5-Aminolevulinic Acid Attenuates Glucose-Regulated Protein 78 Expression and Hepatocyte Lipoapoptosis via Heme Oxygenase-1 Induction
Abstract
:1. Introduction
2. Results
2.1. Palmitate-Induced Steatosis
2.2. 5-ALA Attenuated GRP78 and Increased Bcl-2 Expression via Inducing HO-1 Expression
2.3. 5-ALA Decreased Caspase 3/7 Activity and Lipoapoptosis
3. Discussion
4. Materials and Methods
4.1. Reagents
4.2. Cell Lines and Cultures
4.3. RNA Extraction and Real-Time PCR
4.4. Lipid Staining
4.5. Quantification of Caspase 3/7 Activity
4.6. Quantification of Cell Death
4.7. Statistics
5. Conclusions
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Conflicts of Interest
References
- Marjot, T.; Moolla, A.; Cobbold, J.F.; Hodson, L.; Tomlinson, J.W. Nonalcoholic Fatty Liver Disease in Adults: Current Concepts in Etiology, Outcomes, and Management. Endocr. Rev. 2020, 41, 66–117. [Google Scholar] [CrossRef]
- Liu, C.J. Prevalence and risk factors for non-alcoholic fatty liver disease in Asian people who are not obese. J. Gastroenterol. Hepatol. 2012, 27, 1555–1560. [Google Scholar] [CrossRef]
- Tilg, H.; Moschen, A.R. Evolution of inflammation in nonalcoholic fatty liver disease: The multiple parallel hits hypothesis. Hepatology 2010, 52, 1836–1846. [Google Scholar] [CrossRef]
- Schwarz, D.S.; Blower, M.D. The endoplasmic reticulum: Structure, function and response to cellular signaling. Cell Mol. Life Sci. 2016, 73, 79–94. [Google Scholar] [CrossRef] [Green Version]
- Williams, C.L. Kazutoshi Mori and Peter Walter receive the 2014 Albert Lasker Basic Medical Research Award. J. Clin. Investig. 2015, 91, 469–480. [Google Scholar] [CrossRef] [Green Version]
- Moncan, M.; Mnich, K.; Blomme, A.; Almanza, A.; Samali, A.; Gorman, A.M. Regulation of lipid metabolism by the unfolded protein response. J. Cell. Mol. Med. 2021, 25, 1359–1370. [Google Scholar] [CrossRef]
- Mori, K.; Nagata, S. The unfolded protein response: The dawn of a new field. Proc. Jpn. Acad. Ser. B Phys. Biol. Sci. 2015, 91, 469–480. [Google Scholar] [CrossRef] [Green Version]
- Yoshida, H. ER stress and diseases. FEBS J. 2007, 274, 630–658. [Google Scholar] [CrossRef]
- Lin, J.H.; Walter, P.; Yen, T.S.B. Endoplasmic Reticulum Stress in Disease Pathogenesis. Annu. Rev. Pathol. Mech. Dis. 2008, 3, 399–425. [Google Scholar] [CrossRef]
- Unger, R.H.; Orci, L. Lipoapoptosis: Its mechanism and its diseases. Biochim. Biophys. Acta Mol. Cell Biol. Lipids 2002, 1585, 202–212. [Google Scholar] [CrossRef]
- Wang, S.; Kaufman, R.J. The impact of the unfolded protein response on human disease. J. Cell Biol. 2012, 197, 857–867. [Google Scholar] [CrossRef] [Green Version]
- Malhi, H.; Kaufman, R.J. Endoplasmic reticulum stress in liver disease. J. Hepatol. 2011, 54, 795–809. [Google Scholar] [CrossRef] [Green Version]
- Pagliassotti, M.J.; Kim, P.Y.; Estrada, A.L.; Stewart, C.M.; Gentile, C.L. Endoplasmic reticulum stress in obesity and obesity-related disorders: An expanded view. Metabolism 2016, 65, 1238–1246. [Google Scholar] [CrossRef] [Green Version]
- Nagahara, R.; Matono, T.; Sugihara, T.; Matsuki, Y.; Yamane, M.; Okamoto, T.; Miyoshi, K.; Nagahara, T.; Okano, J.-I.; Koda, M.; et al. Gene Expression Analysis of the Activating Factor 3/Nuclear Protein 1 Axis in a Non-alcoholic Steatohepatitis Mouse Model. Yonago Acta Med. 2019, 62, 36–46. [Google Scholar] [CrossRef] [Green Version]
- Kurumi, H.; Kanda, T.; Kawaguchi, K.; Yashima, K.; Koda, H.; Ogihara, K.; Matsushima, K.; Nakao, K.; Saito, H.; Fujiwara, Y.; et al. Protoporphyrinogen oxidase is involved in the fluorescence intensity of 5-aminolevulinic acid-mediated laser-based photodynamic endoscopic diagnosis for early gastric cancer. Photodiagnosis Photodyn. Ther. 2018, 22, 79–85. [Google Scholar] [CrossRef]
- Kang, Z.; Zhang, J.; Zhou, J.; Qi, Q.; Du, G.; Chen, J. Recent advances in microbial production of δ-aminolevulinic acid and vitamin B12. Biotechnol. Adv. 2012, 30, 1533–1542. [Google Scholar] [CrossRef]
- Liu, C.; Zhu, P.; Fujino, M.; Isaka, Y.; Ito, H.; Takahashi, K.; Nakajima, M.; Tanaka, T.; Zhuang, J.; Li, X.-K. 5-aminolaevulinic acid (ALA), enhances heme oxygenase (HO)-1 expression and attenuates tubulointerstitial fibrosis and renal apoptosis in chronic cyclosporine nephropathy. Biochem. Biophys. Res. Commun. 2019, 508, 583–589. [Google Scholar] [CrossRef]
- Ito, H.; Nishio, Y.; Hara, T.; Sugihara, H.; Tanaka, T.; Li, X.-K. Oral administration of 5-aminolevulinic acid induces heme oxygenase-1 expression in peripheral blood mononuclear cells of healthy human subjects in combination with ferrous iron. Eur. J. Pharmacol. 2018, 833, 25–33. [Google Scholar] [CrossRef]
- Nishio, Y.; Fujino, M.; Zhao, M.; Ishii, T.; Ishizuka, M.; Ito, H.; Takahashi, K.; Abe, F.; Nakajima, M.; Tanaka, T.; et al. 5-Aminolevulinic acid combined with ferrous iron enhances the expression of heme oxygenase-1. Int. Immunopharmacol. 2014, 19, 300–307. [Google Scholar] [CrossRef]
- Duvigneau, J.C.; Esterbauer, H.; Kozlov, A.V. Role of Heme Oxygenase as a Modulator of Heme-Mediated Pathways. Antioxidants 2019, 8, 475. [Google Scholar] [CrossRef] [Green Version]
- Ryter, S.W.; Alam, J.; Choi, A.M.K. Heme Oxygenase-1/Carbon Monoxide: From Basic Science to Therapeutic Applications. Physiol. Rev. 2006, 86, 583–650. [Google Scholar] [CrossRef]
- Inoue, K.; Takahashi, T.; Uehara, K.; Shimuzu, H.; Ido, K.; Morimatsu, H.; Omori, E.; Katayama, H.; Akagi, R.; Morita, K. Protective role of heme oxygenase 1 in the intestinal tissue injury in hemorrhagic shock in rats. Shock 2008, 29, 252–261. [Google Scholar] [CrossRef]
- Gao, Z.; Han, Y.; Hu, Y.; Wu, X.; Wang, Y.; Zhang, X.; Fu, J.; Zou, X.; Zhang, J.; Chen, X.; et al. Targeting HO-1 by Epigallocatechin-3-Gallate Reduces Contrast-Induced Renal Injury via Anti-Oxidative Stress and Anti-Inflammation Pathways. PLoS ONE 2016, 11, e0149032. [Google Scholar] [CrossRef] [Green Version]
- Malaguarnera, L.; Madeddu, R.; Palio, E.; Arena, N.; Malaguarnera, M. Heme oxygenase-1 levels and oxidative stress-related parameters in non-alcoholic fatty liver disease patients. J. Hepatol. 2005, 42, 585–591. [Google Scholar] [CrossRef]
- Maamoun, H.; Zachariah, M.; McVey, J.; Green, F.R.; Agouni, A. Heme oxygenase (HO)-1 induction prevents Endoplasmic Reticulum stress-mediated endothelial cell death and impaired angiogenic capacity. Biochem. Pharmacol. 2017, 127, 46–59. [Google Scholar] [CrossRef]
- Teixidor, P.; Arráez, M.; Villalba, G.; Garcia, R.; Tardáguila, M.; González, J.J.; Rimbau, J.; Vidal, X.; Montané, E. Safety and Efficacy of 5-Aminolevulinic Acid for High Grade Glioma in Usual Clinical Practice: A Prospective Cohort Study. PLoS ONE 2016, 11, e0149244. [Google Scholar] [CrossRef] [Green Version]
- Hadjipanayis, C.; Stummer, W. 5-ALA and FDA Approved for Glimoa Surgery. Physiol. Behav. 2017, 141, 479–486. [Google Scholar] [CrossRef]
- Zhang, X.-Q.; Xu, C.-F.; Yu, C.-H.; Chen, W.-X.; Li, Y.-M. Role of endoplasmic reticulum stress in the pathogenesis of nonalcoholic fatty liver disease. World J. Gastroenterol. 2014, 21, 1768–1776. [Google Scholar] [CrossRef]
- Minamino, T.; Komuro, I.; Kitakaze, M. Endoplasmic Reticulum Stress as a Therapeutic Target in Cardiovascular Disease. Circ. Res. 2010, 107, 1071–1082. [Google Scholar] [CrossRef]
- Loboda, A.; Damulewicz, M.; Pyza, E.; Jozkowicz, A.; Dulak, J. Role of Nrf2/HO-1 system in development, oxidative stress response and diseases: An evolutionarily conserved mechanism. Cell. Mol. Life Sci. 2016, 73, 3221–3247. [Google Scholar] [CrossRef] [Green Version]
- Ogawa, K.; Sun, J.; Taketani, S.; Nakajima, O.; Nishitani, C.; Sassa, S.; Hayashi, N.; Yamamoto, M.; Shibahara, S.; Fujita, H.; et al. Heme mediates derepression of Maf recognition element through direct binding to transcription repressor Bach1. EMBO J. 2001, 20, 2835–2843. [Google Scholar] [CrossRef] [Green Version]
- Yu, J.; Chu, E.S.; Wang, R.; Wang, S.; Wu, C.W.; Wong, V.W.; Chan, H.L.; Farrell, G.C.; Sung, J.J.Y. Heme Oxygenase-1 Protects Against Steatohepatitis in Both Cultured Hepatocytes and Mice. Gastroenterology 2010, 138, 694–704. [Google Scholar] [CrossRef]
- Wang, R.Q.; Nan, Y.M.; Wu, W.J.; Kong, L.B.; Han, F.; Zhao, S.X.; Kong, L.; Yu, J. Induction of heme oxygenase-1 protects against nutritional fibrosing steatohepatitis in mice. Lipids Health Dis. 2011, 10, 31. [Google Scholar] [CrossRef] [Green Version]
- Quinones, Q.J.; de Ridder, G.G.; Pizzo, S.V. GRP78: A chaperone with diverse roles beyond the endoplasmic reticulum. Histol. Histopathol. 2008, 23, 1409–1416. [Google Scholar] [CrossRef]
- Shen, X.; Zhang, K.; Kaufman, R.J. The unfolded protein response—A stress signaling pathway of the endoplasmic reticulum. J. Chem. Neuroanat. 2004, 28, 79–92. [Google Scholar] [CrossRef] [PubMed]
- Nishitoh, H. CHOP is a multifunctional transcription factor in the ER stress response. J. Biochem. 2012, 151, 217–219. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Zhang, Y.; Miao, L.; Zhang, H.; Wu, G.; Zhang, Z.; Lv, J. Chlorogenic acid against palmitic acid in endoplasmic reticulum stress-mediated apoptosis resulting in protective effect of primary rat hepatocytes. Lipids Health Dis. 2018, 17, 270. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Chen, Z.; Lei, L.; Wen, D.; Yang, L. Melatonin attenuates palmitic acid-induced mouse granulosa cells apoptosis via endoplasmic reticulum stress. J. Ovarian Res. 2019, 12, 43. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Yetti, H.; Naito, H.; Jia, X.; Shindo, M.; Taki, H.; Tamada, H.; Kitamori, K.; Hayashi, Y.; Ikeda, K.; Yamori, Y.; et al. High-fat-cholesterol diet mainly induced necrosis in fibrotic steatohepatitis rat by suppressing caspase activity. Life Sci. 2013, 93, 673–680. [Google Scholar] [CrossRef] [PubMed]
- Huang, J.; Wan, L.; Lu, H.; Li, X. High expression of active ATF6 aggravates endoplasmic reticulum stress-induced vascular endothelial cell apoptosis through the mitochondrial apoptotic pathway. Mol. Med. Rep. 2018, 17, 6483–6489. [Google Scholar] [CrossRef] [PubMed]
- Pihán, P.; Carreras-Sureda, A.; Hetz, C. BCL-2 family: Integrating stress responses at the ER to control cell demise. Cell Death Differ. 2017, 24, 1478–1487. [Google Scholar] [CrossRef] [Green Version]
- Martinou, J.-C.; Dubois-Dauphin, M.; Staple, J.K.; Rodriguez, I.; Frankowski, H.; Missotten, M.; Albertini, P.; Talabot, D.; Catsicas, S.; Pietra, C. Overexpression of BCL-2 in transgenic mice protects neurons from naturally occurring cell death and experimental ischemia. Neuron 1994, 13, 1017–1030. [Google Scholar] [CrossRef]
- Islam, A.; Noguchi, Y.; Taniguchi, S.; Yonekura, S. Protective effects of 5-aminolevulinic acid on heat stress in bovine mammary epithelial cells. Anim. Biosci. 2021, 34, 1006–1013. [Google Scholar] [CrossRef]
- Sharmin, M.; Islam, A.; Yamamoto, I.; Taniguchi, S.; Yonekura, S. 5-ALA Attenuates the Palmitic Acid-Induced ER Stress and Apoptosis in Bovine Mammary Epithelial Cells. Molecules 2021, 26, 1183. [Google Scholar] [CrossRef] [PubMed]
- Ji, H.; Xiao, F.; Li, S.; Wei, R.; Yu, F.; Xu, J. GRP78 effectively protect hypoxia/reperfusion-induced myocardial apoptosis via promotion of the Nrf2/HO-1 signaling pathway. J. Cell. Physiol. 2021, 236, 1228–1236. [Google Scholar] [CrossRef] [PubMed]
- Chang, Y.-J.; Chen, W.-Y.; Huang, C.-Y.; Liu, H.-H.; Wei, P.-L. Glucose-regulated protein 78 (GRP78) regulates colon cancer metastasis through EMT biomarkers and the NRF-2/HO-1 pathway. Tumor Biol. 2015, 36, 1859–1869. [Google Scholar] [CrossRef] [PubMed]
- Chang, S.-H.; Barbosa-Tessmann, I.P.; Chen, C.; Kilberg, M.S.; Agarwal, A. Glucose Deprivation Induces Heme Oxygenase-1 Gene Expression by a Pathway Independent of the Unfolded Protein Response. J. Biol. Chem. 2002, 277, 1933–1940. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Kim, H.; Baek, C.H.; Lee, R.B.; Chang, J.W.; Yang, W.S.; Lee, S.K. Anti-Fibrotic Effect of Losartan, an Angiotensin II Receptor Blocker, Is Mediated through Inhibition of ER Stress via Up-Regulation of SIRT1, Followed by Induction of HO-1 and Thioredoxin. Int. J. Mol. Sci. 2017, 18, 305. [Google Scholar] [CrossRef]
- Müller, F.; Sturla, S.J. Human in vitro models of nonalcoholic fatty liver disease. Curr. Opin. Toxicol. 2019, 16, 9–16. [Google Scholar] [CrossRef]
- Malhi, H.; Bronk, S.F.; Werneburg, N.W.; Gores, G.J. Free Fatty Acids Induce JNK-dependent Hepatocyte Lipoapoptosis. J. Biol. Chem. 2006, 281, 12093–12101. [Google Scholar] [CrossRef] [Green Version]
- Liu, X.; Henkel, A.S.; LeCuyer, B.E.; Schipma, M.J.; Anderson, K.A.; Green, R.M. Hepatocyte X-box binding protein 1 deficiency increases liver injury in mice fed a high-fat/sugar diet. Am. J. Physiol. Liver Physiol. 2015, 309, G965–G974. [Google Scholar] [CrossRef] [PubMed] [Green Version]
Gene | Fwd (5′ to 3′) | Rev (5′ to 3′) |
---|---|---|
NRF2 | CAGCGACGGAAAGAGTATGA | TGGGCAACCTGGGAGTAG |
HO-1 | GCCAGCAACAAAGTGCAAG | GAGTGTAAGGACCCATCGGA |
GRP78 | AAGGGGAACGTCTGATTGGC | TGGATGAGGAAAACCGGTCG |
ATF6 | TCCTCGGTCAGTGGACTCTTA | CTTGGGCTGAATTGAAGGTTTTG |
PERK | GGAAACGAGAGCCGGATTTATT | ACTATGTCCATTATGGCAGCTTC |
IRE1 | GCCGAAGTTCAGATGGAATC | ATCTGCAAAGGCCGATGA |
CHOP | CCTCTGCCGTATCACCACAG | GGGCTGTGCTGCTCTTTAGA |
BCL-2 | CTGGTGGGAGCTTGCATCAC | ACAGCCTGCAGCTTTGTTTC |
β-Actin | GCATCCTCACCCTGAAGTA | TGTGGTGCCAGATTTTCTCC |
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations. |
© 2021 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Hashimoto, T.; Sugihara, T.; Kanda, T.; Takata, T.; Isomoto, H. 5-Aminolevulinic Acid Attenuates Glucose-Regulated Protein 78 Expression and Hepatocyte Lipoapoptosis via Heme Oxygenase-1 Induction. Int. J. Mol. Sci. 2021, 22, 11405. https://doi.org/10.3390/ijms222111405
Hashimoto T, Sugihara T, Kanda T, Takata T, Isomoto H. 5-Aminolevulinic Acid Attenuates Glucose-Regulated Protein 78 Expression and Hepatocyte Lipoapoptosis via Heme Oxygenase-1 Induction. International Journal of Molecular Sciences. 2021; 22(21):11405. https://doi.org/10.3390/ijms222111405
Chicago/Turabian StyleHashimoto, Takaaki, Takaaki Sugihara, Tsutomu Kanda, Tomoaki Takata, and Hajime Isomoto. 2021. "5-Aminolevulinic Acid Attenuates Glucose-Regulated Protein 78 Expression and Hepatocyte Lipoapoptosis via Heme Oxygenase-1 Induction" International Journal of Molecular Sciences 22, no. 21: 11405. https://doi.org/10.3390/ijms222111405