Proper Balance of Small GTPase rab10 Is Critical for PGC Migration in Zebrafish
Abstract
:1. Introduction
2. Results
2.1. Transcriptional Profiles in WT and MmiR-202 PGCs
2.2. Analysis of the DEGs Associated with PGC Migration
2.3. rab10 and prdm12b Are Novel miR-202-5p Target Genes
2.4. The Balance of rab10 Is Critical of PGC Migration
2.5. miR-202-5p Negatively Regulates rab10 in PGC Migration
2.6. Knockdown of rab10 Fails to Rescue PGC Migration in MmiR-202 Embryos
3. Discussion
4. Materials and Methods
4.1. Ethics Statement
4.2. Zebrafish Strains and Cell Lines
4.3. Isolation of PGC and Transcriptome Analysis
4.4. Transcriptome Sequencing and Bioinformatic Analysis
4.5. Embryo Collection and RNA Isolation
4.6. Reverse Transcription and qPCR Analysis
4.7. Plasmid Construction and mRNA Transcription
4.8. Micro-Injection
4.9. Dual Luciferase Reporter Assay
4.10. PGC Phenotype Observation
4.11. Statistics Analysis
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Conflicts of Interest
Abbreviations
3′UTR | 3′untranslated region |
DEGs | differentially expressed genes |
DMEM | Dulbecco’s modified Eagle’s medium |
ECM | extracellular matrix |
FACS | fluorescence activated cell sorting |
FPKM | Fragments Per Kilobase Millon Mapped Reads |
GFP | green fluorescence protein |
GO | Gene Ontology |
KEGG | Kyoto Encyclopedia of Genes and Genomes |
miRNAs | MicroRNAs |
Mlck | myosin light chain kinase |
MmiR-202 | maternal miR-202 mutant |
ORF | open reading frame |
PGCs | Primordial germ cells |
PRDM | PR domain containing |
qPCR | Quantitative polymerase chain reaction |
RFP | red fluorescent protein |
WT | wild type |
Appendix A
Description | Primer Name | Primer Sequence (5′-3′) |
---|---|---|
psiCHECK2 | rab10-3′UTR-XhoI-F | CCGCTCGAGCACACACGCACACACAATCTGTTCTACT |
rab10-3′UTR-NotI-R | ATAAGAATGCGGCCGCCGTGAGTGTGAGAAACGTTAGAGATG | |
rab10-3′UTR-seed Mut-R | GTTAGAGATGTGTTTTACAGAGAATCTCGCGAGAAGG | |
prdm12b-3′UTR-XhoI-F | CCGCTCGAG ACCACACCACGTTATTTGCT | |
prdm12b-3′UTR-NotI-R | ATAAGAATGCGGCCGCAGGTGAGCTAAATTGGCCG | |
prdm12b-3′UTR-seed Mut-F | GGAATGTACGCGAGATTTGAACTTTTACG | |
prdm12b-3′UTR-seed Mut-R | GTTCAAATCTCGCGTACATTCCTTTAC | |
pCS2 + mRNA synthesis | rab10-Bamh I-F | ACGGGATCCAGCTCAGATGGCGAAGAAGACCTATGATC |
rab10-Age I-R | ACTACCGGTGGACTGCAGCACTTGGTCTTCCAGCCT | |
rab10-XhoI-R | CCGCTCGAGCGTGAGTGTGAGAAACGTTAGAGATG | |
rab10T23N-F | TGATTGGCGATTCTGGGGTGGGAAAGAACTGCGTGCTGTT | |
rab10T23N-R | TCATCGGAGAATCGGAACAGCACGCAGTTCTTTCCCACCC | |
rab10Q68L-F | GCTACAGATATGGGATACAGCGGGGCTGGAACGGTTTCAC | |
rab10Q68L-R | AGGTAGTGATGGTGTGAAACCGTTCCAGCCCCGCTGTATC | |
qRT-PCR | ef1a-F | GGCTGACTGTGCTGTGCTGATTG |
ef1a-R | CTTGTCGGTGGGACGGCTAGG | |
actin-F | CGAGCTGTCTTCCCATCCA | |
actin-R | TCACCAACGTAGCTGTCTTTCTG | |
rpl13a-F | TCTGGAGGACTGTAAGAGGTATGC | |
rpl13a-R | AGACGCACAATCTTGAGAGCAG | |
rab10-RT-F | CGCCTTCAACACCACCTTTAT | |
rab10-RT-R | GCATCCTCTCCACATCCTCAT | |
prdm12b-RT-F | TCGCAGCTGGATGACTTACA | |
prdm12b-RT-R | TCCCATACCACACAAGCAGT | |
anxa1c-RT-F | ACACCTTGAAGACTGCCTGA | |
anxa1c-RT-R | CCGAACGGCTCACAATGATT | |
cldne-RT-F | GGGAAATGCACCAACTTCGT | |
cldne-RT-R | CTCTGATGATGGTGTTGGCG | |
mcf2a-RT-R | GCAGCGCTATTGAGTTCCTC | |
mcf2a-RT-F | AGTCCTGTGTGATGTCCCAG | |
megf6a-RT-F | CAGGGCAGGTTACAGACTCA | |
megf6a-RT-R | GTCTGTCCTCACCAAGTCGA | |
myl7-RT-F | TGCACAACTAGGGAAGCTGA | |
myl7-RT-R | GGTCTGTGCCATTGAGCTTC | |
rab36-RT-F | GCCGTAAAGATTGCAGCAGA | |
rab36-RT-R | ACTGCCATCTCCGATCTGAG | |
hmgxb4a-RT-F | TCGTCTCTGGGCATGTCTTT | |
hmgxb4a-RT-R | CTGTCTCCTGAAGTCGGTGT | |
synpo21b-RT-F | CAACCTACTCCAGCACCTCA | |
synpo21b-RT-R | TGTGGAGGACTGAATGGCAT | |
dnd-RT-F | GGCTAAGAAAGTGCTCGTGG | |
dnd-RT-R | GCTGGGACGTCATAATGCAG | |
gra-RT-F | CCTTAAAAGCACCGAGACCC | |
gra-RT-R | AAGTATCTGGGCAGGTCACT |
References
- Marlow, F. Primordial Germ Cell Specification and Migration. F1000Research 2015, 4. F1000 Faculty Rev−1462. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Hayashi, K.; de Sousa Lopes, S.M.C.; Surani, M.A. Germ cell specification in mice. Science 2007, 316, 394–396. [Google Scholar] [CrossRef] [PubMed]
- Aalto, A.; Olguin-Olguin, A.; Raz, E. Zebrafish Primordial Germ Cell Migration. Front. Cell Dev. Biol. 2021, 9, 684460. [Google Scholar] [CrossRef] [PubMed]
- Barton, L.J.; LeBlanc, M.G.; Lehmann, R. Finding their way: Themes in germ cell migration. Curr. Opin. Cell Biol. 2016, 42, 128–137. [Google Scholar] [CrossRef] [PubMed]
- Paksa, A.; Raz, E. Zebrafish germ cells: Motility and guided migration. Curr. Opin. Cell Biol. 2015, 36, 80–85. [Google Scholar] [CrossRef] [PubMed]
- Richardson, B.E.; Lehmann, R. Mechanisms guiding primordial germ cell migration: Strategies from different organisms. Nat. Rev. Mol. Cell Biol. 2010, 11, 37–49. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Blaser, H.; Reichman-Fried, M.; Castanon, I.; Dumstrei, K.; Florence, L.M.; Kawakami, K.; Solnica-Krezel, L.; Heisenberg, C.-P.; Raz, E. Migration of Zebrafish Primordial Germ Cells: A Role for Myosin Contraction and Cytoplasmic Flow. Dev. Cell 2012, 11, 613–627. [Google Scholar] [CrossRef] [Green Version]
- Weidinger, G.; Stebler, J.; Slanchev, K.; Dumstrei, K.; Wise, C.; Lovell-Badge, R.; Thisse, C.; Thisse, B.; Raz, E. dead end, a novel vertebrate germ plasm component, is required for zebrafish primordial germ cell migration and survival. Curr. Biol. 2003, 13, 1429–1434. [Google Scholar] [CrossRef] [Green Version]
- Koprunner, M.; Thisse, C.; Thisse, B.; Raz, E. A zebrafish nanos-related gene is essential for the development of primordial germ cells. Genes Dev. 2001, 15, 2877–2885. [Google Scholar] [PubMed]
- Yoon, C.; Kawakami, K.; Hopkins, N. Zebrafish vasa homologue RNA is localized to the cleavage planes of 2- and 4-cell-stage embryos and is expressed in the primordial germ cells. Development 1997, 124, 3157–3165. [Google Scholar] [CrossRef]
- McHugh, C.A.; Chen, C.-K.; Chow, A.; Surka, C.F.; Tran, C.; McDonel, P.; Pandya-Jones, A.; Blanco, M.; Burghard, C.; Moradian, A.; et al. The Xist lncRNA interacts directly with SHARP to silence transcription through HDAC3. Nature 2015, 521, 232–236. [Google Scholar] [CrossRef]
- Kloc, M.; Spohr, G.; Etkin, L. Translocation of repetitive RNA sequences with the germ plasm in Xenopus oocytes. Science 1993, 262, 1712–1714. [Google Scholar] [CrossRef] [PubMed]
- Martinho, R.G.; Kunwar, P.S.; Casanova, J.; Lehmann, R. A noncoding RNA is required for the repression of RNApolII-dependent transcription in primordial germ cells. Curr. Biol. 2004, 14, 159–165. [Google Scholar] [CrossRef] [PubMed]
- Houwing, S.; Kamminga, L.M.; Berezikov, E.; Cronembold, D.; Girard, A.; van den Elst, H.; Filippov, D.V.; Blaser, H.; Raz, E.; Moens, C.B.; et al. A role for Piwi and piRNAs in germ cell maintenance and transposon silencing in Zebrafish. Cell 2007, 129, 69–82. [Google Scholar] [CrossRef] [Green Version]
- Jin, Y.; Liu, W.; Xiang, Y.; Zhang, W.; Zhang, H.; Jia, K.; Yi, M. Maternal miR-202-5p is required for zebrafish primordial germ cell migration by protecting small GTPase Cdc42. J. Mol. Cell Biol. 2020, 12, 530–542. [Google Scholar] [CrossRef]
- Zhang, J.; Liu, W.; Jin, Y.; Jia, P.; Jia, K.; Yi, M. MiR-202-5p is a novel germ plasm-specific microRNA in zebrafish. Sci Rep. 2017, 7, 7055. [Google Scholar] [CrossRef]
- Kugler, J.M.; Chen, Y.W.; Weng, R.; Cohen, S.M. Maternal loss of miRNAs leads to increased variance in primordial germ cell numbers in Drosophila melanogaster. G3 2013, 3, 1573–1576. [Google Scholar] [CrossRef] [Green Version]
- Cinalli, R.M.; Rangan, P.; Lehmann, R. Germ cells are forever. Cell 2008, 132, 559–562. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Wylie, C. Germ cells. Cell 1999, 96, 165–174. [Google Scholar] [CrossRef]
- Magnúsdóttir, E.; Surani, M.A. How to make a primordial germ cell. Development 2014, 141, 245–252. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Paluch, E.K.; Raz, E. The role and regulation of blebs in cell migration. Curr. Opin. Cell Biol. 2013, 25, 582–590. [Google Scholar] [CrossRef] [Green Version]
- Hartwig, J.; Tarbashevich, K.; Seggewiss, J.; Stehling, M.; Bandemer, J.; Grimaldi, C.; Paksa, A.; Gross-Thebing, T.; Meyen, D.; Raz, E. Temporal control over the initiation of cell motility by a regulator of G-protein signaling. Proc. Natl. Acad. Sci. USA 2014, 111, 11389–11394. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Goudarzi, M.; Banisch, T.U.; Mobin, M.B.; Maghelli, N.; Tarbashevich, K.; Strate, I.; van den Berg, J.; Blaser, H.; Bandemer, S.; Paluch, E.; et al. Identification and regulation of a molecular module for bleb-based cell motility. Dev. Cell 2012, 23, 210–218. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Doitsidou, M.; Reichman-Fried, M.; Stebler, J.; Koprunner, M.; Dorries, J.; Meyer, D.; Esguerra, C.V.; Leung, T.; Raz, E. Guidance of primordial germ cell migration by the chemokine SDF-1. Cell 2002, 111, 647–659. [Google Scholar] [CrossRef] [Green Version]
- Tarbashevich, K.; Reichman-Fried, M.; Grimaldi, C.; Raz, E. Chemokine-Dependent pH Elevation at the Cell Front Sustains Polarity in Directionally Migrating Zebrafish Germ Cells. Curr. Biol. 2015, 25, 1096–1103. [Google Scholar] [CrossRef] [Green Version]
- Grimaldi, C.; Schumacher, I.; Boquet-Pujadas, A.; Tarbashevich, K.; Vos, B.E.; Bandemer, J.; Schick, J.; Aalto, A.; Olivo-Marin, J.C.; Betz, T.; et al. E-cadherin focuses protrusion formation at the front of migrating cells by impeding actin flow. Nat. Commun. 2020, 11, 5397. [Google Scholar] [CrossRef]
- Goudarzi, M.; Tarbashevich, K.; Mildner, K.; Begemann, I.; Garcia, J.; Paksa, A.; Reichman-Fried, M.; Mahabaleshwar, H.; Blaser, H.; Hartwig, J.; et al. Bleb expansion in migrating cells depends on supply of membrane from cell surface invaginations. Dev. Cell 2017, 43, 577–587. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Miranda-Rodriguez, J.R.; Salas-Vidal, E.; Lomeli, H.; Zurita, M.; Schnabel, D. RhoA/ROCK pathway activity is essential for the correct localization of the germ plasm mRNAs in zebrafish embryos. Dev. Biol. 2017, 421, 27–42. [Google Scholar] [CrossRef] [PubMed]
- Bartel, D.P. MicroRNAs: Target recognition and regulatory functions. Cell 2009, 136, 215–233. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Gebert, L.F.R.; MacRae, I.J. Regulation of microRNA function in animals. Nat. Rev. Mol. Cell Biol. 2019, 20, 21–37. [Google Scholar] [CrossRef] [PubMed]
- Batool, A.; Karimi, N.; Wu, X.N.; Chen, S.R.; Liu, Y.X. Testicular germ cell tumor: A comprehensive review. Cell Mol. Life Sci 2019, 76, 1713–1727. [Google Scholar] [CrossRef] [PubMed]
- Treiber, T.; Treiber, N.; Meister, G. Regulation of microRNA biogenesis and its crosstalk with other cellular pathways. Nat. Rev. Mol. Cell Biol. 2019, 20, 5–20. [Google Scholar] [CrossRef] [PubMed]
- Matzuk, M.M. LIN28 lets BLIMP1 Take the Right Course. Dev. Cell 2009, 17, 160–161. [Google Scholar] [CrossRef] [Green Version]
- Viswanathan, S.R.; Daley, G.Q.; Gregory, R.I. Selective blockade of microRNA processing by Lin28. Science 2008, 320, 97–100. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- West, J.A.; Viswanathan, S.R.; Yabuuchi, A.; Cunniff, K.; Takeuchi, A.; Park, I.H.; Sero, J.E.; Zhu, H.; Perez-Atayde, A.; Frazier, A.L.; et al. A role for Lin28 in primordial germ-cell development and germ-cell malignancy. Nature 2009, 460, 909–913. [Google Scholar] [CrossRef] [Green Version]
- Melton, C.; Judson, R.L.; Blelloch, R. Opposing microRNA families regulate self-renewal in mouse embryonic stem cells. Nature 2010, 463, 621–626. [Google Scholar] [CrossRef]
- Giraldez, A.J.; Mishima, Y.; Rihel, J.; Grocock, R.J.; Van Dongen, S.; Inoue, K.; Enright, A.J.; Schier, A.F. Zebrafish MiR-430 promotes deadenylation and clearance of maternal mRNAs. Science 2006, 312, 75–79. [Google Scholar] [CrossRef] [Green Version]
- Staton, A.A.; Knaut, H.; Giraldez, A.J. miRNA regulation of Sdf1 chemokine signaling provides genetic robustness to germ cell migration. Nat. Genet. 2011, 43, 204–211. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Jia, K.T.; Zhang, J.; Jia, P.; Zeng, L.; Jin, Y.; Yuan, Y.; Chen, J.; Hong, Y.; Yi, M. Identification of MicroRNAs in Zebrafish Spermatozoa. Zebrafish 2015, 12, 387–397. [Google Scholar] [CrossRef] [PubMed]
- Bizuayehu, T.T.; Babiak, I. Heterogenic Origin of Micro RNAs in Atlantic Salmon (Salmo salar) Seminal Plasma. Int. J. Mol. Sci 2020, 21, 2723. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Gay, S.; Bugeon, J.; Bouchareb, A.; Henry, L.; Delahaye, C.; Legeai, F.; Montfort, J.; Le Cam, A.; Siegel, A.; Bobe, J.; et al. MiR-202 controls female fecundity by regulating medaka oogenesis. PLoS Genet. 2018, 14, e1007593. [Google Scholar] [CrossRef]
- Bendel-Stenzel, M.R.; Gomperts, M.; Anderson, R.; Heasman, J.; Wylie, C. The role of cadherins during primordial germ cell migration and early gonad formation in the mouse. Mech Dev. 2000, 91, 143–152. [Google Scholar] [CrossRef]
- Liu, W.; Jin, Y.; Zhang, W.; Xiang, Y.; Jia, P.; Yi, M.; Jia, K. MiR-202-5p Inhibits RIG-I-Dependent Innate Immune Responses to RGNNV Infection by Targeting TRIM25 to Mediate RIG-I Ubiquitination. Viruses 2020, 12, 261. [Google Scholar] [CrossRef] [Green Version]
- Li, G.; Marlin, M.C. Rab family of GTPases. Methods Mol. Biol. 2015, 1298, 1–15. [Google Scholar] [PubMed] [Green Version]
- Schuck, S.; Gerl, M.J.; Ang, A.; Manninen, A.; Keller, P.; Mellman, I.; Simons, K. Rab10 is involved in basolateral transport in polarized Madin-Darby canine kidney cells. Traffic 2007, 8, 47–60. [Google Scholar] [CrossRef] [PubMed]
- Dabaja, A.A.; Mielnik, A.; Robinson, B.D.; Wosnitzer, M.S.; Schlegel, P.N.; Paduch, D.A. Possible germ cell-Sertoli cell interactions are critical for establishing appropriate expression levels for the Sertoli cell-specific MicroRNA, miR-202-5p, in human testis. Basic Clin. Androl. 2015, 25, 2. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Xu, L.; Guo, Q.; Chang, G.; Qiu, L.; Liu, X.; Bi, Y.; Zhang, Y.; Wang, H.; Lu, W.; Ren, L.; et al. Discovery of microRNAs during early spermatogenesis in chicken. PLoS ONE 2017, 12, e0177098. [Google Scholar] [CrossRef]
- Chen, J.; Sun, Q.; Liu, G.Z.; Zhang, F.; Liu, C.Y.; Yuan, Q.M.; Di, X.S.; Long, S.W.; Jia, Y.S.; Wang, Y.J. Effect of miR-202-5p-mediated ATG7 on autophagy and apoptosis of degenerative nucleus pulposus cells. Eur. Rev. Med. Pharmacol. 2020, 24, 517–525. [Google Scholar]
- Yu, H.Y.; Pan, S.S. MiR-202-5p suppressed cell proliferation, migration and invasion in ovarian cancer via regulating HOXB2. Eur. Rev. Med. Pharmacol. 2020, 24, 2256–2263. [Google Scholar]
- Li, C.; Ma, D.; Yang, J.; Lin, X.; Chen, B. miR-202-5p inhibits the migration and invasion of osteosarcoma cells by targeting ROCK1. Oncol. Lett. 2018, 16, 829–834. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Liu, T.; Guo, J.; Zhang, X. MiR-202-5p/PTEN mediates doxorubicin-resistance of breast cancer cells via PI3K/Akt signaling pathway. Cancer Biol. Ther. 2019, 20, 989–998. [Google Scholar] [CrossRef]
- Wainwright, E.N.; Jorgensen, J.S.; Kim, Y.; Truong, V.; Bagheri-Fam, S.; Davidson, T.; Svingen, T.; Fernandez-Valverde, S.L.; McClelland, K.S.; Taft, R.J. SOX9 regulates microRNA miR-202-5p/3p expression during mouse testis differentiation. Biol. Reprod. 2013, 89, 34. [Google Scholar] [CrossRef] [PubMed]
- Armisen, J.; Gilchrist, M.J.; Wilczynska, A.; Standart, N.; Miska, E.A. Abundant and dynamically expressed miRNAs, piRNAs, and other small RNAs in the vertebrate Xenopus tropicalis. Genome Res. 2009, 19, 1766–1775. [Google Scholar] [CrossRef] [Green Version]
- Blaser, H.; Eisenbeiss, S.; Neumann, M.; Reichman-Fried, M.; Thisse, B.; Thisse, C.; Raz, E. Transition from non-motile behaviour to directed migration during early PGC development in zebrafish. J. Cell Sci. 2005, 118 Pt 17, 4027–4038. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Weidinger, G.; Wolke, U.; Koprunner, M.; Klinger, M.; Raz, E. Identification of tissues and patterning events required for distinct steps in early migration of zebrafish primordial germ cells. Development 1999, 126, 5295–5307. [Google Scholar] [CrossRef] [PubMed]
- Mishima, Y.; Giraldez, A.J.; Takeda, Y.; Fujiwara, T.; Sakamoto, H.; Schier, A.F.; Inoue, K. Differential regulation of germline mRNAs in soma and germ cells by zebrafish miR-430. Curr. Biol. 2006, 16, 2135–2142. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Ohinata, Y.; Payer, B.; O’Carroll, D.; Ancelin, K.; Ono, Y.; Sano, M.; Barton, S.C.; Obukhanych, T.; Nussenzweig, M.; Tarakhovsky, A.; et al. Blimp1 is a critical determinant of the germ cell lineage in mice. Nature 2005, 436, 207–213. [Google Scholar] [CrossRef] [PubMed]
- Sybirna, A.; Tang, W.W.C.; Pierson Smela, M.; Dietmann, S.; Gruhn, W.H.; Brosh, R.; Surani, M.A. A critical role of PRDM14 in human primordial germ cell fate revealed by inducible degrons. Nat. Commun. 2020, 11, 1282. [Google Scholar] [CrossRef] [PubMed]
- Ding, H.L.; Clouthier, D.E.; Artinger, K.B. Redundant roles of PRDM family members in zebrafish craniofacial development. Dev. Dyn. 2013, 242, 67–79. [Google Scholar] [CrossRef] [Green Version]
- Reiner, D.J.; Lundquist, E.A. Small GTPases. In The Online Review of C. elegans Biology; WormBook: Pasadena, CA, USA, 2018; pp. 1–65. [Google Scholar]
- Olguin-Olguin, A.; Aalto, A.; Maugis, B.; Boquet-Pujadas, A.; Hoffmann, D.; Ermlich, L.; Betz, T.; Gov, N.S.; Reichman-Fried, M.; Raz, E. Chemokine-biased robust self-organizing polarization of migrating cells in vivo. Proc. Natl. Acad. Sci. USA 2021, 118, e2018480118. [Google Scholar] [CrossRef]
- Lui, W.Y.; Lee, W.M.; Cheng, C.Y. Sertoli-germ cell adherens junction dynamics in the testis are regulated by RhoB GTPase via the ROCK/LIMK signaling pathway. Biol. Reprod. 2003, 68, 2189–2206. [Google Scholar] [CrossRef]
- Palamidessi, A.; Frittoli, E.; Garré, M.; Faretta, M.; Mione, M.; Testa, I.; Diaspro, A.; Lanzetti, L.; Scita, G.; Di Fiore, P.P. Endocytic trafficking of Rac is required for the spatial restriction of signaling in cell migration. Cell 2008, 134, 135–147. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Pan, Z.N.; Pan, M.H.; Sun, M.H.; Li, X.H.; Zhang, Y.; Sun, S.C. RAB7 GTPase regulates actin dynamics for DRP1-mediated mitochondria function and spindle migration in mouse oocyte meiosis. FASEB J. 2020, 34, 9615–9627. [Google Scholar] [CrossRef] [PubMed]
- Lin, Y.-H.; Ke, C.-C.; Wang, Y.-Y.; Chen, M.-F.; Chen, T.-M.; Ku, W.-C.; Chiang, H.-S.; Yeh, C.-H. RAB10 Interacts with the Male Germ Cell-Specific GTPase-Activating Protein during Mammalian Spermiogenesis. Int. J. Mol. Sci 2017, 18, 97. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Kim, D.; Langmead, B.; Salzberg, S.L. HISAT: A fast spliced aligner with low memory requirements. Nat. Methods 2015, 12, 357–360. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Liu, W.; Zhang, H.; Xiang, Y.; Jia, K.; Luo, M.; Yi, M. A novel germline and somatic cell expression of two sexual differentiation genes, Dmrt1 and Foxl2 in marbled goby (Oxyeleotris marmorata). Aquaculture 2020, 516, 734619. [Google Scholar] [CrossRef]
Sample | Raw Reads | Clean Reads | Clean Reads Rate (%) | Q30 (%) | Mapping Rate (%) |
---|---|---|---|---|---|
WT PGC1 | 92,981,332 | 90,378,978 | 97.20 | 92.49 | 89.66 |
WT PGC2 | 94,130,668 | 91,742,980 | 97.46 | 92.99 | 90.48 |
WT PGC3 | 93,087,162 | 91,203,598 | 97.98 | 93.34 | 88.52 |
MmiR-202 PGC1 | 94,567,190 | 91,905,698 | 97.19 | 93.48 | 88.70 |
MmiR-202 PGC2 | 95,092,164 | 91,571,918 | 96.30 | 93.25 | 88.75 |
MmiR-202 PGC3 | 95,230,438 | 92,724,062 | 97.37 | 93.26 | 88.91 |
GO Terms Related to Migratory Events | DEGs |
---|---|
Bleb | panx1a |
Cell polarity | fgf13b |
Cell motility | rab36, cavin1a |
Chemokine | chia.4, ccl20a.3 |
Cadherin | cdh18a, clstn3, cblc, si:dkey-81e3.2, ppl, prx, dock9b |
Cell adhesion | cldne, col28a2a, cdh18a, clstn3, hyal1, spon1a, si:dkey-81e3.2, itga9, styk1b |
Cytoskeleton | al935300.3, actc1a, anxa1c, epha4b, mcf2a, ppl, prx, ttn.2, tpm4b, synpo2lb, si:dkey-81e3.2, si:dkey-26g8.5, zgc:86896, zgc:174153 |
Extracellular matrix | col1a1a, col1a2, col28a2a, fgf13b, vit, ndnfl, tns2b, itga9, si:dkey-81e3.2, megf6a |
GTPase activity | dock9b, epha4b, mcf2a, nudt1, rap1gap2b, rab10, rab36, snx18b |
Myosin | myl7, rab36, cmlc1, tpm4b |
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations. |
© 2021 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Mo, C.; Li, W.; Jia, K.; Liu, W.; Yi, M. Proper Balance of Small GTPase rab10 Is Critical for PGC Migration in Zebrafish. Int. J. Mol. Sci. 2021, 22, 11962. https://doi.org/10.3390/ijms222111962
Mo C, Li W, Jia K, Liu W, Yi M. Proper Balance of Small GTPase rab10 Is Critical for PGC Migration in Zebrafish. International Journal of Molecular Sciences. 2021; 22(21):11962. https://doi.org/10.3390/ijms222111962
Chicago/Turabian StyleMo, Chengyu, Wenjing Li, Kuntong Jia, Wei Liu, and Meisheng Yi. 2021. "Proper Balance of Small GTPase rab10 Is Critical for PGC Migration in Zebrafish" International Journal of Molecular Sciences 22, no. 21: 11962. https://doi.org/10.3390/ijms222111962