Effect of Methyl Jasmonate on Thymol, Carvacrol, Phytochemical Accumulation, and Expression of Key Genes Involved in Thymol/Carvacrol Biosynthetic Pathway in Some Iranian Thyme Species
Abstract
:1. Introduction
2. Result and Discussion
2.1. Effect of Different Concentrations of MeJA on Thymol and Carvacrol Content in Fennel Leaves
2.2. Differences in Total Phenolic Content and Total Flavonoid Content in Response to Different MeJA Concentrations
2.3. Induction of Essential Oil Yield (EO) by Using MeJa Elicitor
2.4. Changes in Gene Expression in the Thymol/Carvacrol Biosynthesis Pathway with Different Concentration of MeJA
3. Materials and Methods
3.1. Plant Material and Growth
3.2. Elicitation of Thymus by Different Concentration of MeJa
3.3. RNA Extraction and cDNA Synthesis
3.4. qRT-PCR and Gene Expression Analysis
3.5. Estimation of Total Phenolic Content and Total Flavonoid Content
3.6. Essential Oil Extraction
3.7. Quantification of Thymol and Carvacrol
3.8. Statistical Analysis
4. Conclusions
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Conflicts of Interest
References
- Mohammadi, H.; Amirikia, F.; Ghorbanpour, M.; Fatehi, F.; Hashempour, H. Salicylic acid induced changes in physiological traits and essential oil constituents in different ecotypes of Thymus kotschyanus and Thymus vulgaris under well-watered and water stress conditions. Ind. Crops Prod. 2019, 129, 561–574. [Google Scholar] [CrossRef]
- Mehrgan, H.; Mojab, F.; Pakdaman, S.; Poursaeed, M. Antibacterial activity of Thymus pubescens methanolic extract. Iran. J. Pharm. Sci. 2008, 7, 291–295. [Google Scholar]
- Fachini-Queiroz, F.C.; Kummer, R.; Estevao-Silva, C.F.; de Barros Carvalho, M.D.; Cunha, J.M.; Grespan, R.; Bersani-Amado, C.A.; Cuman, R.K.N. Effects of thymol and carvacrol, constituents of Thymus vulgaris L. essential oil, on the inflammatory response. Evid.-Based Complement. Altern. Med. 2012, 2012, 657026. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Farjam, M.H.; Mohammadi, M.; Izadi, S.; Bazregari, F. Composition and antioxidant activity of the essential oils of Thymus trautvetteri Klokov and Des.-Shost., Thymus migricus Klokov and Des.-Shost. and Thymus caespititius Brot. from Iran. Nat. Prod. Indian J. 2013, 9, 345–349. [Google Scholar]
- Alizadeh, A.; Alizadeh, O.; Amari, G.; Zare, M. Essential oil composition, total phenolic content, antioxidant activity and antifungal properties of Iranian Thymus daenensis subsp. daenensis Celak. as in influenced by ontogenetical variation. J. Essent. Oil-Bear. Plants 2013, 16, 59–70. [Google Scholar] [CrossRef]
- Imelouane, B.; Amhamdi, H.; Wathelet, J.P.; Ankit, M.; Khedid, K.; El Bachiri, A. Chemical composition and antimicrobial activity of essential oil of thyme (Thymus vulgaris) from Eastern Morocco. Int. J. Agric. Biol. 2009, 11, 205–208. [Google Scholar]
- Tohidi, B.; Rahimmalek, M.; Arzani, A. Variations in chemical composition and bioactive compounds of Thymus kotschyanus Boiss. and Hohen populations originated from different collection sites. J. Essent. Oil-Bear. Plants 2018, 21, 1272–1283. [Google Scholar] [CrossRef]
- Abdel-Shafi, S. Preliminary studies on antibacterial and antiviral activities of five medicinal plants. J. Plant Pathol. Microbiol. 2013, 4, 190. [Google Scholar] [CrossRef] [Green Version]
- Moreira-Rodríguez, M.; Nair, V.; Benavides, J.; Cisneros-Zevallos, L.; Jacobo-Velázquez, D.A. UVA, UVB light, and methyl jasmonate, alone or combined, redirect the biosynthesis of glucosinolates, phenolics, carotenoids, and chlorophylls in broccoli sprouts. Int. J. Mol. Sci. 2017, 18, 2330. [Google Scholar] [CrossRef] [Green Version]
- Santana-Gálvez, J.; Cisneros-Zevallos, L.; Jacobo-Velázquez, D.A. Chlorogenic acid: Recent advances on its dual role as a food additive and a nutraceutical against metabolic syndrome. Molecules 2017, 22, 358. [Google Scholar] [CrossRef] [Green Version]
- Amiri, H. Essential oils composition and antioxidant properties of three thymus species. Evid.-Based Complement. Altern. Med. 2012, 2012, 728065. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Nickavar, B.; Mojab, F.; Dolat-Abadi, R. Analysis of the essential oils of two Thymus species from Iran. Food Chem. 2015, 90, 609–611. [Google Scholar] [CrossRef]
- Hoferl, M.; Buchbauer, G.; Jirovetz, L.; Schmidt, E.; Stoyanova, A.; Denkova, Z.; Slavchev, A.; Geissler, M. Correlation of antimicrobial activities of various essential oils and their main aromatic volatile constituents. J. Essent. Oil Res. 2009, 21, 459–463. [Google Scholar] [CrossRef]
- Rodriguez, J.; Ortuno, C.; Benedito, J.; Bon, J. Optimization of the antioxidant capacity of thyme (Thymus vulgaris L.) extracts: Management of the drying process. Ind. Crops Prod. 2013, 46, 258–263. [Google Scholar] [CrossRef]
- Crocoll, C. Biosynthesis of the Phenolic Monoterpenes, Thymol and Carvacrol, by Terpene Synthases and Cytochrome P450s in Oregano and Thyme. Ph.D. Thesis, Biologisch-Pharmazeutischen Fakulte at der Friedrich-Schiller-Universite at Jena, Jena, Germany, 2011. [Google Scholar]
- Dudareva, N.; Andersson, S.; Orlova, I.; Gatto, N.; Reichelt, M.; Rhodes, D.; Boland, W.; Gershenzon, J. The nonmevalonate pathway supports both monoterpene and sesquiterpene formation in snapdragon flowers. Proc. Natl. Acad. Sci. USA 2005, 102, 933–938. [Google Scholar] [CrossRef] [Green Version]
- Takahashi, S.; Kuzuyama, T.; Watanabe, H.; Seto, H. A 1-deoxy-D-xylulose 5-phosphate reductoisomerase catalyzing the formation of 2-C-methyl-D-erythritol 4-phosphate in an alternative nonmevalonate pathway for terpenoid biosynthesis. Proc. Natl. Acad. Sci. USA 1998, 95, 9879–9884. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Lichtenthaler, H.K. The 1-deoxy-D-xylulose-5-phosphate pathway of isoprenoid biosynthesis in plants. Annu. Rev. Plant Physiol. Plant Mol. Biol. 1999, 50, 47–65. [Google Scholar] [CrossRef]
- Burke, C.C.; Wildung, M.R.; Croteau, R. Geranyl diphosphate synthase: Cloning, expression, and characterization of this prenyltransferase as a heterodimer. Proc. Natl. Acad. Sci. USA 1999, 9, 13062–13067. [Google Scholar] [CrossRef] [Green Version]
- Majdi, M.; Malekzadeh-Mashhady, A.; Maroufi, A.; Crocoll, C. Tissue-specific gene-expression patterns of genes associated with thymol/carvacrol biosynthesis in thyme (Thymus vulgaris L.) and their differential changes upon treatment with abiotic elicitors. Plant Physiol. Biochem. 2017, 115, 152–162. [Google Scholar] [CrossRef]
- Hectors, K.; Van Oevelen, S.; Geuns, J.; Guisez, Y.; Jansen, M.A.; Prinsen, E. Dynamic changes in plant secondary metabolites during UV acclimation in Arabidopsis thaliana. Physiol. Plant. 2014, 152, 219–230. [Google Scholar] [CrossRef]
- Hojati, M.; Modarres-Sanavy, S.A.M.; Tahmasebi Enferadi, S.; Majdi, M.; Ghanati, F.; Farzadfar, S. Differential deployment of parthenolide and phenylpropanoids in feverfew plants subjected to divalent heavy metals and transcinnamic acid. Plant Soil. 2016, 399, 41–59. [Google Scholar] [CrossRef]
- Majdi, M.; Abdollahi, M.R.; Maroufi, A. Parthenolide accumulation and expression of genes related to parthenolide biosynthesis affected by exogenous application of methyl jasmonate and salicylic acid in Tanacetum parthenium. Plant Cell Rep. 2015, 34, 1909–1918. [Google Scholar] [CrossRef] [PubMed]
- Elyasi, R.; Majdi, M.; Bahramnejad, B.; Mirzaghaderi, G. Spatial modulation and abiotic elicitors responses of the biosynthesis related genes of mono/triterpenes in blak cumin (Nigella sativa). Ind. Crops Prod. 2016, 79, 240–247. [Google Scholar] [CrossRef]
- Fatemi, F.; Abdollahi, M.R.; Mirzaie-asl, A.; Dastan, D.; Garagounis, C.; Papadopoulou, K. Identification and expression profiling of rosmarinic acid biosynthetic genes from Satureja khuzistanica under carbon nanotubes and methyl jasmonate elicitation. Plant Cell Tissue Organ Cult. 2019, 136, 561–573. [Google Scholar] [CrossRef]
- Fatemi, F.; Abdollahi, M.R.; Mirzaie-Asl, A.; Dastan, D.; Papadopoulou, K. Phytochemical, antioxidant, enzyme activity and antifungal properties of Satureja khuzistanica in vitro and in vivo explants stimulated by some chemical elicitors. Pharm. Biol. 2020, 58, 286–296. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Kianersi, F.; Abdollahi, M.R.; Mirzaie-asl, A.; Dastan, D.; Rasheed, F. Identification and tissue-specific expression of rutin biosynthetic pathway genes in Capparis spinosa elicited with salicylic acid and methyl jasmonate. Sci. Rep. 2020, 10, 1–15. [Google Scholar] [CrossRef] [PubMed]
- Kianersi, F.; Abdollahi, M.R.; Mirzaie-asl, A.; Dastan, D.; Rasheed, F. Biosynthesis of rutin changes in Capparis spinosa due to altered expression of its pathway genes under elicitors’ supplementation. Plant Cell Tissue Organ Cult. 2020, 141, 619–631. [Google Scholar] [CrossRef]
- De Geyter, N.; Gholami, A.; Goormachtig, S.; Goossens, A. Transcriptional machineries in jasmonate-elicited plant secondary metabolism. Trends Plant Sci. 2012, 17, 349–359. [Google Scholar] [CrossRef]
- Mirzajani, Z.; Hadavi, E.; Kashi, A. Changes in the essential oil content and selected traits of sweet basil (Ocimum basilicum L.) as induced by foliar sprays of citric acid and salicylic acid. Ind. Crops Prod. 2015, 76, 269–274. [Google Scholar] [CrossRef]
- Patricelli, D.; Barbero, F.; Occhipinti, A.; Bertea, C.M.; Bonelli, S.; Casacci, L.P.; Zebelo, S.A.; Crocoll, C.; Gershenzon, J.; Maffei, M.E.; et al. Plant defences against ants provide a pathway to social parasitism in butterflies. Proc. R. Soc. 2015, 282, 1811. [Google Scholar] [CrossRef] [Green Version]
- Xu, X.; Zhang, X.; Chen, C. Stimulated production of triterpenoids of Inonotus obliquus using methyl jasmonate and fatty acids. Ind. Crops Prod. 2016, 85, 49–57. [Google Scholar] [CrossRef]
- Tohidi, B.; Rahimmalek, M.; Arzani, A.; Sabzalian, M.R. Thymol, carvacrol, and antioxidant accumulation in Thymus species in response to different light spectra emitted by light-emitting diodes. Food Chem. 2020, 307, 125521. [Google Scholar] [CrossRef]
- Verma, R.S.; Verma, R.K.; Chauhan, A.; Yadav, A.K. Seasonal variation in essential oil content and composition of Thyme, Thymus serpyllum L. cultivated in Uttarakhand hills. Indian J. Pharm. Sci. 2011, 73, 233–235. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Salami, M.; Rahimmalek, M.; Ehtemam, M.H. Inhibitory effect of different fennel (Foeniculum vulgare) samples and their phenolic compounds on formation of advanced glycation products and comparison of antimicrobial and antioxidant activities. Food Chem. 2016, 213, 196–205. [Google Scholar] [CrossRef] [PubMed]
- Gharibi, S.; Tabatabaei, B.E.S.; Saeidi, G. Comparison of essential oil composition, flavonoid content and antioxidant activity in eight Achillea species. J. Essent. Oil-Bear. Plants 2015, 18, 1382–1394. [Google Scholar] [CrossRef]
- Roby, M.H.H.; Sarhana, M.A.; Selima, K.A.; Khalela, K.I. Antioxidant and Antimicrobial Activities of Essential Oil and Extracts of Fennel (Foeniculum vulgare L.) and Chamomile (Matricaria chamomilla L.). Ind. Crops Prod. 2013, 44, 437–445. [Google Scholar] [CrossRef]
- Jabri-Karoui, I.; Bettaieb, I.; Msaada, K.; Hammami, M.; Marzouk, B. Research on the phenolic compounds and antioxidant activities of Tunisian Thymus capitatus. J. Funct. Foods 2012, 4, 661–669. [Google Scholar] [CrossRef]
- Tohidi, B.; Rahimmalek, M.; Arzani, A. Essential oil composition, total phenolic, flavonoid contents, and antioxidant activity of Thymus species collected from different regions of Iran. Food Chem. 2017, 220, 153–161. [Google Scholar] [CrossRef]
- Hossain, M.A.; AL-Raqmi, K.A.S.; AL-Mijizy, Z.H.; Weli, A.M.; Al-Riyami, Q. Study of total phenol, flavonoids contents and phytochemical screening of various leaves crude extracts of locally grown Thymus vulgaris. Asian Pac. J. Trop Biomed. 2013, 3, 705–710. [Google Scholar] [CrossRef] [Green Version]
- Rahimmalek, M.; Bahreininejad, B.; Khorrami, M.; Tabatabaei, B.E.S. Genetic variability and geographic differentiation in Thymus daenensis subsp. daenensis, an endangered medicinal plant, as revealed by inter simple sequence repeat (ISSR) markers. Biochem. Genet. 2009, 47, 831–842. [Google Scholar]
- Manivannan, A.; Soundararajan, P.; Park, Y.G.; Jeong, B.R. Chemical elicitor-induced modulation of antioxidant metabolism and enhancement of secondary metabolite accumulation in cell suspension cultures of Scrophularia kakudensis Franch. Int. J. Mol. Sci. 2016, 17, 399. [Google Scholar] [CrossRef]
- Al-Abd, N.M.; Nor, Z.M.; Mansor, M.; Azhar, F.; Hasan, M.S.; Kassim, M. Antioxidant, antibacterial activity, and phytochemical characterization of Melaleuca cajuputi extract. BMC Complement. Altern. Med. 2015, 15, 385–398. [Google Scholar] [CrossRef] [Green Version]
- Safaei-Ghomi, J.; Ebrahimabadi, A.H.; Djafari-Bidgoli, Z.; Batooli, H. GC/MS analysis and in vitro antioxidant activity of essential oil and methanol extracts of Thymus caramanicus Jalas and its main constituent carvacrol. Food Chem. 2009, 115, 1524–1528. [Google Scholar] [CrossRef]
- Sokmen, A.; Gulluce, M.; Akpulat, H.A.; Daferera, D.; Tepe, B.; Polissiou, M.; Sokmen, M.; Sahin, F. The in vitro antimicrobial and antioxidant activities of the essential oils and methanol extracts of endemic Thymus spathulifolius. Food Control 2004, 15, 627–634. [Google Scholar] [CrossRef]
- Mata, A.T.; Proenca, C.; Ferreira, A.R.; Serralheiro, M.L.M.; Nogueira, J.M.F.; Araujo, M.E.M. Antioxidant and antiacetylcholinesterase activities of five plants used as Portuguese food spices. Food Chem. 2007, 103, 778–786. [Google Scholar] [CrossRef]
- Rahimmalek, M.; Goli, S.A.H. Evaluation of six drying treatments with respect to essential oil yield, composition and color characteristics of Thymys daenensis subsp. daenensis. Celak leaves. Ind. Crops Prod. 2013, 42, 613–619. [Google Scholar] [CrossRef]
- Wróblewska, K.; Szumny, A.; Żarowska, B.; Kromer, K.; Dębicz, R.; Fabian, S. Impact of mulching on growth essential oil composition and its biological activity in Monarda didyma L. Ind. Crops Prod. 2019, 129, 299–308. [Google Scholar] [CrossRef]
- Russo, M.; Galletti, G.C.; Bocchini, P. Carnacini, A. Essential oil chemical composition of wild populations of italian oregano spice (Origanum vulgare ssp. hirtum (Link) Ietswaart): A preliminary evaluation of their use in chemotaxonomy by cluster analysis. 1. Inflorescences. J. Agric. Food. Chem. 1998, 46, 3741–3746. [Google Scholar] [CrossRef]
- Crocoll, C.; Asbach, J.; Novak, J.; Gershenzon, J.; Degenhardt, J. Terpene synthases of oregano (Origanum vulgare L.) and their roles in the pathway and regulation of terpene biosynthesis. Plant. Mol. Biol. 2010, 73, 587–603. [Google Scholar] [CrossRef]
- Martin, D.M.; Gershenzon, J.; Bohlmann, J. Induction of volatile terpene biosynthesis and diurnal emission by methyl jasmonate in foliage of Norway spruce. Plant Physiol. 2003, 132, 1586–1599. [Google Scholar] [CrossRef] [Green Version]
- Hampel, D.; Mosand, A.; Wüst, M. Induction of de novo volatile terpene biosynthesis via cytosolic and plastidial pathways by methyl jasmonate in foliage of Vitis vinifera L. J. Agric. Food Chem. 2005, 53, 2652–2657. [Google Scholar] [CrossRef]
- Iijima, Y. Recent advances in the application of metabolomics to studies of biogenic volatile organic compounds (BVOC) produced by plant. Metabolites 2014, 4, 699–721. [Google Scholar] [CrossRef] [Green Version]
- Jiang, A.L.; Liu, Y.N.; Liu, R.; Ren, A.; Ma, H.Y.; Shu, L.B.; Shi, L.; Zhu, J.; Zhao, M.W. Integrated proteomics and metabolomics analysis provides insights into ganoderic acid biosynthesis in response to methyl jasmonate in Ganoderma lucidum. Int. J. Mol. Sci. 2019, 20, 6116. [Google Scholar] [CrossRef] [Green Version]
- Huang, A.C.; Jiang, T.; Liu, Y.X.; Bai, Y.C.; Reed, J.; Qu, B.; Goossens, A.; Nützmann, H.W.; Bai, Y.; Osbourn, A. A specialized metabolic network selectively modulates Arabidopsis root microbiota. Science 2019, 364, 6389. [Google Scholar] [CrossRef]
- Rechinger, K.H. Flora Iranica; Verlagsanstalt Wien Austria Akademische Druke-U: Graz, Australia, 1963; Volume 158, pp. 49–71. [Google Scholar]
- Tohidi, B.; Rahimmalek, M.; Arzani, A.; Trindade, H. Sequencing and variation of terpene synthase gene (TPS2) as the major gene in biosynthesis of thymol in different Thymus species. Phytochem 2020, 1, 112–126. [Google Scholar] [CrossRef]
- Livak, K.J.; Schmittgen, T.D. Analysis of relative gene expression data using real-time quantitative PCR and the 2−ΔΔct method. Methods 2001, 25, 402–408. [Google Scholar] [CrossRef]
- Zhang, D.Y.; Yao, X.H.; Duan, M.H.; Wei, F.Y.; Wu, G.H.; Li, L. Variation of essential oil content and antioxidant activity of Lonicera species in different sites of China. Ind. Crops Prod. 2015, 77, 772–779. [Google Scholar] [CrossRef]
- Adams, R.P. Identification of essential oil components by gas chromatography/quadrupole mass spectrometry. J. Am. Soc. Mass Spectrom. 2007, 16, 1902–1903. [Google Scholar]
Real-Time Primers | Sequences (5′ to 3′) | Tm °C | Amplicon Size (bp) |
---|---|---|---|
TPS2 F TPS2 R | AACCTCGCCGAGAAACTCCC AGCTGCAGTTCGTCGAGTGT | 62 | 182 |
CYP71D178F CYP71D178R | CGACCACTGGCGCCAAATAC CGATGGTGCACACCGTCTTG | 60 | 179 |
CYP71D180F CYP71D180R | AACATCGGGTCGCGGATCAT GATGAGGCGAGCCATCTCGT | 60 | 165 |
UQ F UQ R | AAGACCTACACCAAGCCCAA AAGTGAGCCCACACTTACCA | 54 | 196 |
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations. |
© 2021 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Kianersi, F.; Pour-Aboughadareh, A.; Majdi, M.; Poczai, P. Effect of Methyl Jasmonate on Thymol, Carvacrol, Phytochemical Accumulation, and Expression of Key Genes Involved in Thymol/Carvacrol Biosynthetic Pathway in Some Iranian Thyme Species. Int. J. Mol. Sci. 2021, 22, 11124. https://doi.org/10.3390/ijms222011124
Kianersi F, Pour-Aboughadareh A, Majdi M, Poczai P. Effect of Methyl Jasmonate on Thymol, Carvacrol, Phytochemical Accumulation, and Expression of Key Genes Involved in Thymol/Carvacrol Biosynthetic Pathway in Some Iranian Thyme Species. International Journal of Molecular Sciences. 2021; 22(20):11124. https://doi.org/10.3390/ijms222011124
Chicago/Turabian StyleKianersi, Farzad, Alireza Pour-Aboughadareh, Mohammad Majdi, and Peter Poczai. 2021. "Effect of Methyl Jasmonate on Thymol, Carvacrol, Phytochemical Accumulation, and Expression of Key Genes Involved in Thymol/Carvacrol Biosynthetic Pathway in Some Iranian Thyme Species" International Journal of Molecular Sciences 22, no. 20: 11124. https://doi.org/10.3390/ijms222011124