Functional Identification of Complement Factor D and Analysis of Its Expression during GCRV Infection in Grass Carp (Ctenopharyngodon idella)
Abstract
:1. Introduction
2. Results
2.1. Sequence Characteristics of CiDf
2.2. The Domain Architecture and Three-Dimensional Structure Model of CiDf
2.3. The Phylogenetic Tree
2.4. The Analysis and Comparison of CiDf Genomic Structure
2.5. The Enhancement of rCiDf to Cleave C3 Protein in Grass Carp Serum
2.6. The Distribution of CiDf mRNA Transcript in Grass Carp Tissues
2.7. The Fold Changes in CiDf mRNA Expression during GCRV Infection
3. Discussion
4. Materials and Methods
4.1. Cloning of CiDf Full-Length cDNA by Using Rapid Amplification of cDNA Ends (RACE) Technique
4.2. Sequence Analysis of CiDf
4.3. Prokaryotic Expression, Purification of Recombinant CiDf Protein
4.4. The Incubation of rCiDf with Grass Carp Serum
4.5. Grass Carps, the GCRV Challenge Experiment, and Sampling
4.6. Quantitative Real-Time Polymerase Chain Reaction Analysis of CiDf Expression in Different Tissues
4.7. Temporal Expression Analysis of CiDf in Response to GCRV Infection
4.8. Statistical Analysis
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Sarma, J.V.; Ward, P.A. The complement system. Cell Tissue Res. 2011, 343, 227–235. [Google Scholar] [CrossRef]
- Noris, M.; Remuzzi, G. Overview of Complement Activation and Regulation. Semin. Nephrol. 2013, 33, 479–492. [Google Scholar]
- Nonaka, M.; Smith, S.L. Complement system of bony and cartilaginous fish. Fish Shellfish Immunol. 2000, 10, 215–228. [Google Scholar] [CrossRef]
- Nakao, M.; Tsujikura, M.; Ichiki, S.; Vo, T.K.; Somamoto, T. The complement system in teleost fish: Progress of post-homolog-hunting researches. Dev. Comp. Immunol. 2011, 35, 1296–1308. [Google Scholar] [CrossRef]
- Mortensen, S.A.; Sander, B.; Jensen, R.K.; Pedersen, J.S.; Golas, M.M.; Jensenius, J.C.; Hansen, A.G.; Thiel, S.; Andersen, G.R. Structure and activation of C1, the complex initiating the classical pathway of the complement cascade. Proc. Natl. Acad. Sci. USA 2017, 114, 986–991. [Google Scholar]
- Garred, P.; Genster, N.; Pilely, K.; Bayarri-Olmos, R.; Rosbjerg, A.; Ma, Y.J.; Skjoedt, M.O. A journey through the lectin pathway of complement-MBL and beyond. Immunol. Rev. 2016, 274, 74–97. [Google Scholar] [CrossRef]
- Kallio, S.P.; Eveliina, J.; Shaun, P.; Minna, S.; Keijo, K.; Tienari, P.J.; Irina, E.; Tuula, P.; Mauri, R.; Denis, B. Use of a genetic isolate to identify rare disease variants: C7 on 5p associated with MS. Hum. Mol. Genet. 2009, 18, 1670–1683. [Google Scholar] [CrossRef]
- Sigdel, T.K.; Bestard, O.; Salomonis, N.; Hsieh, S.C.; Sarwal, M.M. Intragraft Antiviral-Specific Gene Expression as a Distinctive Transcriptional Signature for Studies in Polyomavirus-Associated Nephropathy. Transplantation 2016, 100, 2062–2070. [Google Scholar] [CrossRef] [Green Version]
- Coulthard, L.G.; Woodruff, T.M. Is the Complement Activation Product C3a a Proinflammatory Molecule? Re-evaluating the Evidence and the Myth. J. Immunol. 2015, 194, 3542–3548. [Google Scholar] [CrossRef] [Green Version]
- Carr, J.M.; Cabezas-Falcon, S.; Dubowsky, J.G.; Hulme-Jones, J.; Gordon, D.L. Dengue virus and the complement alternative pathway. FEBS Lett. 2020, 594, 2543–2555. [Google Scholar] [CrossRef] [Green Version]
- Saori, I.; Garrett, K.; Connor, K.M. The Alternative Complement System Mediates Cell Death in Retinal Ischemia Reperfusion Injury. Front. Mol. Neurosci. 2018, 11, 278. [Google Scholar]
- Al-Sharif, W.Z.; Sunyer, J.O.; Lambris, J.D.; Smith, L.C. Sea urchin coelomocytes specifically express a homologue of the complement component C3. J. Immunol. 1998, 160, 2983–2997. [Google Scholar]
- Smith, L.C.; Shih, C.S.; Dachenhausen, S.G. Coelomocytes Express SpBf, a Homologue of Factor B, the Second Component in the Sea Urchin Complement System. J. Immunol. 1998, 161, 6784–6793. [Google Scholar]
- Nonaka, M.; Azumi, K.; Ji, X.; Namikawa-Yamada, C.; Sasaki, M.; Saiga, H.; Dodds, A.W.; Sekine, H.; Homma, M.K.; Matsushita, M.; et al. Opsonic complement component C3 in the solitary ascidian, Halocynthia roretzi. J. Immunol. 1999, 162, 387–391. [Google Scholar]
- Suzuki, M.M.; Satoh, N.; Nonaka, M. C6-like and C3-like molecules from the cephalochordate, amphioxus, suggest a cytolytic complement system in invertebrates. J. Mol. Evol. 2002, 54, 671–679. [Google Scholar]
- Matsushita, M. The Complement System of Agnathans. Front. Immunol. 2018, 9, 1405. [Google Scholar] [CrossRef]
- Goshima, M.; Sekiguchi, R.; Matsushita, M.; Nonaka, M. The complement system of elasmobranches revealed by liver transcriptome analysis of a hammerhead shark, Sphyrna zygaena. Dev. Comp. Immunol. 2016, 61, 13–24. [Google Scholar]
- Boshra, H.; Li, J.; Sunyer, J.O. Recent advances on the complement system of teleost fish. Fish Shellfish Immunol. 2006, 20, 239–262. [Google Scholar] [CrossRef]
- Rodriguez, K.M.; Voyles, J. The amphibian complement system and chytridiomycosis. J. Exp. Zool. A Ecol. Integr. Physiol. 2020, 333, 706–719. [Google Scholar]
- Ingram, G.A.; Molyneux, D.H. A comparison of selected immunological techniques used to detect anti-leishmanial antibodies in the sera of two reptile species. J. Immunol. Methods 1984, 75, 53–64. [Google Scholar] [CrossRef]
- Papareddy, P.; Kasetty, G.; Alyafei, S.; Smeds, E.; Salo-Ahen, O.; Hansson, S.R.; Egesten, A.; Herwald, H. An ecoimmunological approach to study evolutionary and ancient links between coagulation, complement and Innate immunity. Virulence 2018, 9, 724–737. [Google Scholar] [CrossRef] [Green Version]
- Qin, J.; Munyard, K.; Lee, C.Y.; Wetherall, J.D.; Groth, D.M. Characterization of the sheep Complement Factor B gene (CFB). Vet. Immunol. Immunopathol. 2011, 140, 170–174. [Google Scholar] [CrossRef] [Green Version]
- Torreira, E.; Tortajada, A.; Montes, T.; de Cordoba, S.R.; Llorca, O. 3D structure of the C3bB complex provides insights into the activation and regulation of the complement alternative pathway convertase. Proc. Natl. Acad. Sci. USA 2009, 106, 882–887. [Google Scholar]
- Forneris, F.; Ricklin, D.; Wu, J.; Tzekou, A.; Wallace, R.S.; Lambris, J.D.; Gros, P. Structures of C3b in complex with factors B and D give insight into complement convertase formation. Science 2010, 330, 1816–1820. [Google Scholar] [CrossRef] [Green Version]
- Volanakis, J.E.; Narayana, S. Complement factor D, a novel serine protease. Protein Sci. 1996, 5, 553–564. [Google Scholar] [CrossRef] [Green Version]
- Lizbeth, H. Serine protease mechanism and specificity. Chem. Rev. 2002, 102, 4501–4524. [Google Scholar]
- Biesma, D.H.; Hannema, A.J.; Velzenblad, H.V.; Mulder, L.; Zwieten, R.V.; Kluijt, I.; Roos, D. A family with complement factor D deficiency. J. Clin. Investig. 2001, 108, 233–240. [Google Scholar] [CrossRef]
- Qi, H.; Wei, J.; Gao, Y.; Yang, Y.; Li, Y.; Zhu, H.; Su, L.; Su, X.; Zhang, Y.; Yang, R. Reg4 and complement factor D prevent the overgrowth of E. coli in the mouse gut. Commun. Biol. 2020, 3, 483. [Google Scholar]
- Gorman, N.T.; Lachmann, P.J. In vitro modulation of viral cell surface glycoproteins by anti-viral antibody in the presence of complement. Clin. Exp. Immunol. 1982, 50, 507–514. [Google Scholar]
- Tomoki, Y.; Miki, N. Isolation of a carp complement protein homologous to mammalian factor D. Mol. Immunol. 1994, 31, 337–342. [Google Scholar] [CrossRef]
- Hajnik, C.A.; Goetz, F.W.; Hsu, S.Y.; Sokal, N. Characterization of a ribonucleic acid transcript from the brook trout (Salvelinus fontinalis) ovary with structural similarities to mammalian adipsin/complement factor D and tissue kallikrein, and the effects of kallikrein-like serine proteases on follicle contraction. Biol. Reprod. 1998, 58, 887–897. [Google Scholar] [PubMed] [Green Version]
- Løvoll, M.; Kilvik, T.; Boshra, H.; Bøgwald, J.; Sunyer, J.O.; Dalmo, R.A. Maternal transfer of complement components C3-1, C3-3, C3-4, C4, C5, C7, Bf, and Df to offspring in rainbow trout (Oncorhynchus mykiss). Immunogenetics 2006, 58, 168–179. [Google Scholar] [CrossRef] [PubMed]
- Kong, H.J.; Hong, G.E.; Nam, B.H.; Kim, Y.O.; Kim, W.J.; Lee, S.J.; Lee, N.S.; Do, J.W.; Cho, H.K.; Cheong, J.; et al. An immune responsive complement factor D/adipsin and kallikrein-like serine protease (PoDAK) from the olive flounder Paralichthys olivaceus. Fish Shellfish Immunol. 2009, 27, 486–492. [Google Scholar] [PubMed]
- Zhou, Z.; Hong, L.; Liu, S.; Sun, F.; Peatman, E.; Kucuktas, H.; Kaltenboeck, L.; Feng, T.; Hao, Z.; Niu, D.; et al. Alternative complement pathway of channel catfish (Ictalurus punctatus): Molecular characterization, mapping and expression analysis of factors Bf/C2 and Df. Fish Shellfish Immunol. 2012, 32, 186–195. [Google Scholar] [CrossRef]
- Woo, S.; Denis, V.; Yum, S. Transcriptional Changes Caused by Bisphenol A in Oryzias javanicus, a Fish Species Highly Adaptable to Environmental Salinity. Mar. Drugs 2014, 12, 983–998. [Google Scholar] [CrossRef] [Green Version]
- Godahewa, G.I.; Perera, N.C.N.; Bathige, S.D.N.K.; Nam, B.H.; Noh, J.K.; Lee, J. Complement factor D homolog involved in the alternative complement pathway of rock bream (Oplegnathus fasciatus): Molecular and functional characterization and immune responsive mRNA expression analysis. Fish Shellfish Immunol. 2016, 55, 423–433. [Google Scholar]
- Ding, M.; Fan, J.; Wang, W.; Wang, H.; Liu, H. Molecular characterization, expression and antimicrobial activity of complement factor D in Megalobrama amblycephala. Fish Shellfish Immunol. 2019, 89, 43–51. [Google Scholar] [CrossRef]
- Duan, C.; Ma, Z.; Wu, S.; Ding, X.; Ye, J. Functional characterization of complement factor D on the defense against Gyrodactylus kobayashii (Monogenea) infection in goldfish (Carassius auratus). Aquaculture 2021, 545, 737214. [Google Scholar] [CrossRef]
- Miner, J.L.; Hahn, K.J.; Spurlock, M.E.; Staten, N.R. Expression and Complement D Activity of Porcine Adipsin. Protein Expr. Purif. 2001, 23, 14–21. [Google Scholar] [CrossRef]
- He, L.; Zhu, D.; Liang, X.; Li, Y.; Liao, L.; Yang, C.; Huang, R.; Zhu, Z.; Wang, Y. Multi-Omics Sequencing Provides Insights Into Age-Dependent Susceptibility of Grass Carp (Ctenopharyngodon idella) to Reovirus. Front. Immunol. 2021, 12, 694965. [Google Scholar] [CrossRef]
- He, L.; Zhang, A.; Xiong, L.; Li, Y.; Huang, R.; Liao, L.; Zhu, Z.; Wang, A.Y. Deep Circular RNA Sequencing Provides Insights into the Mechanism Underlying Grass Carp Reovirus Infection. Int. J. Mol. Sci. 2017, 18, 1977. [Google Scholar] [CrossRef] [Green Version]
- Wang, H.; Ding, C.; Wang, J.; Zhao, X.; Jin, S.; Liang, J.; Luo, H.; Li, D.; Li, R.; Li, Y.; et al. Molecular cloning and expression analysis of coagulation factor VIII and plasminogen involved in immune response to GCRV, and immunity activity comparison of grass carp Ctenopharyngodon idella with different viral resistance. Fish Shellfish Immunol. 2019, 86, 794–804. [Google Scholar] [CrossRef] [PubMed]
- Roh, H.; Kim, A.; Kim, N.; Lee, Y.; Kim, D. Multi-Omics Analysis Provides Novel Insight into Immuno-Physiological Pathways and Development of Thermal Resistance in Rainbow Trout Exposed to Acute Thermal Stress. Int. J. Mol. Sci. 2020, 21, 9198. [Google Scholar] [CrossRef]
- Su, H.; Fan, C.; Liao, Z.; Yang, C.; Clarke, J.L.; Zhang, Y.; Su, J. Grass Carp Reovirus Major Outer Capsid Protein VP4 Interacts with RNA Sensor RIG-I to Suppress Interferon Response. Biomolecules 2020, 10, 560. [Google Scholar] [CrossRef] [Green Version]
- Xu, B.H.; Zhong, L.; Liu, Q.L.; Xiao, T.Y.; Su, J.M.; Chen, K.J.; Wang, H.Q.; Dai, Y.J.; Chen, J. Characterization of grass carp spleen transcriptome during GCRV infection. Genet. Mol. Res. 2016, 15, 10–4238. [Google Scholar]
- Langer, H.F.; Chung, K.J.; Orlova, V.V.; Choi, E.Y.; Kaul, S.; Kruhlak, M.J.; Alatsatianos, M.; DeAngelis, R.A.; Roche, P.A.; Magotti, P.; et al. Complement-mediated inhibition of neovascularization reveals a point of convergence between innate immunity and angiogenesis. Blood 2010, 116, 4395–4403. [Google Scholar] [CrossRef] [Green Version]
- Yang, X.; Tao, H.; Xiao, L.; Li, C.; Tang, Y.; Liu, Y. Increased Serum C3 and Decreased UA in Patients of Bipolar Disorder in Chinese Han Population. Front. Psychiatry 2018, 9, 381. [Google Scholar] [CrossRef]
- Kraiczy, P.; Skerka, C.; Zipfel, P.F.; Brade, V. Complement regulator-acquiring surface proteins of Borrelia burgdorferi: A new protein family involved in complement resistance. Wien. Klin. Wochenschr. 2002, 114, 568–573. [Google Scholar] [PubMed]
- Giang, J.; Seelen, M.A.J.; van Doorn, M.B.A.; Rissmann, R.; Prens, E.P.; Damman, J. Complement Activation in Inflammatory Skin Diseases. Front. Immunol. 2018, 9, 639. [Google Scholar] [CrossRef] [PubMed]
- Modinger, Y.; Rapp, A.; Pazmandi, J.; Vikman, A.; Holzmann, K.; Haffner-Luntzer, M.; Huber-Lang, M.; Ignatius, A. C5aR1 interacts with TLR2 in osteoblasts and stimulates the osteoclast-inducing chemokine CXCL10. J. Cell. Mol. Med. 2018, 22, 6002–6014. [Google Scholar] [CrossRef] [PubMed]
- Cheema, N.; Herbst, A.; McKenzie, D.; Aiken, J.M. Apoptosis and necrosis mediate skeletal muscle fiber loss in age-induced mitochondrial enzymatic abnormalities. Aging Cell 2015, 14, 1085–1093. [Google Scholar] [CrossRef]
- Martin, M.; Leffler, J.; Smoląg, K.I.; Mytych, J.; Bjork, A.; Chaves, L.D.; Alexander, J.J.; Quigg, R.J.; Blom, A.M. Factor H uptake regulates intracellular C3 activation during apoptosis and decreases the inflammatory potential of nucleosomes. Cell Death Differ. 2016, 23, 903–911. [Google Scholar] [CrossRef] [PubMed]
- Zhang, S.; Cui, P. Complement system in zebrafish. Dev. Comp. Immunol. 2014, 46, 3–10. [Google Scholar] [PubMed]
- Wang, Y.; Sun, S.N.; Liu, Q.; Yu, Y.Y.; Guo, J.; Wang, K.; Xing, B.C.; Zheng, Q.F.; Campa, M.J.; Patz, E.F., Jr.; et al. Autocrine Complement Inhibits IL10-Dependent T-cell-Mediated Antitumor Immunity to Promote Tumor Progression. Cancer Discov. 2016, 6, 1022–1035. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Corvillo, F.; Okroj, M.; Nozal, P.; Melgosa, M.; Sanchez-Corral, P.; Lopez-Trascasa, M. Nephritic Factors: An Overview of Classification, Diagnostic Tools and Clinical Associations. Front. Immunol. 2019, 10, 886. [Google Scholar] [CrossRef]
- Panelius, J.; Meri, S. Complement system in dermatological diseases—Fire under the skin. Front. Med. 2015, 2, 3. [Google Scholar]
- Fromell, K.; Adler, A.; Aman, A.; Manivel, V.A.; Huang, S.; Duhrkop, C.; Sandholm, K.; Ekdahl, K.N.; Nilsson, B. Assessment of the Role of C3(H2O) in the Alternative Pathway. Front. Immunol. 2020, 11, 530. [Google Scholar] [CrossRef]
- Tsuru, H.; Osaka, M.; Hiraoka, Y.; Yoshida, M. HFD-induced hepatic lipid accumulation and inflammation are decreased in Factor D deficient mouse. Sci. Rep. 2020, 10, 17593. [Google Scholar]
- Ai, S.; Zheng, J.; Qiu, C.X.; Lu, X.L.; Li, X.W. Urinary proteomics analysis based on mass spectrometry and identification of therapeutic targets of Shenkangling interventions in rats with adriamycin nephropathy using iTRAQ. Am. J. Transl. Res. 2018, 10, 2115–2125. [Google Scholar]
- Carregari, V.C.; Monforte, M.; Di Maio, G.; Pieroni, L.; Urbani, A.; Ricci, E.; Tasca, G. Proteomics of Muscle Microdialysates Identifies Potential Circulating Biomarkers in Facioscapulohumeral Muscular Dystrophy. Int. J. Mol. Sci. 2020, 22, 290. [Google Scholar] [CrossRef]
- Zhao, Y.; Wang, M.; Meng, B.; Gao, Y.; Xue, Z.C.; He, M.J.; Jiang, Y.; Dai, X.H.; Yan, D.; Fang, X. Identification of Dysregulated Complement Activation Pathways Driven by N-Glycosylation Alterations in T2D Patients. Front. Chem. 2021, 9, 677621. [Google Scholar] [PubMed]
- Yuan, X.; Gavriilaki, E.; Thanassi, J.A.; Yang, G.; Baines, A.C.; Podos, S.D.; Huang, Y.; Huang, M.; Brodsky, R.A. Small-molecule factor D inhibitors selectively block the alternative pathway of complement in paroxysmal nocturnal hemoglobinuria and atypical hemolytic uremic syndrome. Haematologica 2017, 102, 466–475. [Google Scholar] [CrossRef] [Green Version]
- Corvillo, F.; Gonzalez-Sanchez, L.; Lopez-Lera, A.; Arjona, E.; Ceccarini, G.; Santini, F.; Araujo-Vilar, D.; Brown, R.J.; Villarroya, J.; Villarroya, F.; et al. Complement Factor D (adipsin) Levels Are Elevated in Acquired Partial Lipodystrophy (Barraquer-Simons syndrome). Int. J. Mol. Sci. 2021, 22, 6608. [Google Scholar]
- Takahashi, M.; Ishida, Y.; Iwaki, D.; Kanno, K.; Suzuki, T.; Endo, Y.; Homma, Y.; Fujita, T. Essential role of Mannose-binding lectin-associated serine protease-1 in activation of the complement factor D. J. Exp. Med. 2010, 207, 29–37. [Google Scholar]
- Narayana, S.V.; Kilpatrick, J.M.; el-Kabbani, O.; Babu, Y.S.; Bugg, C.E.; Volanakis, J.E.; DeLucas, L.J. Crystallization and preliminary X-ray investigation of factor D of human complement. J. Mol. Biol. 1991, 219, 1–3. [Google Scholar] [PubMed]
- Perkins, S.J.; Smith, K.F. Identity of the putative serine-proteinase fold in proteins of the complement system with nine relevant crystal structures. Biochem. J. 1993, 295, 109–114. [Google Scholar] [CrossRef] [Green Version]
- Narayana, S.V.; Yamauchi, Y.; Macon, K.J.; Moore, D.; DeLucas, L.J.; Volanakis, J.E. Preliminary crystallographic studies on human complement pro-factor D. J. Mol. Biol. 1994, 235, 1144–1146. [Google Scholar] [CrossRef]
- Kim, S.; Narayana, S.V.; Volanakis, J.E. Crystal Structure of a Complement Factor D Mutant Expressing Enhanced Catalytic Activity. J. Biol. Chem. 1995, 270, 24399–24405. [Google Scholar] [CrossRef] [Green Version]
- Jing, H.; Babu, Y.S.; Moore, D.; Kilpatrick, J.M.; Liu, X.Y.; Volanakis, J.E.; Narayana, S.V. Structures of native and complexed complement factor D: Implications of the atypical His57 conformation and self-inhibitory loop in the regulation of specific serine protease activity. J. Mol. Biol. 1998, 282, 1061–1081. [Google Scholar] [CrossRef] [PubMed]
- Forneris, F.; Burnley, B.T.; Gros, P. Ensemble refinement shows conformational flexibility in crystal structures of human complement factor D. Acta Crystallogr. D 2014, 70, 733–743. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Lesavre, P.H.; Hugli, T.E.; Esser, A.F.; Müller-Eberhard, H.J. The alternative pathway C3/C5 convertase: Chemical basis of factor B activation. J. Immunol. 1979, 123, 529–534. [Google Scholar]
- Pangburn, M.K.; Müller-Eberhard, H.J. The C3 convertase of the alternative pathway of human complement. Enzymic properties of the bimolecular proteinase. Biochem. J. 1986, 235, 723–730. [Google Scholar] [CrossRef] [PubMed]
- Forneris, F.; Ricklin, D.; Wu, J.; Tzekou, A.; Wallace, R.S.; Lambris, J.D.; Gros, P. Complement convertase formation based on the structures of C3b in complex with factors B and D. Acta Crystallogr. A 2011, 67, C23–C24. [Google Scholar]
- Malekshahi, Z.; Schiela, B.; Bernklau, S.; Banki, Z.; Wurzner, R.; Stoiber, H. Interference of the Zika Virus E-Protein With the Membrane Attack Complex of the Complement System. Front. Immunol. 2020, 11, 569549. [Google Scholar] [CrossRef] [PubMed]
- Yu, J.; Yuan, X.; Chen, H.; Chaturvedi, S.; Brodsky, R.A. Direct activation of the alternative complement pathway by SARS-CoV-2 spike proteins is blocked by factor D inhibition. Blood 2020, 136, 2080–2089. [Google Scholar] [PubMed]
- Livak, K.J.; Schmittgen, T.D. Analysis of relative gene expression data using real-time quantitative PCR and the 2(-Delta Delta C(T)) Method. Methods 2001, 25, 402–408. [Google Scholar] [CrossRef]
Primer Name | Primer Sequence (5′-3′) | Application |
---|---|---|
Df 5′ | AGGTTATCCCCACAGCAACGCCCTT | RACE |
Df 3′ | AGGCTGATGCTCACTCCCGTCCGT | RACE |
UPM | CTAATACGACTCACTATAGGGCAAGCAGTGGTATCAACGCAGAGT | RACE |
M13F(-47) | CGCCAGGGTTTTCCCAGTCACGAC | Sequence |
RV-M | GAGCGGATAACAATTTCACACAGG | Sequence |
rDf F | CCGGGATCCATTACAGGAGGAAGTGAG | Prokaryotic expression |
rDf R | CCCGAATTCTTACTGGGTGGTTGTGCT | Prokaryotic expression |
CiDf YF | ACGACCGGACAAATTGCAAG | qPCR |
CiDf YR | TGCTGGTGAACTTCGTCCCAT | qPCR |
β-actin YF | GGCTGTGCTGTCCCTGTATG | qPCR |
β-actin YR | CTCTGGGCACCTGAACCTCT | qPCR |
18S RNA YF | ATTTCCGACACGGAGAGG | qPCR |
18S RNA YR | CATGGGTTTAGGATACGCTC | qPCR |
Species | GenBank Number |
---|---|
Larimichthys crocea | KKF28223.1 |
Oplegnathus fasciatus | AIZ96981.1 |
Ictalurus punctatus | AEW10547.1 |
Channa striata | SSC14279.1 |
Oreochromis niloticus | XP003447819.1 |
Cynoglossus semilaevis | XP008314450.1 |
Maylandia zebra | XP004554830.1 |
Fundulus heteroclitus | XP012727595.1 |
Clupea harengus | XP012693684.1 |
Danio rerio | NP001018368.1 |
Nothobranchius furzeri | SBP53828.1 |
Ophiophagus hannah | ETE68974.1 |
Terrapene mexicana triunguis | XP026510843.1 |
Ursus arctos horribilis | XP026336632.1 |
Dromaius novaehollandiae | XP025964073.1 |
Canis lupus dingo | XP025312436.1 |
Zonotrichia albicollis | XP014130555.1 |
Poecilia reticulata | XP008397016.1 |
Lipotes vexillifer | XP007460509.1 |
Alligator mississippiensis | XP006272575.1 |
Bos taurus | NP001029427.1 |
Erinaceus europaeus | XP007524916.2 |
Homo sapiens | NP001919.2 |
Rattus norvegicus | NP001071110.1 |
Camelus dromedarius | KAB1259241.1 |
Castor canadensis | JAV41751.1 |
Leptonychotes weddellii | XP_006740829.1 |
Echinops telfairi | XP_004717028.1 |
Delphinapterus leucas | XP_022421399.2 |
Triplophysa tibetana | KAA0717797.1 |
Strigops habroptila | XP_030364968.1 |
Takifugu flavidus | TWW72489.1 |
Serinus canaria | XP_030086118.1 |
Aquila chrysaetos chrysaetos | XP_029888753.1 |
Liparis tanakae | TNN52007.1 |
Protobothrops mucrosquamatus | XP_015665549.1 |
Esox lucius | XP_010877625.1 |
Collichthys lucidus | TKS87224.1 |
Ornithorhynchus anatinus | XP_028905544.1 |
Macaca mulatta | XP_014977796.2 |
Peromyscus leucopus | XP_028714389.1 |
Lynx pardinus | VFV21436.1 |
Balaenoptera acutorostrata scammoni | XP_028020846.1 |
Ovis aries | XP_012033825.1 |
Marmota flaviventris | XP_027779348.1 |
Falco cherrug | XP_027668635.1 |
Tupaia chinensis | XP_014440966.1 |
Penaeus vannamei | ROT85320.1 |
Lagenorhynchus obliquidens | XP_026941784.1 |
Anabarilius grahami | ROK15838.1 |
Acinonyx jubatus | XP_026905297.1 |
Urocitellus parryii | XP_026269752.1 |
Apteryx rowi | XP_025920610.1 |
Nothobranchius kuhntae | SBR24004.1 |
Nothobranchius kadleci | SBQ40315.1 |
Paralichthys olivaceus | ACV89350.1 |
Nothobranchius rachovii | SBR75430.1 |
Cyprinus carpio | AYD42292.1 |
Carassius auratus | XP_026079875.1 |
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations. |
© 2021 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Ding, C.; Xiao, T.; Qin, B.; Xu, B.; Lv, Z.; Wang, H. Functional Identification of Complement Factor D and Analysis of Its Expression during GCRV Infection in Grass Carp (Ctenopharyngodon idella). Int. J. Mol. Sci. 2021, 22, 12011. https://doi.org/10.3390/ijms222112011
Ding C, Xiao T, Qin B, Xu B, Lv Z, Wang H. Functional Identification of Complement Factor D and Analysis of Its Expression during GCRV Infection in Grass Carp (Ctenopharyngodon idella). International Journal of Molecular Sciences. 2021; 22(21):12011. https://doi.org/10.3390/ijms222112011
Chicago/Turabian StyleDing, Chunhua, Tiaoyi Xiao, Beibei Qin, Baohong Xu, Zhao Lv, and Hongquan Wang. 2021. "Functional Identification of Complement Factor D and Analysis of Its Expression during GCRV Infection in Grass Carp (Ctenopharyngodon idella)" International Journal of Molecular Sciences 22, no. 21: 12011. https://doi.org/10.3390/ijms222112011