer stem cells and their niche govern metastatic colonization. Nature 2011, 481, 85–89. [Google Scholar] [CrossRef]
- Wang, Z.; Ouyang, G. Periostin: A bridge between cancer stem cells and their metastatic niche. Cell Stem Cell 2012, 10, 111–112. [Google Scholar] [CrossRef] [Green Version]
- Zeuner, A.; Todaro, M.; Stassi, G.; De Maria, R. Colorectal cancer stem cells: From the crypt to the clinic. Cell Stem Cell 2014, 15, 692–705. [Google Scholar] [CrossRef] [Green Version]
- You, L.; Guo, X.; Huang, Y. Correlation of Cancer Stem-Cell Markers OCT4, SOX2, and NANOG with Clinicopathological Features and Prognosis in Operative Patients with Rectal Cancer. Yonsei Med. J. 2018, 59, 35–42. [Google Scholar] [CrossRef] [PubMed]
- Miyoshi, N.; Ishii, H.; Nagai, K.; Hoshino, H.; Mimori, K.; Tanaka, F.; Nagano, H.; Sekimoto, M.; Doki, Y.; Mori, M. Defined factors induce reprogramming of gastrointestinal cancer cells. Proc. Natl. Acad. Sci. USA 2010, 107, 40–45. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Kong, D.; Li, Y.; Wang, Z.; Sarkar, F.H. Cancer Stem Cells and Epithelial-to-Mesenchymal Transition (EMT)-Phenotypic Cells: Are They Cousins or Twins? Cancers 2011, 3, 716–729. [Google Scholar] [CrossRef] [PubMed]
- Hutz, K.; Mejias-Luque, R.; Farsakova, K.; Ogris, M.; Krebs, S.; Anton, M.; Vieth, M.; Schuller, U.; Schneider, M.R.; Blum, H.; et al. The stem cell factor SOX2 regulates the tumorigenic potential in human gastric cancer cells. Carcinogenesis 2014, 35, 942–950. [Google Scholar] [CrossRef] [Green Version]
- Hoffman, B.; Liebermann, D.A. Apoptotic signaling by c-MYC. Oncogene 2008, 27, 6462–6472. [Google Scholar] [CrossRef] [Green Version]
- Takahashi, A.; Ohtani, N.; Yamakoshi, K.; Iida, S.; Tahara, H.; Nakayama, K.; Nakayama, K.I.; Ide, T.; Saya, H.; Hara, E. Mitogenic signalling and the p16INK4a-Rb pathway cooperate to enforce irreversible cellular senescence. Nat. Cell Biol. 2006, 8, 1291–1297. [Google Scholar] [CrossRef]
- Avery, S.; Inniss, K.; Moore, H. The regulation of self-renewal in human embryonic stem cells. Stem Cells Dev. 2006, 15, 729–740. [Google Scholar] [CrossRef]
- Masui, S.; Nakatake, Y.; Toyooka, Y.; Shimosato, D.; Yagi, R.; Takahashi, K.; Okochi, H.; Okuda, A.; Matoba, R.; Sharov, A.A.; et al. Pluripotency governed by Sox2 via regulation of Oct3/4 expression in mouse embryonic stem cells. Nat. Cell Biol. 2007, 9, 625–635. [Google Scholar] [CrossRef]
- Aoi, T.; Yae, K.; Nakagawa, M.; Ichisaka, T.; Okita, K.; Takahashi, K.; Chiba, T.; Yamanaka, S. Generation of pluripotent stem cells from adult mouse liver and stomach cells. Science 2008, 321, 699–702. [Google Scholar] [CrossRef] [Green Version]
- Yu, J.; Vodyanik, M.A.; Smuga-Otto, K.; Antosiewicz-Bourget, J.; Frane, J.L.; Tian, S.; Nie, J.; Jonsdottir, G.A.; Ruotti, V.; Stewart, R.; et al. Induced pluripotent stem cell lines derived from human somatic cells. Science 2007, 318, 1917–1920. [Google Scholar] [CrossRef]
- De Giovanni, C.; Landuzzi, L.; Nicoletti, G.; Astolfi, A.; Croci, S.; Micaroni, M.; Nanni, P.; Lollini, P.L. Apc10.1: An ApcMin/+ intestinal cell line with retention of heterozygosity. Int. J. Cancer 2004, 109, 200–206. [Google Scholar] [CrossRef] [PubMed]
- Cong, L.; Zhang, F. Genome engineering using CRISPR-Cas9 system. Methods Mol. Biol. 2015, 1239, 197–217. [Google Scholar] [PubMed] [Green Version]
- Jin, J.; Xu, Y.; Huo, L.; Ma, L.; Scott, A.W.; Pizzi, M.P.; Li, Y.; Wang, Y.; Yao, X.; Song, S.; et al. An improved strategy for CRISPR/Cas9 gene knockout and subsequent wildtype and mutant gene rescue. PLoS ONE 2020, 15, e0228910. [Google Scholar] [CrossRef] [PubMed]
- Ghatak, S.; Bogatkevich, G.S.; Atnelishvili, I.; Akter, T.; Feghali-Bostwick, C.; Hoffman, S.; Fresco, V.M.; Fuchs, J.C.; Visconti, R.P.; Markwald, R.R.; et al. Overexpression of c-Met and CD44v6 receptors contributes to autocrine TGF-beta1 signaling in interstitial lung disease. J. Biol. Chem 2014, 289, 7856–7872. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Ghatak, S.; Hascall, V.C.; Markwald, R.R.; Misra, S. Stromal hyaluronan interaction with epithelial CD44 variants promotes prostate cancer invasiveness by augmenting expression and function of hepatocyte growth factor and androgen receptor. J. Biol. Chem. 2010, 285, 19821–19832. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Ghatak, S.; Misra, S.; Norris, R.A.; Moreno-Rodriguez, R.A.; Hoffman, S.; Levine, R.A.; Hascall, V.C.; Markwald, R.R. Periostin induces intracellular cross-talk between kinases and hyaluronan in atrioventricular valvulogenesis. J. Biol. Chem. 2014, 289, 8545–8561. [Google Scholar] [CrossRef] [Green Version]
- Andoorfar, S.; Tafreshi, S.A.H.; Rezvani, Z. Assessment of the expression level of miRNA molecules using a semi-quantitative RT-PCR approach. Mol. Biol. Rep. 2019, 46, 5057–5062. [Google Scholar] [CrossRef]
- Finkbeiner, M.R.; Astanehe, A.; To, K.; Fotovati, A.; Davies, A.H.; Zhao, Y.; Jiang, H.; Stratford, A.L.; Shadeo, A.; Boccaccio, C.; et al. Profiling YB-1 target genes uncovers a new mechanism for MET receptor regulation in normal and malignant human mammary cells. Oncogene 2009, 28, 1421–1431. [Google Scholar] [CrossRef] [Green Version]
Genes | Primers | |
---|---|---|
Sense Sequence (5′–3′) | Antisense Sequence (5′–3′) | |
CD44v6 shRNA1 | TCCTCCCAGTATGACACATATTTTCAAGAGA -AATATGTGTCATACTGGGAGGTTTTTTC | TCGAGAAAAAACCTCCCAGTATGACACATATT-TCTCTTGAA-AATATGTGTCATACTGGGAGGA |
CD44 shRNA2 | TGGACCAATTACCATAACTATTTTCAAGAGA AATAGTTATGGTAATTGGTCCTTTTTTC | TCGAGAAAAAAGGACCAATTACCATAACTATT TCTCTTGAA-AATAGTTATGGTAATTGGTCCA |
Genes | Primers | |
---|---|---|
Forward Sequence (5′–3′) | Reverse Sequence (5′–3′) | |
NFkB | GTGACAGGAGACGTGAAGATG | TGAAGGTGGATGATTGCTAAGT |
E2F1 | TCCCTGAGCTGTTCTTCTG | CCTCCCTCACTTTCCCAATAAA |
STAT3 | GAGAAGGACATCAGCGGTAAG | CAGTGGAGACACCAGGATATTG |
RUNX2 | CGGAATGCCTCTGCTGTTAT | TGTGAAGACGGTTATGGTCAAG |
Snail | ACTATGCCGCGCTCTTTC | GCTGGAAGGTAAACTCTGGATTA |
TWIST1 | AGACTCTGGAGCTGGATAACT | GCCTGTCTCGCTTTCTCTTT |
SOX2 | GGACTGAGAGAAAGAAGAGGAGAG | CGCCGCCGATGATTGTTATTA |
Cyclin D1 | GGTTCAACCCACAGCTACTT | CAGCGCTATTTCCTACACCTATT |
FZD1 | AAGACCGAGTGGTGTGTAATG | TGGCCATGCTGAAGAAGTAG |
GINS1 | TCAGGTGGACGAAGTGATTTG | CGAAGCAAGCGGTCATACA |
MMP9 | GAACTTTGACAGCGACAAGAAG | CGGCACTGAGGAATGATCTAA |
Lgr5 | GGGAAACGCTCTGACATACA | CTTCTGTGGGTACGTGTCTTAG |
OCT4 | GGAGGAAGCTGACAACAATGA | CTCTCACTCGGTTCTCGATACT |
c-Myc | AAGCTGAGGCACACAAAGA | GCTTGGACAGGTTAGGAGTAAA |
EpCAM | AGCTGGTGTTATTGCTGTTATTG | GCATCTCACCCATCTCCTTTAT |
ALDH1 | CTTGGAATTTCCCGTTGGTTATG | GAGAGCAGTGAGAGGAGTTTG |
Nanog | GCCTGTAGTCCCAGCTATTTG | GGAGTGCAGTGGTGTGATATT |
ZEB1 | GGCTCCTATAGCTCACACATAAG | TGCTGAAAGAGACGGTGAAG |
CD44v6 | GACAGAATCCCTGCTACCAATAG | TCCTTCGTGTGTGGGTAATG |
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations. |
© 2021 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (http://creativecommons.org/licenses/by/4.0/).
Share and Cite
Ghatak, S.; Hascall, V.C.; Markwald, R.R.; Misra, S. FOLFOX Therapy Induces Feedback Upregulation of CD44v6 through YB-1 to Maintain Stemness in Colon Initiating Cells. Int. J. Mol. Sci. 2021, 22, 753. https://doi.org/10.3390/ijms22020753
Ghatak S, Hascall VC, Markwald RR, Misra S. FOLFOX Therapy Induces Feedback Upregulation of CD44v6 through YB-1 to Maintain Stemness in Colon Initiating Cells. International Journal of Molecular Sciences. 2021; 22(2):753. https://doi.org/10.3390/ijms22020753
Chicago/Turabian StyleGhatak, Shibnath, Vincent C. Hascall, Roger R. Markwald, and Suniti Misra. 2021. "FOLFOX Therapy Induces Feedback Upregulation of CD44v6 through YB-1 to Maintain Stemness in Colon Initiating Cells" International Journal of Molecular Sciences 22, no. 2: 753. https://doi.org/10.3390/ijms22020753