Anthocyanin Extract from Purple Sweet Potato Exacerbate Mitophagy to Ameliorate Pyroptosis in Klebsiella pneumoniae Infection
Abstract
:1. Introduction
2. Results
2.1. PSPAs Decreased Mortality Rates of KP–Infected Mice
2.2. PSPAs Reduced Lung Injury and Inflammatory Responses in Mice Infected with KP
2.3. PSPAs Attenuated KP-Induced Pyroptsis in AMs
2.4. PSPAs Suppresses NLRP3 Inflammasome Activation and Mitochondrial Dysfunction Induced by KP
2.5. PSPAs Ameliorates Mitochondrial Dysfunction through Mitophagy to Inhibit KP-Induced Pyroptosis
2.6. Nrf2 Is Required in PSPAs-Induced Mitophagy in AMs
3. Discussion
4. Material and Methods
4.1. Mice
4.2. Primary Cells and Cell Lines
4.3. Bacteria Preparation and Infection Experiments
4.4. Histological Analysis
4.5. Inflammatory Cytokine Profiling
4.6. The Protein Concentration of Lung Lavage Samples
4.7. Lung W/D Weight Ratio
4.8. MPO Activity Assay
4.9. Bacterial Burden Assay
4.10. Polymorphonuclear Cell Counts in Peripheral Blood
4.11. Transfection of Small Interfering RNA, Plasmids, and Inhibitors
4.12. RNA Isolation and Quantitative Real-Time PCR
4.13. mtDNA Content
4.14. MTT Assay
4.15. Mitochondrial Potential Assay
4.16. Measurement of mtROS Production
4.17. Immunoblotting
4.18. LC3 Puncta Observation
4.19. Flow Cytometry Assay
4.20. Statistical Analysis
5. Conclusions
Supplementary Materials
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Martin, R.M.; Bachman, M.A. Colonization, infection, and the accessory genome of klebsiella pneumoniae. Front. Cell. Infect. Microbiol. 2018, 8, 4. [Google Scholar] [CrossRef] [Green Version]
- Ashurst, J.V.; Dawson, A. Klebsiella pneumonia. In StatPearls; StatPearls Publishing: Treasure Island, FL, USA, 2021. [Google Scholar]
- Hauck, C.; Cober, E.; Richter, S.S.; Perez, F.; Salata, R.A.; Kalayjian, R.C.; Watkins, R.R.; Scalera, N.M.; Doi, Y.; Kaye, K.S.; et al. Spectrum of excess mortality due to carbapenem-resistant Klebsiella pneumoniae infections. Clin. Microbiol. Infect. 2016, 22, 513–519. [Google Scholar] [CrossRef] [Green Version]
- Zhang, Y.; Yao, Z.; Zhan, S.; Yang, Z.; Wei, D.; Zhang, J.; Li, J.; Kyaw, M.H. Disease burden of intensive care unit-acquired pneumonia in China: A systematic review and meta-analysis. Int. J. Infect. Dis. 2014, 29, 84–90. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Zhang, Y.; Wang, Q.; Yin, Y.; Chen, H.; Jin, L.; Gu, B.; Xie, L.; Yang, C.; Ma, X.; Li, H.; et al. Epidemiology of carbapenem-resistant enterobacteriaceae infections: Report from the China CRE network. Antimicrob. Agents Chemother. 2018, 62, e01882-17. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Tiri, B.; Sensi, E.; Marsiliani, V.; Cantarini, M.; Priante, G.; Vernelli, C.; Martella, L.A.; Costantini, M.; Mariottini, A.; Andreani, P.; et al. Antimicrobial stewardship program, COVID-19, and infection control: Spread of carbapenem-resistant Klebsiella pneumoniae colonization in ICU COVID-19 patients. What did not work? J. Clin. Med. 2020, 9, 2744. [Google Scholar] [CrossRef] [PubMed]
- Szijarto, V.; Guachalla, L.M.; Hartl, K.; Varga, C.; Badarau, A.; Mirkina, I.; Visram, Z.C.; Stulik, L.; Power, C.A.; Nagy, E.; et al. Endotoxin neutralization by an O-antigen specific monoclonal antibody: A potential novel therapeutic approach against Klebsiella pneumoniae ST258. Virulence 2017, 8, 1203–1215. [Google Scholar] [CrossRef] [Green Version]
- Zhu, P.; Bu, H.; Tan, S.; Liu, J.; Yuan, B.; Dong, G.; Wang, M.; Jiang, Y.; Zhu, H.; Li, H.; et al. A novel cochlioquinone derivative, CoB1, regulates autophagy in Pseudomonas aeruginosa infection through the PAK1/Akt1/mTOR signaling pathway. J. Immunol. 2020, 205, 1293–1305. [Google Scholar] [CrossRef]
- Li, R.; Tan, S.; Yu, M.; Jundt, M.C.; Zhang, S.; Wu, M. Annexin A2 regulates autophagy in pseudomonas aeruginosa infection through the Akt1-mTOR-ULK1/2 signaling pathway. J. Immunol. 2015, 195, 3901–3911. [Google Scholar] [CrossRef] [Green Version]
- Gonzalez-Ferrer, S.; Penaloza, H.F.; Budnick, J.A.; Bain, W.G.; Nordstrom, H.R.; Lee, J.S.; Van Tyne, D. Finding order in the chaos: Outstanding questions in Klebsiella pneumoniae pathogenesis. Infect. Immun. 2021, 89, e00693-20. [Google Scholar] [CrossRef]
- Bengoechea, J.A.; Sa Pessoa, J. Klebsiella pneumoniae infection biology: Living to counteract host defences. FEMS Microbiol. Rev. 2019, 43, 123–144. [Google Scholar] [CrossRef] [Green Version]
- You, H.S.; Lee, S.H.; Kang, S.S.; Hyun, S.H. OmpA of Klebsiella pneumoniae ATCC 13883 induces pyroptosis in HEp-2 cells, leading to cell-cycle arrest and apoptosis. Microbes Infect. 2020, 22, 432–440. [Google Scholar] [CrossRef] [PubMed]
- Kovarova, M.; Hesker, P.R.; Jania, L.; Nguyen, M.; Snouwaert, J.N.; Xiang, Z.; Lommatzsch, S.E.; Huang, M.T.; Ting, J.P.Y.; Koller, B.H. NLRP1-dependent pyroptosis leads to acute lung injury and morbidity in mice. J. Immunol. 2012, 189, 2006–2016. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Wu, D.D.; Pan, P.H.; Liu, B.; Su, X.L.; Zhang, L.M.; Tan, H.Y.; Cao, Z.; Zhou, Z.R.; Li, H.T.; Li, H.S.; et al. Inhibition of alveolar macrophage pyroptosis reduces lipopolysaccharide-induced acute lung injury in mice. Chin. Med. J. 2015, 128, 2638–2645. [Google Scholar] [CrossRef] [PubMed]
- Mai, C.T.; Wu, M.M.; Wang, C.L.; Su, Z.R.; Cheng, Y.Y.; Zhang, X.J. Palmatine attenuated dextran sulfate sodium (DSS)-induced colitis via promoting mitophagy-mediated NLRP3 inflammasome inactivation. Mol. Immunol. 2019, 105, 76–85. [Google Scholar] [CrossRef]
- Kang, R.; Zeng, L.; Xie, Y.; Yan, Z.; Zhou, B.; Cao, L.; Klionsky, D.J.; Tracey, K.J.; Li, J.; Wang, H.; et al. A novel PINK1- and PARK2-dependent protective neuroimmune pathway in lethal sepsis. Autophagy 2016, 12, 2374–2385. [Google Scholar] [CrossRef] [Green Version]
- Atanasov, A.G.; Waltenberger, B.; Pferschy-Wenzig, E.M.; Linder, T.; Wawrosch, C.; Uhrin, P.; Temml, V.; Wang, L.; Schwaiger, S.; Heiss, E.H.; et al. Discovery and resupply of pharmacologically active plant-derived natural products: A review. Biotechnol. Adv. 2015, 33, 1582–1614. [Google Scholar] [CrossRef] [Green Version]
- Timalsina, D.A.-O.; Pokhrel, K.A.-O.; Bhusal, D.A.-O. Pharmacologic activities of plant-derived natural products on respiratory diseases and inflammations. BioMed Res. Int. 2021, 2021, 1636816. [Google Scholar] [CrossRef]
- Van Vuuren, S.; Holl, D. Antimicrobial natural product research: A review from a South African perspective for the years 2009–2016. J. Ethnopharmacol. 2017, 208, 236–252. [Google Scholar] [CrossRef] [PubMed]
- Langeder, J.; Grienke, U.; Chen, Y.; Kirchmair, J.; Schmidtke, M.; Rollinger, J.M. Natural products against acute respiratory infections: Strategies and lessons learned. J. Ethnopharmacol. 2020, 248, 112298. [Google Scholar] [CrossRef] [PubMed]
- Bovell-Benjamin, A.C. Sweet potato: A review of its past, present, and future role in human nutrition. Adv. Food Nutr. Res. 2007, 52, 1–59. [Google Scholar]
- Truong, V.D.; Deighton, N.; Thompson, R.T.; McFeeters, R.F.; Dean, L.O.; Pecota, K.V.; Yencho, G.C. Characterization of anthocyanins and anthocyanidins in purple-fleshed sweetpotatoes by HPLC-DAD/ESI-MS/MS. J. Agric. Food Chem. 2010, 58, 404–410. [Google Scholar] [CrossRef] [PubMed]
- Li, A.; Xiao, R.; He, S.; An, X.; He, Y.A.-O.; Wang, C.; Yin, S.; Wang, B.; Shi, X.; He, J. Research advances of purple sweet potato anthocyanins: Extraction, identification, stability, bioactivity, application, and biotransformation. Molecules 2019, 24, 3816. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Mattioli, R.; Francioso, A.; Mosca, L.; Silva, P. Anthocyanins: A comprehensive review of their chemical properties and health effects on cardiovascular and neurodegenerative diseases. Molecules 2020, 25, 3809. [Google Scholar] [CrossRef] [PubMed]
- Yahfoufi, N.; Alsadi, N.; Jambi, M.; Matar, C. The immunomodulatory and anti-inflammatory role of polyphenols. Nutrients 2018, 10, 1618. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Holmström, K.M.; Kostov, R.V.; Dinkova-Kostova, A.T. The multifaceted role of Nrf2 in mitochondrial function. Curr. Opin. Toxicol. 2016, 1, 80–91. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Luo, Z.L.; Sun, H.Y.; Wu, X.B.; Cheng, L.; Ren, J.A.-O. Epigallocatechin-3-gallate attenuates acute pancreatitis induced lung injury by targeting mitochondrial reactive oxygen species triggered NLRP3 inflammasome activation. Food Funct. 2021, 12, 5658–5667. [Google Scholar] [CrossRef] [PubMed]
- Wu, D.; Zhang, H.; Wu, Q.; Li, F.; Wang, Y.; Liu, S.; Wang, J. Sestrin 2 protects against LPS-induced acute lung injury by inducing mitophagy in alveolar macrophages. Life Sci. 2021, 267, 118941. [Google Scholar] [CrossRef] [PubMed]
- Sogo, T.; Terahara, N.; Hisanaga, A.; Kumamoto, T.; Yamashiro, T.; Wu, S.; Sakao, K.; Hou, D.X. Anti-inflammatory activity and molecular mechanism of delphinidin 3-sambubioside, a Hibiscus anthocyanin. Biofactors 2015, 41, 58–65. [Google Scholar] [CrossRef] [PubMed]
- Qian, Q.; Cao, X.; Wang, B.; Dong, X.; Pei, J.; Xue, L.; Feng, F. Endoplasmic reticulum stress potentiates the autophagy of alveolar macrophage to attenuate acute lung injury and airway inflammation. Cell Cycle 2020, 19, 567–576. [Google Scholar] [CrossRef] [PubMed]
- Neupane, A.S.; Willson, M.; Chojnacki, A.K.; Vargas, E.S.C.F.; Morehouse, C.; Carestia, A.; Keller, A.E.; Peiseler, M.; DiGiandomenico, A.; Kelly, M.M.; et al. Patrolling alveolar macrophages conceal bacteria from the immune system to maintain homeostasis. Cell 2020, 183, 110–125. [Google Scholar] [CrossRef] [PubMed]
- Willingham, S.B.; Allen, I.C.; Bergstralh, D.T.; Brickey, W.J.; Huang, M.T.; Taxman, D.J.; Duncan, J.A.; Ting, J.P. NLRP3 (NALP3, Cryopyrin) facilitates in vivo caspase-1 activation, necrosis, and HMGB1 release via inflammasome-dependent and -independent pathways. J. Immunol. 2009, 183, 2008–2015. [Google Scholar] [CrossRef] [PubMed]
- Yue, L.; Yao, H. Mitochondrial dysfunction in inflammatory responses and cellular senescence: Pathogenesis and pharmacological targets for chronic lung diseases. Br. J. Pharmacol. 2016, 173, 2305–2318. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- West, A.P.; Shadel, G.S. Mitochondrial DNA in innate immune responses and inflammatory pathology. Nat. Rev. Immunol. 2017, 17, 363–375. [Google Scholar] [CrossRef] [PubMed]
- Youle, R.J.; Narendra, D.P. Mechanisms of mitophagy. Nat. Rev. Mol. Cell Biol. 2011, 12, 9–14. [Google Scholar] [CrossRef] [PubMed]
- Eiyama, A.; Okamoto, K. PINK1/Parkin-mediated mitophagy in mammalian cells. Curr. Opin. Cell Biol. 2015, 33, 95–101. [Google Scholar] [CrossRef] [PubMed]
- Speciale, A.; Saija, A.; Bashllari, R.; Molonia, M.S.; Muscara, C.; Occhiuto, C.; Cimino, F.; Cristani, M. Anthocyanins as modulators of cell redox-dependent pathways in non-communicable diseases. Curr. Med. Chem. 2020, 27, 1955–1996. [Google Scholar] [CrossRef] [PubMed]
- Riis, S.; Murray, J.B.; O’Connor, R. IGF-1 signalling regulates mitochondria dynamics and turnover through a conserved GSK-3beta-Nrf2-BNIP3 pathway. Cells 2020, 9, 147. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Speer, H.; D’Cunha, N.M.; Alexopoulos, N.I.; McKune, A.J.; Naumovski, N. Anthocyanins and human health-a focus on oxidative stress, inflammation and disease. Antioxidants 2020, 9, 366. [Google Scholar] [CrossRef] [PubMed]
- Kozlowska, A.; Dzierzanowski, T. Targeting inflammation by anthocyanins as the novel therapeutic potential for chronic diseases: An update. Molecules 2021, 26, 4380. [Google Scholar] [CrossRef] [PubMed]
- Jiang, T.; Zhou, J.; Liu, W.; Tao, W.; He, J.; Jin, W.; Guo, H.; Yang, N.; Li, Y. The anti-inflammatory potential of protein-bound anthocyanin compounds from purple sweet potato in LPS-induced RAW264.7 macrophages. Food Res. Int. 2020, 137, 109647. [Google Scholar] [CrossRef] [PubMed]
- Yan, X.; Wu, L.; Li, B.; Meng, X.; Dai, H.; Zheng, Y.; Fu, J. Cyanidin-3-O-glucoside attenuates acute lung injury in sepsis rats. J. Surg. Res. 2015, 199, 592–600. [Google Scholar] [CrossRef] [PubMed]
- Liang, Y.D.; Bai, W.J.; Li, C.G.; Xu, L.H.; Wei, H.X.; Pan, H.; He, X.H.; Ouyang, D.Y. Piperine suppresses pyroptosis and interleukin-1beta release upon ATP triggering and bacterial infection. Front. Pharmacol. 2016, 7, 390. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Han, X.; Xu, T.; Fang, Q.; Zhang, H.; Yue, L.; Hu, G.; Sun, L. Quercetin hinders microglial activation to alleviate neurotoxicity via the interplay between NLRP3 inflammasome and mitophagy. Redox. Biol. 2021, 44, 102010. [Google Scholar] [CrossRef] [PubMed]
- Zhang, Y.; Liang, D.; Dong, L.; Ge, X.; Xu, F.; Chen, W.; Dai, Y.; Li, H.; Zou, P.; Yang, S.; et al. Anti-inflammatory effects of novel curcumin analogs in experimental acute lung injury. Respir. Res. 2015, 16, 43. [Google Scholar] [CrossRef] [Green Version]
- FitzGerald, E.S.; Luz, N.F.; Jamieson, A.M. Competitive cell death interactions in pulmonary infection: Host modulation versus pathogen manipulation. Front. Immunol. 2020, 11, 814. [Google Scholar] [CrossRef] [PubMed]
- Mohsin, M.; Tabassum, G.; Ahmad, S.; Ali, S.; Ali Syed, M. The role of mitophagy in pulmonary sepsis. Mitochondrion 2021, 59, 63–75. [Google Scholar] [CrossRef] [PubMed]
- Zhou, Y.; Wang, S.; Wan, T.; Huang, Y.; Pang, N.; Jiang, X.; Gu, Y.; Zhang, Z.; Luo, J.; Yang, L. Cyanidin-3-O-beta-glucoside inactivates NLRP3 inflammasome and alleviates alcoholic steatohepatitis via SirT1/NF-kappaB signaling pathway. Free Radic. Biol. Med. 2020, 160, 334–341. [Google Scholar] [CrossRef]
- Li, X.; Shi, Z.; Zhu, Y.; Shen, T.; Wang, H.; Shui, G.; Loor, J.J.; Fang, Z.; Chen, M.; Wang, X.; et al. Cyanidin-3-O-glucoside improves non-alcoholic fatty liver disease by promoting PINK1-mediated mitophagy in mice. Br. J. Pharmacol. 2020, 177, 3591–3607. [Google Scholar] [CrossRef]
- Liu, H.; You, L.; Wu, J.; Zhao, M.; Guo, R.; Zhang, H.; Su, R.; Mao, Q.; Deng, D.; Hao, Y. Berberine suppresses influenza virus-triggered NLRP3 inflammasome activation in macrophages by inducing mitophagy and decreasing mitochondrial ROS. J. Leukoc. Biol. 2020, 108, 253–266. [Google Scholar] [CrossRef]
- Aboonabi, A.; Aboonabi, A. Anthocyanins reduce inflammation and improve glucose and lipid metabolism associated with inhibiting nuclear factor-kappaB activation and increasing PPAR-gamma gene expression in metabolic syndrome subjects. Free Radic. Biol. Med. 2020, 150, 30–39. [Google Scholar] [CrossRef]
- Dorrington, M.G.; Fraser, I.D.C. NF-kappaB signaling in macrophages: Dynamics, crosstalk, and signal integration. Front. Immunol. 2019, 10, 705. [Google Scholar] [CrossRef]
- Murata, H.; Takamatsu, H.; Liu, S.; Kataoka, K.; Huh, N.H.; Sakaguchi, M. NRF2 regulates PINK1 expression under oxidative stress conditions. PLoS ONE 2015, 10, e0142438. [Google Scholar] [CrossRef] [PubMed]
- Gunne, S.; Heinicke, U.; Parnham, M.J.; Laux, V.; Zacharowski, K.; von Knethen, A. Nrf2—A molecular target for sepsis patients in critical care. Biomolecules 2020, 10, 1688. [Google Scholar] [CrossRef] [PubMed]
- Sun, J.; Zhu, H.; Wang, X.; Gao, Q.; Li, Z.; Huang, H. CoQ10 ameliorates mitochondrial dysfunction in diabetic nephropathy through mitophagy. J. Endocrinol. 2019, 240, 445–465. [Google Scholar] [CrossRef]
- Li, R.A.-O.; Fang, L.A.-O.X.; Pu, Q.; Bu, H.; Zhu, P.; Chen, Z.; Yu, M.; Li, X.; Weiland, T.; Bansal, A.; et al. MEG3-4 is a miRNA decoy that regulates IL-1β abundance to initiate and then limit inflammation to prevent sepsis during lung infection. Sci. Signal. 2018, 11, eaao2387. [Google Scholar] [CrossRef] [Green Version]
- Cao, F.; Tian, X.; Li, Z.; Lv, Y.; Han, J.; Zhuang, R.; Cheng, B.; Gong, Y.; Ying, B.; Jin, S.; et al. Suppression of NLRP3 inflammasome by erythropoietin via the EPOR/JAK2/STAT3 pathway contributes to attenuation of acute lung injury in mice. Front. Pharmacol. 2020, 19, 306. [Google Scholar] [CrossRef]
- Zhou, Y.; Li, P.; Goodwin, A.J.; Cook, J.A.; Halushka, P.V.; Chang, E.; Zingarelli, B.; Fan, H.A.-O. Exosomes from endothelial progenitor cells improve outcomes of the lipopolysaccharide-induced acute lung injury. Crit Care 2019, 23, 44. [Google Scholar] [CrossRef] [Green Version]
- Shi, Y.A.-O.; Zhao, Q.Q.; Liu, X.S.; Dong, S.H.; E, J.F.; Li, X.; Liu, C.; Wang, H.A.-O. Toll-like receptor 4 regulates spontaneous intestinal tumorigenesis by up-regulating IL-6 and GM-CSF. J. Cell. Mol. Med. 2020, 24, 385–397. [Google Scholar] [CrossRef] [Green Version]
- Wang, X.; Zhang, J.Q.; Xiu, C.K.; Yang, J.; Fang, J.Y.; Lei, Y. Ginseng-Sanqi-Chuanxiong (GSC) Extracts ameliorate diabetes-induced endothelial cell senescence through regulating mitophagy via the AMPK pathway. Oxid. Med. Cell Longev. 2020, 2020, 7151946. [Google Scholar] [CrossRef]
- Bu, H.; Tan, S.; Yuan, B.; Huang, X.; Jiang, J.; Wu, Y.; Jiang, J.; Li, R. Therapeutic potential of IBP as an autophagy inducer for treating lung cancer via blocking PAK1/Akt/mTOR signaling. Mol. Ther. Oncolytics 2020, 20, 82–93. [Google Scholar] [CrossRef] [PubMed]
- Chen, Y.; Chen, H.N.; Wang, K.; Zhang, L.; Huang, Z.; Liu, J.; Zhang, Z.; Luo, M.; Lei, Y.; Peng, Y.; et al. Ketoconazole exacerbates mitophagy to induce apoptosis by downregulating cyclooxygenase-2 in hepatocellular carcinoma. J. Hepatol. 2019, 70, 66–77. [Google Scholar] [CrossRef] [PubMed]
- Cheng, Y.A.-O.X.; Chu, L.W.; Chen, J.Y.; Hsieh, S.L.; Chang, Y.C.; Dai, Z.K.; Wu, B.A.-O. Loganin attenuates high glucose-induced schwann cells pyroptosis by inhibiting ROS generation and NLRP3 inflammasome activation. Cells 2020, 9, 1948. [Google Scholar] [CrossRef] [PubMed]
- Wang, Y.; Gao, W.; Shi, X.; Ding, J.; Liu, W.; He, H.; Wang, K.; Shao, F. Chemotherapy drugs induce pyroptosis through caspase-3 cleavage of a gasdermin. Nature 2017, 547, 99–103. [Google Scholar] [CrossRef] [PubMed]
Gene | Primer |
---|---|
PINK1 | Forward primer: ccccacaccctaacatcatc |
Reverse primer: actgggagtctgctcctcaa | |
Gapdh | Forward primer: caaggctgagaatgggaagc |
Reverse primer: gaagacgccagtagactcca | |
ND2 | Forward primer: cccattccacttctgattacc |
Reverse primer: atgatagtagagttgagtagcg |
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations. |
© 2021 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Dong, G.; Xu, N.; Wang, M.; Zhao, Y.; Jiang, F.; Bu, H.; Liu, J.; Yuan, B.; Li, R. Anthocyanin Extract from Purple Sweet Potato Exacerbate Mitophagy to Ameliorate Pyroptosis in Klebsiella pneumoniae Infection. Int. J. Mol. Sci. 2021, 22, 11422. https://doi.org/10.3390/ijms222111422
Dong G, Xu N, Wang M, Zhao Y, Jiang F, Bu H, Liu J, Yuan B, Li R. Anthocyanin Extract from Purple Sweet Potato Exacerbate Mitophagy to Ameliorate Pyroptosis in Klebsiella pneumoniae Infection. International Journal of Molecular Sciences. 2021; 22(21):11422. https://doi.org/10.3390/ijms222111422
Chicago/Turabian StyleDong, Guokai, Nana Xu, Meng Wang, Yunyun Zhao, Fei Jiang, Huimin Bu, Jinjuan Liu, Bo Yuan, and Rongpeng Li. 2021. "Anthocyanin Extract from Purple Sweet Potato Exacerbate Mitophagy to Ameliorate Pyroptosis in Klebsiella pneumoniae Infection" International Journal of Molecular Sciences 22, no. 21: 11422. https://doi.org/10.3390/ijms222111422