Next Article in Journal
Disrupting the Molecular Pathway in Myotonic Dystrophy
Next Article in Special Issue
Genome-Wide Identification of OSC Gene Family and Potential Function in the Synthesis of Ursane- and Oleanane-Type Triterpene in Momordica charantia
Previous Article in Journal
Practical Considerations of Dissolved Oxygen Levels for Platelet Function under Hypoxia
Previous Article in Special Issue
Transcriptional Responses and GCMS Analysis for the Biosynthesis of Pyrethrins and Volatile Terpenes in Tanacetum coccineum
 
 
Search for Articles:
Title / Keyword
Author / Affiliation / Email
Journal
Article Type
 
 
Advanced Search
 
Section
Special Issue
Volume
Issue
Number
Page
 
Journals
IJMS
Volume 22
Issue 24
10.3390/ijms222413230
ijms-logo
Submit to this Journal Review for this Journal Propose a Special Issue
► Article Menu

Article Menu

share Share announcement Help format_quote Cite question_answer Discuss in SciProfiles thumb_up
...
Endorse textsms
...
Comment
first_page
settings
Order Article Reprints
Font Type:
Arial Georgia Verdana
Font Size:
Aa Aa Aa
Line Spacing:
Column Width:
Background:
Article

Organelle Comparative Genome Analysis Reveals Novel Alloplasmic Male Sterility with orf112 in Brassica oleracea L.

by
Li Chen
1,2,
Wenjing Ren
1,2,
Bin Zhang
1,2,
Wendi Chen
1,
Zhiyuan Fang
1,
Limei Yang
1,
Mu Zhuang
1,
Honghao Lv
1,
Yong Wang
1,
Jialei Ji
1 and
Yangyong Zhang
1,*
1
Key Laboratory of Biology and Genetic Improvement of Horticultural Crops, Institute of Vegetables and Flowers, Chinese Academy of Agricultural Sciences, Ministry of Agriculture, Beijing 100081, China
2
State Key Laboratory of Crop Genetics and Germplasm Enhancement, College of Horticulture, Nanjing Agricultural University, Nanjing 210095, China
*
Author to whom correspondence should be addressed.
Int. J. Mol. Sci. 2021, 22(24), 13230; https://doi.org/10.3390/ijms222413230
Submission received: 12 November 2021 / Revised: 4 December 2021 / Accepted: 6 December 2021 / Published: 8 December 2021
(This article belongs to the Special Issue Plant Genomics and Genome Editing)
Browse Figures
Review Reports Versions Notes

Abstract

:
B. oleracea Ogura CMS is an alloplasmic male-sterile line introduced from radish by interspecific hybridization and protoplast fusion. The introduction of alien cytoplasm resulted in many undesirable traits, which affected the yield of hybrids. Therefore, it is necessary to identify the composition and reduce the content of alien cytoplasm in B. oleracea Ogura CMS. In the present study, we sequenced, assembled, and compared the organelle genomes of Ogura CMS cabbage and its maintainer line. The chloroplast genome of Ogura-type cabbage was completely derived from normal-type cabbage, whereas the mitochondrial genome was recombined from normal-type cabbage and Ogura-type radish. Nine unique regions derived from radish were identified in the mitochondrial genome of Ogura-type cabbage, and the total length of these nine regions was 35,618 bp, accounting for 13.84% of the mitochondrial genome. Using 32 alloplasmic markers designed according to the sequences of these nine regions, one novel sterile source with less alien cytoplasm was discovered among 305 materials and named Bel CMS. The size of the alien cytoplasm in Bel CMS was 21,587 bp, accounting for 8.93% of its mtDNA, which was much less than that in Ogura CMS. Most importantly, the sterility gene orf138 was replaced by orf112, which had a 78-bp deletion, in Bel CMS. Interestingly, Bel CMS cabbage also maintained 100% sterility, although orf112 had 26 fewer amino acids than orf138. Field phenotypic observation showed that Bel CMS was an excellent sterile source with stable 100% sterility and no withered buds at the early flowering stage, which could replace Ogura CMS in cabbage heterosis utilization.

1. Introduction

Cabbage (Brassica oleracea L. var. capitata) is an important leafy vegetable crop that is widely cultivated worldwide. As a typical cross-pollinated plant, cabbage exhibits noticeable heterosis, and hybrids usually have better growth potential, yield, and disease resistance than their parents [1]. The utilization of heterosis in Brassica crops depends mainly on either self-incompatible or male-sterile lines [2].
Cytoplasmic male sterility (CMS) is maternally inherited. With CMS, the pistil develops normally, but the stamen is abnormal and cannot produce functional pollen [3,4]. The use of CMS not only ensures the quality and purity of hybrids, but also protects the intellectual property rights related to the parents. Therefore, cytoplasmic male-sterile lines have gradually replaced the use of self-incompatible lines as the main method of hybrid production in many Brassica crops [2]. CMS occurs widely among higher plants, and CMS caused by natural variation in the mitochondrial genome is usually referred to as homoplasmic CMS. Examples of homoplasmic CMS include CMS-T in maize [5], Pol CMS and Nap CMS in rapeseed [6,7], and NWB CMS and DCGMS in radish [8,9]. To date, no occurrences of homoplasmic CMS have been found in B. oleracea crops. CMS derived from interspecific or intergeneric hybridization and somatic cell fusion is often referred to as alloplasmic CMS [10]. The most widely used alloplasmic male-sterile line in B. oleracea is the Ogura CMS, which was introduced from radish [1]. Although the Ogura CMS line has greatly improved the seed purity of B. oleracea and has undergone several rounds of improvements [11,12], many undesirable traits affecting seed yield are still present, such as a high rate of withered buds, small nectaries, a light petal color, and low seed production. Previous studies in Solanaceae and Cruciaceae crops have shown that alloplasmic CMS retains many redundant donor mitochondrial genome sequences [13,14,15,16]. It is possible that the exogenous mitochondrial fragment could not coordinate with the nuclear genome and resulted in those undesirable traits. Identifying the composition and content of the exogenous fragments is of great importance to solve the problem.
Chloroplasts and mitochondria are essential semiautonomous organelles for higher plants [17]. Many studies have shown that chloroplasts and mitochondria are not only responsible for photosynthesis and respiration, but also associated with many various traits, such as seed oil content, cold tolerance, and sex differentiation [18,19,20]. Therefore, the chloroplast and mitochondrial genomes are important molecular bases for higher plant cell functions. The chloroplast genomes (cpDNAs) of higher plants are structurally simple, small (100~300 kb), and stably inherited with nearly no recombination [21]. In contrast, plant mitochondrial genomes (mtDNAs) are highly variable in terms of size and structure [22]. For example, the mtDNA in Brassica is approximately 200 kb [23], but the mtDNA in Silene conica is approximately 11.3 Mb [24]. Interestingly, there is no linear relationship between the size of mtDNA and the number of encoded genes. In addition, plant mitochondrial genomes have complex structures, which are mainly the result of frequent recombination events and gene rearrangement [25,26]. Abnormal recombination and nonhomologous end-joining (NHEJ) activities often lead to the formation of novel open reading frames (ORFs) [27]. These novel genes could possibly form chimeric structures with known mitochondrial genes and encode proteins with transmembrane domains, which may cause abnormal development of flower organs or pollen grains and eventually result in CMS [28].
In this study, the complete chloroplast and mitochondrial genomes of Ogura CMS cabbage and its maintainer line were obtained via second- and third-generation sequencing technologies. The size and composition of alien fragments in the Ogura-type cabbage mitochondrial genome were determined by comparative genome analysis. Based on these results, a set of alloplasmic screening markers was developed, and a novel excellent sterility source, Bel CMS, was identified using this screening system, which had less alien cytoplasm and no withered buds at early flowering stage. These results lay the foundation for heterosis utilization and cytoplasmic improvement in B. oleracea.

2. Results

2.1. Analysis of Ogura- and Normal-Type Chloroplast Genomes

Using second-generation sequencing data, we assembled the chloroplast genomes of normal-type and Ogura-type cabbage into single circular molecules with sizes of 153,365 bp and 153,363 bp, respectively (Figure 1A). The overall GC content of both cpDNAs was 36.36%, which was comparable to that of other cpDNAs among Brassicaceae. The two chloroplast genomes had similar structures, including a long single copy (LSC), a short single copy (SSC), and a pair of inverted repeats (IRA and IRB) (Figure 1B).
In total, 131 genes were identified in the chloroplast genome, consisting of 86 protein-coding genes, eight rRNA genes, and 37 tRNA genes. The protein-coding genes mainly included ATP synthase, the cytochrome b/f complex, NADH dehydrogenase, photosystem, ribosomal proteins, and other related genes (Table 1). Among the 131 genes, 114 genes had no introns, 15 genes (trnK-UUU, rps16, trnG-UCC, atpF, rpoC1, rnL-UAA, trnV-UAC, petB, petD, rpl16, rpl2, ndhB, trnI-GAU, trnA-UGC and ndhA) contained one intron, two genes (clpP and ycf) contained two introns, and one gene (rps12) exhibited trans-splicing. Compared with Ogura-type radish (NC_024469.1), the chloroplast genome of cybrid 19-3-2 was identical to normal-type cabbage in structure and coding sequence, indicating that the chloroplast genome of cybrid 19-3-2 was completely derived from B. oleracea (Table S1).

2.2. Analysis of Ogura- and Normal-Type Mitochondrial Genome

Because the mitochondrial genomes of higher plants usually exhibit considerable structural variation, we used second- and third-generation sequencing technologies to assemble the mitochondrial genomes to ensure accuracy. The mitochondrial genome of normal-type cabbage 19-3-1 was ultimately assembled into a single circular molecule of 219,969 bp with a GC content of 45.25% (Figure 2A). However, the mitochondrial genome of Ogura-type cabbage 19-3-2 was assembled into two circular molecules of different sizes (Figure 2B). The small circle (19-3-2_MT1) comprised 71,998 bp with a GC content of 45.56%, and the large circle (19-3-2_MT2) comprised 185,431 bp with a GC content of 45.25%.
The normal- and Ogura-type mitochondrial genomes were annotated via BLAST homology alignment and tRNAscan-SE. The coding genes within the two types of mitochondrial genomes were relatively conserved. A total of 33 protein-coding genes, three rRNA genes, and 18 tRNA genes were detected in the normal-type mitochondrial genome. The 33 protein-coding genes included nine subunits of complex I (nad1, 2, 3, 4, 4 L, 5, 6, 7, and 9), one subunit of complex III (cob), four subunits of complex IV (cox1, 2-1, 2-2 and 3), five subunits of complex V (atp1, 4, 6, 8, and 9), five cytochrome c biogenesis genes (ccmB, ccmC, ccmFN1, ccmFN2 and ccmFC), eight ribosomal genes (rpl2, rpl5, rpl16, rps3, rps4, rps7, rps12 and rps14), and one maturase gene (matR). The mitochondrial genome of Ogura-type cabbage contains all of the above genes as well as an additional sterility gene orf138 and three tRNA genes (trnfM-CAU, trnN-GUU and trnY-GUA) (Table S2).

2.3. Synteny Analysis of the Mitochondrial Genomes

To further clarify the structure and composition of the Ogura-type cabbage mitochondrial genome, syntenic analysis was performed with the normal-type cabbage and the Ogura-type radish mitochondrial genomes (NC_018551) (Figure 3A,B). The results showed that there were 13 structural variations (>1 kb in size) between Ogura- and normal-type cabbage mtDNA, while there were 22 structural variations (>1 kb in size) between Ogura-type cabbage and radish mtDNA. Moreover, the structural variations between Ogura-type cabbage and radish were more complex, and the syntenic regions were short and scattered. Therefore, the mtDNA of Ogura-type cabbage exhibited higher synteny with normal-type cabbage than with Ogura-type radish. We designed 15 pairs of primers based on the structural variations between Ogura- and normal-type cabbage mtDNA (Table S3). The PCR results showed that all the primers had amplification products in Ogura-type cabbage, while no amplification was detected in normal-type cabbage (Figure 3C), which further confirmed the structural variations between the Ogura- and normal-type cabbage mtDNA. We also compared the coding sequences of the three mitochondrial genomes. With the exception of a SNP (1398 A/G) within the rrn18 gene, the coding sequences of Ogura- and normal-type cabbage mtDNA were consistent. However, compared to Ogura-type radish (NC_018551), there were 16 genes with at least one base mutation in Ogura-type cabbage, some of which resulted in amino acid changes (Table 2).

2.4. Development and Application of Alloplasmic Markers

Sequence alignment showed that nine specific regions in the Ogura-type cabbage mitochondrial genome were completely derived from Ogura-type radish, and among these regions, the Ogura sterility gene orf138 was located in region R8 (Figure 4A). The nine specific regions varied in size, with the smallest R1 (1551 bp) and the largest R9 (6820 bp) (Table 3). The total length of the nine specific regions was 35,618 bp, accounting for 13.84% of the Ogura-type cabbage mtDNA. Moreover, the gene annotation results showed that the nine specific regions did not encode any known mitochondrial genes, except for the sterility gene orf138.
Based on the sequences of the nine specific regions, a total of 32 specific markers were developed to identify the alien cytoplasm (Table S4). These markers were used to identify the cytoplasm of 305 cabbage materials. The detection results of 152 materials were consistent with those of normal-type cabbage, indicating that these materials did not have alien cytoplasm and were not from the Ogura CMS. The other 150 materials were consistent with Ogura-type cabbage, indicating that they had the same alien cytoplasm as the Ogura-type cabbage. Notably, three materials, namely 19-2202, JY314, and 18Q2183, were significantly different from both Ogura-type and normal-type cabbage. Only 16 out of the 32 markers were detected in these three materials, and the markers representing the specific regions of R2 to R6 were not amplified (Figure 4B), which indicated that the content of alien cytoplasm in these three materials was much lower than that in the Ogura-type cabbage. In addition, we found that the amplification product of the Ogura sterility gene orf138 in these three materials was slightly shorter than that in Ogura-type cabbage. Sequencing and comparison results showed that the orf138 gene in these three materials had a 78-base deletion. However, there were no SNPs, and the amino acid sequence on either side of the deletion was not changed. Because the new gene encoded 112 amino acids, we named it orf112. Based on the differences in the sterility genes and alien cytoplasm composition, we considered this material to be a new type of CMS line distinct from Ogura CMS and named it Bel CMS. We then sequenced the chloroplast and mitochondrial genomes of the Bel CMS to determine the exact composition of the radish fragment in its mitochondrial genome.

2.5. Analysis of the Chloroplast and Mitochondrial Genomes of Bel CMS

The chloroplast genome of Bel CMS was ultimately assembled into a single circular molecule comprised of 153,377 bp and a CG content of 36.37%. Annotation and comparison showed that the coding genes and structure of Bel CMS were the same as those of Ogura- and normal-type cabbage (Figure S1).
Similar to the Ogura-type cabbage mitochondrial genome, the Bel CMS mitochondrial genome was also assembled into two circles (Figure 5). The small circle (19-2202_MT1) comprised 65,849 bp with a CG content of 45.57%. The large circle (19-2202_MT2) comprised 175,791 bp with a CG content of 45.04%. The gene annotation results showed that the Bel CMS mitochondrial genome encoded a total of 57 known genes, including 34 protein-coding genes, three rRNA genes, and 20 tRNA genes (Table S5). Except for the sterility gene orf112, the other protein-coding genes did not differ from those in Ogura-type cabbage.

2.6. Structural Variations and Alloplasmic Composition of the Bel CMS Mitochondrial Genome

Synteny analysis showed that there were 10 structural variations (>1 kb in size) between the Bel CMS mitochondrial genome and the normal cabbage mitochondrial genome (Figure 6A). In addition, there were 21 structural variations (>1 kb in size) between the Bel CMS mitochondrial genome and the radish mitochondrial genome (Figure 6B). Compared to Ogura-type cabbage, Bel CMS exhibited a higher synteny with normal cabbage, which indicated that the mitochondrial genome of Bel CMS was more closely related to that of normal cabbage in terms of genetic relationships.
The sequencing and comparison results showed that a total of four specific regions in the Bel CMS mitochondrial genome were completely derived from Ogura-type radish (Figure 6C, Table 4). The first three specific regions in Bel CMS corresponded to R7, R1, R8 and R9 in Ogura-type cabbage, which was consistent with our detection results using alloplasmic markers (Figure 4B). The fourth region, R10, was not present in Ogura-type cabbage and was unique to 19-2202. The total length of alien cytoplasm in the Bel CMS was 21,587 bp, accounting for 8.93% of the whole mtDNA, which was much lower than the proportion of alien cytoplasm in Ogura-type cabbage (13.84%).

2.7. Comparison of Phenotypes of Ogura CMS and Bel CMS Cabbage under Field Conditions

To compare the performance of Bel CMS and Ogura CMS in terms of various breeding traits, 19-2202 and 19-3-1 were used as the male parent and female parent, respectively, for crossing and successive backcrossing. Phenotypic observations of thirty F1-generation plants revealed no significant differences in flower organ development (Figure 7C) or degree of sterility (Figure 7D–F) between Bel CMS and Ogura CMS under the same field conditions. The main difference was that Bel CMS had no withered buds at the early flowering stage, while Ogura CMS displayed severe bud mortality (Figure 7A,B). Thus, the discovery of Bel CMS is of great significance for the heterosis utilization in B. oleracea.

3. Discussion

3.1. Sequencing and Assembly of Plant Organelle Genomes

With the development of sequencing technology, the complete sequences of many plant organelle genomes have been released. To date, chloroplast and mitochondrial genome sequencing has been completed for 6284 and 419 plant species, respectively (https://www.ncbi.nlm.nih.gov/genome/browse#!/organelles (accessed on 2 December 2021)). Chloroplast genomes are easy to assemble due to their simple structure and low degree of variation [21]. However, plant mitochondrial genomes contain many repeat sequences as well as inserts of nuclear and chloroplast origin, making their assembly difficult [10]. Because third-generation sequencing technology can accurately identify structural variation, it has advantages for the sequencing and assembly of mitochondrial genomes with complex structures. Further, the second generation sequencing technology has high sequencing accuracy. The difficulty of assembling plant mitochondrial genomes is greatly reduced through second- and third-generation sequencing technology, which greatly promotes the composition analysis of plant mitochondrial genomes [29,30,31].
In this study, the complete cabbage chloroplast genome sequences of one fertile line and two male-sterile lines were obtained using Illumina HiSeq data. The three chloroplast genomes consisted of an LSC, an SSC, and a pair of inverted repeats (IRA and IRB) (Figure 1 and Figure S1), which are typical structures of plant chloroplast genomes, and the coding genes were highly conserved among these three genomes. This result is consistent with previous results. Kim et al. (2018) sequenced and compared the chloroplast genomes of 28 Brassica crop plants and found that the chloroplast genomes of cabbage plants with the C genome present low intraspecies diversity compared to those of other Brassica crop species [32].
Using Illumina HiSeq data and Nanopore Sequel data, we obtained three cabbage mitochondrial genomes. The genome of the fertile line was a single circular molecule (Figure 2A), but the genomes of other two male-sterile lines contained two circular molecules (Figure 2B and Figure 5), which was different from some other findings in cruciferous crops [4,33,34]. In fact, plant mitochondrial genomes can have various forms, such as linear forms [35,36], mixed linear and circular forms [37,38], single circular molecules [10,33,39], and one main circular molecule plus several subgenomes [40]. With the development and application of third-generation sequencing technology, an increasing number of plant mitochondrial genomes with polycyclic structures have been identified, especially in cytoplasmic male-sterile lines. The mitochondrial genome of the commercial sugarcane species Khon Kaen 3 was assembled into two circles of different sizes via PacBio Sequel [41]. Similarly, using specific length readings generated by PacBio Sequel, it was demonstrated that three isoforms of mtDNA molecules exist in the radish NWB CMS mitochondrial genome [4]. The recombination of repeated sequences leads to different isoforms of mitochondrial genome [42], and the variation of alloplasmic CMS mitogenome is likely to result from protoplast fusion and interspecific hybridization.

3.2. The Alien Cytoplasm MAY Affect the Agronomic Traits of Alloplasmic CMS Lines

In sexual reproductive plants, organelle genomes follow the principle of maternal inheritance, but in somatic hybridization, organelle genomes are inherited in a more complex manner [43]. It has been shown that chloroplasts generally do not fuse with each other during plant growth and development; that is, only one parent chloroplast is present in somatic hybrids. In contrast, mitochondria usually undergo fusion, which means that the mitochondria of somatic hybrids contain exogenous fragments from the donor parent, especially in asymmetric fusion [13,44,45]. In this study, the chloroplast genomes of the two alloplasmic cytoplasmic male-sterile lines examined were derived completely from cabbage, while the mitochondrial genomes consisted of cabbage components as well as components of radish cytoplasm. These results were consistent with those of previous studies.
Most importantly, these cytoplasmic male sterile lines produced by protoplast fusion and interspecific hybridization usually showed poorer agronomic traits than maintainer lines, such as leaf yellowing, abnormal pistil, incomplete nectary development, seed pod deformity, flower bud yellowing, and abscission [46,47,48], but these undesirable traits were not observed in nuclear dominant male sterile lines without exogenous fragments [49]. Therefore, it is possible that these undesirable traits were caused by the disharmony between exogenous mitochondrial fragments and nuclear genes. Based on sequencing and comparative genome analysis, nine radish-specific fragments were identified in cabbage Ogura CMS with a total length of 35,618 bp, accounting for 13.84% of the mtDNA (Figure 4A). However, there were only four radish-specific fragments in Bel CMS with a total length of 21,587 bp, accounting for 8.93% of the mtDNA (Figure 6C). Ogura CMS is currently widely used in the production of cabbage hybrids, but it has the disadvantages of a high withered bud rate at the early flowering stage. Field phenotypic and pollen staining observations showed that Bel CMS had no withered buds (Figure 7), suggesting that the improvement of agronomic traits is likely to be related to the reduction of exogenous fragments. Moreover, those exogenous fragments may contain unknown genes or regulatory elements that can regulate the early development of flower buds. Cabbage Bel CMS is likely to replace Ogura CMS for cabbage heterosis utilization due to its less alien cytoplasm and better agronomic traits.

3.3. Comparison of Sterility Genes between Ogura CMS and Bel CMS in B. oleracea Plants

In homoplasmic male-sterile lines, sterility genes are mostly novel ORFs derived from mtDNA recombination and NHEJ, and they generally form chimeric structures together with known mitochondrial genes [27]. This feature has become one of the bases for identifying candidate genes for CMS. A variety of CMS genes have been identified by a comparative analysis of the mitochondrial genomes of cytoplasmic male-sterile lines and their maintainer lines, such as orf113 in rice RT98A CMS [50], orf507 in the pepper cytoplasmic male-sterile line FS4401 [51], orf182 in rice D1-CMS [52], and orf463a in Radish NWB CMS [4]. In alloplasmic male-sterile lines, the CMS gene is derived from the donor parent. The candidate gene orf346 in Nsa CMS Brassica napus has been demonstrated to be completely derived from the mitochondrial genome of Arvensis without any sequence variation [10,53]. Previous studies have shown that orf138 in radish exhibits various polymorphisms, and they were classified into nine haplotypes (A~I) according to the difference in the nucleotide sequence [54]. The orf138 gene in Ogura CMS cabbage line 19-3-2 belongs to haplotype A, which was consistent with the Ogura CMS cabbage line R2P2CMS [34].
Through restriction enzyme digestion and sequencing analysis, the sterility gene orf138 was identified from B. napus cybrid 13 carrying Ogura CMS [55,56]. Subsequently, two homologous genes of orf138 were discovered. The first was orf125 in the Japanese cultivar Kozena [57] and Japanese wild radish [58], which is the sterility gene of Kos CMS. Compared to orf138, orf125 had a 39-base deletion and two SNPs in the coding region (Figure 8). Kos CMS and its sterility gene, orf125, have been transferred into B. napus although protoplast fusion [59,60], and a 23-kb fragment derived from radish has been detected in the mitochondrial genome of cybrid progeny, accounting for 8.8% of mtDNA [16]. The other gene, orf112, was identified for the first time in the selfing progeny of B. napus cybrid 13F [61], with a deletion of 78 bases but no SNPs compared to orf138. However, there have been no reports about the use of this sterility gene. Sequence alignment showed that the 3′ ends of all three homologous genes had a 39-nucleotide sequence (AAAGGGGAAATAGAGGGGAAAGAGGAAAAAAAAGAGGGG), which was consecutively repeated three times in orf138, but there were only two repeats in orf125 and only one repeat in orf112 (Figure 8). At present, the function of this 39-bp repeat is unclear. The orf112 gene we found in cabbage CMS line 19-2202 was identical to that in B. napus, and both of them were probably introduced from radish through protoplast fusion and intergeneric hybridization. According to the name of the original discoverer, the CMS line containing orf112 was named Bel CMS to distinguish it from Ogura CMS and Kos CMS. We developed a molecular marker ‘OKB’ that can identify these three genes (OKB-F: TATTTTCTCGGTCCATTTTCCACCTCTT; OKB-R: GAATTTCAGTATGGGTGGCTAGGCGTC; annealing at 62 °C for 30 cycles), which can identify these three CMS types as well as fertile line efficiently and quickly at the seedling stage (Figure 8B). In addition, previous studies have shown that Ogura CMS and Kos CMS have the same restorer gene (Rfo/Rfk) [62], so the fertility of Bel CMS is likely to be restored by this restorer gene. We have hybridized Bel CMS with a fertile line containing the Rfo gene [1,63], and the fertility was successfully recovered, which showed that all three kinds of CMS can be fertility-restored by the same Rfo gene.

4. Materials and Methods

4.1. Plant Materials

The 305 cabbage materials used in this study were inbred lines and CMS lines, which were collected or created by the Institute of Vegetables and Flowers, Chinese Academy of Agricultural Sciences (IVF-CAAS). The original Ogura CMS materials were introduced from U.S.A. in 1998 by Prof. Zhiyuan Fang. 19-3-1 is a normal fertile cabbage inbred line. Different cabbage inbred lines were used as male parent to cross with donor CMS materials and successive backcross for multiple generations to generate different CMS cabbage lines, such as 19-3-2 and 19-2202. All the plant materials were grown in a greenhouse at IVF-CAAS.

4.2. Organelle Genome Sequencing, Assembly and Annotation

About 10 g of fresh cabbage leaves were harvested and quick-frozen in liquid nitrogen for DNA isolation using a modified extraction method. Genome sequencing of DNA samples was performed using second-generation Illumina HiSeq and third-generation ONT sequencing technology, after which an Illumina paired-end (PE) library (300–500 bp) and a Nanopore library (8–10 kb) were constructed. Sequencing was performed using NovaSeq 6000 and Nanopore high-throughput sequencing platforms.
The adapters, reads containing over 10% Ns (uncalled bases), duplicated sequences, and low-quality reads (the Phred scores < Q20) were removed. The Phred scores (Q20, Q30) and GC content of the clean data were calculated. SPADES 3.9.0 and Paired-Read Iterative Contig Extension (Price) software were used for genome assembly.
UGENE ORFS Finder was used to annotate the protein-coding genes, and tRNA annotations were submitted to the tRNAscan-se online website for annotation. RNAmmer 1.2 Server (https://services.healthtech.dtu.dk/service.php?RNAmmer-1.2/ (accessed on 2 December 2021)) was used to annotate the rRNAs. After the sequence annotation was finished, it was edited via Sequin to generate a submission file that could be submitted to the GenBank database. The edited GenBank annotation file was submitted to OGDRAW to construct an annotation map.

4.3. Collinearity Analysis and Sequence Alignment

The target and reference genomes were compared using MUMmer 3.23 software, and large-scale collinearity between the genomes was assessed. LASTZ 1.03.54 was then used to compare the regions to determine the local location arrangement relationships and identify Translocation/Trans, Inversion/Inv, and Translocation + Inversion (Trans + Inv) regions.
The online BLAST website (https://blast.ncbi.nlm.nih.gov/Blast.cgi (accessed on 2 December 2021)) was used for whole-genome sequence alignment. Small regions (<50 kb) and specific genes were compared using DNAMAN 6.0.3.99.

4.4. DNA Extraction and PCR Amplification

Total DNA was extracted from young leaves by the cetyl-trimethylammonium bromide (CTAB) method. All the primers used in this study were designed by Primer 5.0. PCR amplification was performed using a 20-μL reaction system, which included 7 μL of ddH2O, 10 μL of 2× Taq PCR Master Mix, 1 μL of DNA, and 1 μL of forward and reverse primers. The reaction procedure was as follows: predenaturation at 95 °C for 3 min; 35 cycles of denaturation at 95 °C for 15 s, annealing at 60 °C for 15 s and extension at 72 °C for 30 s; final extension at 72 °C for 5 min; and holding at 4 °C. The PCR products were subsequently detected via 1.5% agarose gel electrophoresis.

4.5. Pollen Staining Observation

At the early flowering stage, three plants were taken from each plot, and the top three wide-open flowers were taken from each plant. The anthers were collected and placed in a 2.0 mL centrifuge tube, supplemented with 200 μL Alexandria solution, and dyed at room temperature for 3–6 h. The stained anthers were stripped off to release pollen grains for microscopy observation. The red and rounded is the viable pollen, and the colorless and wrinkled is the unvital pollen.

Supplementary Materials

The following are available online at https://www.mdpi.com/article/10.3390/ijms222413230/s1.

Author Contributions

Conceptualization, L.C. and Y.Z.; data curation, L.C., W.R. and B.Z.; formal analysis, L.C., W.R. and B.Z.; funding acquisition, Y.Z.; investigation, L.C. and W.C.; methodology, L.C., W.R. and W.C.; project administration, L.Y., M.Z. and H.L.; resources, H.L., Y.W. and J.J.; software, Y.W. and J.J.; supervision, Z.F., L.Y. and Y.Z.; validation, Z.F. and M.Z.; writing—original draft, L.C.; writing—review & editing, L.C., Z.F., L.Y. and Y.Z. All authors have read and agreed to the published version of the manuscript.

Funding

This work was supported by grants from the National Natural Science Foundation of China (31872948), the Science and Technology Innovation Program of the Chinese Academy of Agricultural Sciences (CAAS-ASTIP-IVFCAAS), and the earmarked fund for the Modern Agro-Industry Technology Research System, China. The work was performed in the Key Laboratory of Biology and Genetic Improvement of Horticultural Crops, Ministry of Agriculture, Beijing 100081, China. No funders were involved in the design, data analysis, or writing of the study.

Institutional Review Board Statement

Not applicable.

Informed Consent Statement

Not applicable.

Data Availability Statement

The datasets used and/or analyzed during the current study are available from the corresponding author on reasonable request.

Acknowledgments

The authors are grateful to all lab members for their useful suggestions, support, and encouragement.

Conflicts of Interest

The authors declare no conflict of interest.

Abbreviations

CMSCytoplasmic Male Sterility
IRInverted Repeat
LSCLong Single Copy
ORFsOpen Reading Frames
SNPSingle Nucleotide Polymorphism
SSCShort Single Copy

References

  1. Yu, H.; Li, Z.; Ren, W.; Han, F.; Yang, L.; Zhuang, M.; Lv, H.; Liu, Y.; Fang, Z.; Zhang, Y. Creation of fertility-restored materials for Ogura CMS in Brassica oleracea by introducing Rfo gene from Brassica napus via an allotriploid strategy. Theor. Appl. Genet. 2020, 133, 2825–2837. [Google Scholar] [CrossRef]
  2. Kitamoto, N.; Nishikawa, K.; Tanimura, Y.; Urushibara, S.; Matsuura, T.; Yokoi, S.; Takahata, Y.; Yui, S. Correction to: Development of late-bolting F1 hybrids of Chinese cabbage (Brassica rapa L.) allowing early spring cultivation without heating. Euphytica 2018, 214, 30. [Google Scholar] [CrossRef] [Green Version]
  3. Laser, R.D.; Lersten, N.R. Anatomy and cytology of microsporogenesis in cytoplasmic male sterile angiosperms. Bot. Rev. 1972, 38, 425–454. [Google Scholar] [CrossRef]
  4. Wang, Y.; Wang, Q.; Hao, W.; Li, J.; Qi, M.; Zhang, L. Mitochondrial genome sequencing reveals orf463a may induce male sterility in NWB cytoplasm of radish. Genes 2020, 11, 74. [Google Scholar] [CrossRef] [Green Version]
  5. Levings, C.S. Thoughts on cytoplasmic male sterility in cms-T maize. Plant Cell 1993, 5, 1285–1290. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  6. Handa, H.; Gualberto, J.M.; Grienenberger, J.M. Characterization of the mitochondrial orfB gene and its derivative, orf224, a chimeric open reading frame specific to one mitochondrial genome of the “Polima” male-sterile cytoplasm in rapeseed (Brassica napus L.). Curr. Genet. 1995, 28, 546–552. [Google Scholar] [CrossRef]
  7. L’Homme, Y.; Stahl, R.J.; Li, X.Q.; Hameed, A.; Brown, G.G. Brassica nap cytoplasmic male sterility is associated with expression of a mtDNA region containing a chimeric gene similar to the pol CMS-associated orf224 gene. Curr. Genet. 1997, 31, 325–335. [Google Scholar] [CrossRef]
  8. Nahm, S.H.; Lee, H.J.; Lee, S.W.; Joo, G.Y.; Harn, C.H.; Yang, S.; Min, B.W. Development of a molecular marker specific to a novel CMS line in radish (Raphanus sativus L.). Theor. Appl. Genet. 2005, 111, 1191–1200. [Google Scholar] [CrossRef] [PubMed]
  9. Lee, Y.P.; Park, S.; Lim, C.; Kim, H.; Lim, H.; Ahn, Y.; Sung, S.K.; Yoon, M.K.; Kim, S. Discovery of a novel cytoplasmic male-sterility and its restorer lines in radish (Raphanus sativus L.). Theor. Appl. Genet. 2008, 117, 905–913. [Google Scholar] [CrossRef]
  10. Sang, S.; Mei, D.; Liu, J.; Zaman, Q.U.; Zhang, H.; Hao, M.; Fu, L.; Wang, H.; Cheng, H.; Hu, Q. Organelle genome composition and candidate gene identification for Nsa cytoplasmic male sterility in Brassica napus. BMC Genom. 2019, 20, 813. [Google Scholar] [CrossRef] [PubMed]
  11. Bannerot, H.; Boulidard, L.; Canderon, Y.; Tempe, J. Transfer of cytoplasmic male sterility from Raphanus sativus to Brassica oleracea. Eucarpia Crucif. Newsl. 1974, 1, 52–54. [Google Scholar]
  12. Walters, T.W.; Mutschler, M.A.; Earle, E.D. Protoplast fusion-derived Ogura male sterile cauliflower with cold tolerance. Plant Cell Rep. 1992, 10, 624–628. [Google Scholar] [CrossRef] [PubMed]
  13. Sanchez-Puerta, M.V.; Zubko, M.K.; Palmer, J.D. Homologous recombination and retention of a single form of most genes shape the highly chimeric mitochondrial genome of a cybrid plant. New Phytol. 2015, 206, 381–396. [Google Scholar] [CrossRef] [Green Version]
  14. Du, K.; Liu, Q.; Wu, X.; Jiang, J.; Wu, J.; Fang, Y.; Li, A.; Wang, Y. Morphological structure and transcriptome comparison of the cytoplasmic male sterility line in Brassica napus (SaNa-1A) derived from somatic hybridization and its maintainer line SaNa-1B. Front. Plant Sci. 2016, 7, 1313. [Google Scholar] [CrossRef] [Green Version]
  15. Kang, L.; Li, P.; Wang, A.; Ge, X.; Li, Z. A Novel Cytoplasmic Male Sterility in Brassica napus (inap CMS) with Carpelloid Stamens via Protoplast Fusion with Chinese Woad. Front. Plant Sci. 2017, 8, 529. [Google Scholar] [CrossRef] [Green Version]
  16. Arimura, S.I.; Yanase, S.; Tsutsumi, N.; Koizuka, N. The mitochondrial genome of an asymmetrically cell-fused rapeseed, Brassica napus, containing a radish-derived cytoplasmic male sterility-associated gene. Genes Genet. Syst. 2018, 93, 143–148. [Google Scholar] [CrossRef] [Green Version]
  17. Dyall, S.D.; Brown, M.T.; Johnson, P.J. Ancient invasions: From endosymbionts to organelles. Science 2004, 304, 253–257. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  18. Levi, A.; Thomas, C.E.; Thies, J.A.; Simmons, A.M.; Ling, K.S.; Harrison, H.F. Novel watermelon breeding lines containing chloroplast and mitochondrial genomes derived from the desert species Citrullus colocynthis. HortScience 2006, 41, 463–464. [Google Scholar] [CrossRef] [Green Version]
  19. Ali, A.; Bang, S.W.; Yang, E.M.; Chung, S.M.; Staub, J.E. Putative paternal factors controlling chilling tolerance in korean market-type cucumber (Cucumis sativus L.). Sci. Hortic. 2014, 167, 145–148. [Google Scholar] [CrossRef]
  20. Liu, J.; Hao, W.; Liu, J.; Fan, S.; Zhao, W.; Deng, L.; Wang, X.; Hu, Z.; Hua, W.; Wang, H. A novel chimeric mitochondrial gene confers cytoplasmic effects on seed oil content in polyploid rapeseed (Brassica napus). Mol. Plant 2019, 12, 582–596. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  21. Dong, W.; Liu, H.; Xu, C.; Zuo, Y.; Chen, Z.; Zhou, S. A chloroplast genomic strategy for designing taxon specific DNA mini-barcodes: A case study on ginsengs. BMC Genet. 2014, 15, 138. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  22. Bock, R.; Knoop, V. Genomics of chloroplasts and mitochondria. Adv. Photosynth. Respir. 2012, 35, 377. [Google Scholar]
  23. Qiao, J.; Zhang, X.; Chen, B.; Huang, F.; Xu, K.; Huang, Q.; Huang, Y.; Hu, Q.; Wu, X. Comparison of the cytoplastic genomes by resequencing: Insights into the genetic diversity and the phylogeny of the agriculturally important genus Brassica. BMC Genom. 2020, 21, 480. [Google Scholar] [CrossRef] [PubMed]
  24. Sloan, D.B.; Alverson, A.J.; Chuckalovcak, J.P.; Wu, M.; McCauley, D.E.; Palmer, J.D.; Taylor, D.R. Rapid evolution of enormous, multichromosomal genomes in flowering plant mitochondria with exceptionally high mutation rates. PLoS Biol. 2012, 10, e1001241. [Google Scholar] [CrossRef] [Green Version]
  25. Davila, J.I.; Arrieta-Montiel, M.P.; Wamboldt, Y.; Cao, J.; Hagmann, J.; Shedge, V.; Xu, Y.Z.; Weigel, D.; Mackenzie, S.A. Double-strand break repair processes drive evolution of the mitochondrial genome in Arabidopsis. BMC Biol. 2011, 9, 64. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  26. Guo, W.; Grewe, F.; Fan, W.; Young, G.J.; Knoop, V.; Palmer, J.D.; Mower, J.P. Ginkgo and welwitschia mitogenomes reveal extreme contrasts in gymnosperm mitochondrial evolution. Mol. Biol. Evol. 2016, 33, 1448–1460. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  27. Hanson, M.R.; Bentolila, S. Interactions of mitochondrial and nuclear genes that affect male gametophyte development. Plant Cell 2004, 16, S154–S169. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  28. Okazaki, M.; Kazama, T.; Murata, H.; Motomura, K.; Toriyama, K. Whole mitochondrial genome sequencing and transcriptional analysis to uncover an RT102-type cytoplasmic male sterility-associated candidate Gene Derived from Oryza rufipogon. Plant Cell Physiol. 2013, 54, 1560–1568. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  29. Kovar, L.; Nageswara-Rao, M.; Ortega-Rodriguez, S.; Dugas, D.V.; Straub, S.; Cronn, R.; Strickler, S.R.; Hughes, C.E.; Hanley, K.A.; Rodriguez, D.N.; et al. PacBio-based mitochondrial genome assembly of Leucaena trichandra (Leguminosae) and an intrageneric assessment of mitochondrial RNA editing. Genome Biol. Evol. 2018, 10, 2501–2517. [Google Scholar] [CrossRef] [PubMed]
  30. Dong, S.; Zhao, C.; Chen, F.; Liu, Y.; Zhang, S.; Wu, H.; Zhang, L.; Liu, Y. The complete mitochondrial genome of the early flowering plant Nymphaea colorata is highly repetitive with low recombination. BMC Genom. 2018, 19, 614. [Google Scholar] [CrossRef] [PubMed]
  31. Omelchenko, D.O.; Makarenko, M.S.; Kasianov, A.S.; Schelkunov, M.I.; Logacheva, M.D.; Penin, A.A. Assembly and analysis of the complete mitochondrial genome of Capsella bursa-pastoris. Plants 2020, 9, 469. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  32. Kim, C.K.; Seol, Y.J.; Perumal, S.; Lee, J.; Waminal, N.E.; Jayakodi, M.; Lee, S.C.; Jin, S.; Choi, B.S.; Yu, Y.; et al. Re-exploration of U’s triangle Brassica species based on chloroplast genomes and 45S nrDNA sequences. Sci. Rep. 2018, 8, 7353. [Google Scholar] [CrossRef]
  33. Chang, S.; Yang, T.; Du, T.; Huang, Y.; Chen, J.; Yan, J.; He, J.; Guan, R. Mitochondrial genome sequencing helps show the evolutionary mechanism of mitochondrial genome formation in Brassica. BMC Genom. 2011, 12, 497. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  34. Zhong, X.; Chen, D.; Cui, J.; Li, H.; Huang, Y.; Kang, J. Comparative analysis of the complete mitochondrial genome sequences and anther development cytology between maintainer and Ogura-type cytoplasm male-sterile cabbage (B. oleracea Var. capitata). BMC Genom. 2021, 22, 646. [Google Scholar] [CrossRef] [PubMed]
  35. Oldenburg, D.J.; Bendich, A.J. Mitochondrial DNA from the liverwort Marchantia polymorpha: Circularly permuted linear molecules, head-to-tail concatemers, and a 5′ protein. J. Mol. Biol. 2001, 310, 549–562. [Google Scholar] [CrossRef] [PubMed]
  36. Smith, D.R.; Hua, J.; Lee, R.W. Evolution of linear mitochondrial DNA in three known lineages of Polytomella. Curr. Genet. 2010, 56, 427–438. [Google Scholar] [CrossRef] [PubMed]
  37. Allen, J.O.; Fauron, C.M.; Minx, P.; Roark, L.; Oddiraju, S.; Lin, G.N.; Meyer, L.; Sun, H.; Kim, K.; Wang, C.; et al. Comparisons among two fertile and three male-sterile mitochondrial genomes of maize. Genetics 2007, 177, 1173–1192. [Google Scholar] [CrossRef]
  38. Jackman, S.D.; Coombe, L.; Warren, R.L.; Kirk, H.; Trinh, E.; MacLeod, T.; Pleasance, S.; Pandoh, P.; Zhao, Y.; Coope, R.J.; et al. Complete mitochondrial genome of a gymnosperm, Sitka spruce (Picea sitchensis), indicates a complex physical structure. Genome Biol. Evol. 2020, 12, 1174–1179. [Google Scholar] [CrossRef]
  39. Tanaka, Y.; Tsuda, M.; Yasumoto, K.; Yamagishi, H.; Terachi, T. A complete mitochondrial genome sequence of Ogura-type male-sterile cytoplasm and its comparative analysis with that of normal cytoplasm in radish (Raphanus sativus L.). BMC Genom. 2012, 13, 352. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  40. Alverson, A.J.; Rice, D.W.; Dickinson, S.; Barry, K.; Palmer, J.D. Origins and recombination of the bacterial-sized multichromosomal mitochondrial genome of cucumber. Plant Cell 2011, 23, 2499–2513. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  41. Shearman, J.R.; Sonthirod, C.; Naktang, C.; Pootakham, W.; Yoocha, T.; Sangsrakru, D.; Jomchai, N.; Tragoonrung, S.; Tangphatsornruang, S. The two chromosomes of the mitochondrial genome of a sugarcane cultivar: Assembly and recombination analysis using long PacBio reads. Sci. Rep. 2016, 6, 31533. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  42. Yamagishi, H.; Tanaka, Y.; Shiiba, S.; Hashimoto, A.; Fukunaga, A. Mitochondrial orf463 causing male sterility in radish is possessed by cultivars belonging to the ‘Niger’ group. Euphytica 2019, 215, 109. [Google Scholar] [CrossRef]
  43. Wang, J.; Jiang, J.; Li, X.; Li, A.; Zhang, Y.; Guan, R.; Wang, Y. Complete sequence of heterogenous-composition mitochondrial genome (Brassica napus) and its exogenous source. BMC Genom. 2012, 13, 675. [Google Scholar] [CrossRef] [Green Version]
  44. Temple, M.; Makaroff, C.A.; Mutschler, M.A.; Earle, E.D. Novel mitochondrial genomes in Brassica napus somatic hybrids. Curr. Genet. 1992, 22, 243–249. [Google Scholar] [CrossRef] [PubMed]
  45. Sheahan, M.B.; McCurdy, D.W.; Rose, R.J. Mitochondria as a connected population: Ensuring continuity of the mitochondrial genome during plant cell dedifferentiation through massive mitochondrial fusion. Plant J. 2005, 44, 744–755. [Google Scholar] [CrossRef] [PubMed]
  46. Bannerot, H.; Boulidard, L.; Chupeau, Y. Unexpected difficulties met with radish cytoplasm in Brassica oleracea. Eucarpia Crucif. Newsl. 1977, 2, 16. [Google Scholar]
  47. Mesquida, J.; Renard, M. The entomophilous pollination of male sterile strains of winter rapeseed (Brassica napus L.) and a preliminary study of alternating devices. In Proceedings of the Fourth International Symposium on Pollination: Increasing Production of Agricultural Crops through Increased Insect Pollinatin: 11–13 October 1978; Caron, D.M., Ed.; University of Maryland: College Park, MD, USA, 1978; pp. 49–57. [Google Scholar]
  48. Yang, L.; Liu, Y.; Wang, X.; Sun, P.; Zhuang, M.; Fang, Z. Preliminary observation on main botanical characteristics of cytoplasmic male sterile cabbage. China Veg. 1997, 6, 24–25. [Google Scholar]
  49. Wang, Q.; Fang, Y.; Liu, Y.; Yang, L.; Mu, Z.; Sun, P. The floral and seed setting characteristics in two types of male sterile lines of cabbage (Brassica oleracea L. var. capitata). Acta Hortic. Sin. 2011, 38, 61–68. [Google Scholar]
  50. Igarashi, K.; Kazama, T.; Motomura, K.; Toriyama, K. Whole genomic sequencing of RT98 mitochondria derived from Oryza rufipogon and northern blot analysis to uncover a cytoplasmic male sterility-associated gene. Plant Cell Physiol. 2013, 54, 237–243. [Google Scholar] [CrossRef] [Green Version]
  51. Jo, Y.D.; Choi, Y.; Kim, D.H.; Kim, B.D.; Kang, B.C. Extensive structural variations between mitochondrial genomes of CMS and normal peppers (Capsicum annuum L.) revealed by complete nucleotide sequencing. BMC Genom. 2014, 15, 561. [Google Scholar] [CrossRef] [Green Version]
  52. Xie, H.; Peng, X.; Qian, M.; Cai, Y.; Ding, X.; Chen, Q.; Cai, Q.; Zhu, Y.; Yan, L.; Cai, Y. The chimeric mitochondrial gene orf182 causes non-pollen-type abortion in Dongxiang cytoplasmic male-sterile rice. Plant J. 2018, 95, 715–726. [Google Scholar] [CrossRef]
  53. Sang, S.; Cheng, H.; Hao, M.; Ding, B.; Mei, D.; Wang, H.; Wang, W.; Liu, J.; Fu, L.; Liu, K.; et al. Mitochondrial localization of ORF346 causes pollen abortion in alloplasmic male sterility. Crop J. 2021, in press. [Google Scholar] [CrossRef]
  54. Yamagishi, H.; Terachi, T. Intra- and inter-specific variations in the mitochondrial gene orf138 of Ogura-type male-sterile cytoplasm from Raphanus sativus and Raphanus raphanistrum. Theor. Appl. Genet. 2001, 103, 725–732. [Google Scholar] [CrossRef]
  55. Bonhomme, S.; Budar, F.; Férault, M.; Pelletier, G. A 2.5 kb NcoI fragment of Ogura radish mitochondrial DNA is correlated with cytoplasmic male-sterility in Brassica cybrids. Curr. Genet. 1991, 19, 121–127. [Google Scholar] [CrossRef]
  56. Bonhomme, S.; Budar, F.; Lancelin, D.; Small, I.; Defrance, M.C.; Pelletier, G. Sequence and transcript analysis of the Nco2.5 Ogura-specific fragment correlated with cytoplasmic male sterility in Brassica cybrids. Mol. Gen. Genet. 1992, 235, 340–348. [Google Scholar] [CrossRef] [PubMed]
  57. Iwabuch, M.; Sakai, T.; Imamura, J. Characterization of cytoplasmic male-sterility (CMS) of Kosena radish on genetical and mitochondrial DNA bases. Jpn. J. Breed. 1993, 43, 312. (In Japanese) [Google Scholar]
  58. Yamagishi, H.; Terachi, T. Molecular and biological studies on male-sterile cytoplasm in the Cruciferae. III. Distribution of Ogura-type cytoplasm among Japanese wild radishes and Asian radish cultivars. Theor. Appl. Genet. 1996, 93, 325–332. [Google Scholar] [CrossRef] [PubMed]
  59. Sakai, T.; Imamura, J. Intergeneric transfer of cytoplasmic male sterility between Raphanus sativus (cms line) and Brassica napus through cytoplast-protoplast fusion. Theor. Appl. Genet. 1990, 80, 421–427. [Google Scholar] [CrossRef] [PubMed]
  60. Sakai, T.; Imamura, J. Alteration of mitochondrial genomes containing atpA genes in the sexual progeny of cybrids between Raphanus sativus cms line and Brassica napus cv. Westar. Theor. Appl. Genet. 1992, 84, 923–929. [Google Scholar] [CrossRef]
  61. Bellaoui, M.; Martin-Canadell, A.; Pelletier, G.; Budar, F. Low-copy-number molecules are produced by recombination, actively maintained and can be amplified in the mitochondrial genome of Brassicaceae: Relationship to reversion of the male sterile phenotype in some cybrids. Mol. Gen. Genet. 1998, 257, 177–185. [Google Scholar] [CrossRef]
  62. Koizuka, N.; Imai, R.; Iwabuchi, M.; Sakai, T.; Imamura, J. Genetic analysis of fertility restoration and accumulation of ORF125 mitochondrial protein in the kosena radish (Raphanus sativus cv. Kosena) and a Brassica napus restorer line. Theor. Appl. Genet. 2000, 100, 949–955. [Google Scholar] [CrossRef]
  63. Ren, W.; Li, Z.; Han, F.; Zhang, B.; Li, X.; Fang, Z.; Yang, L.; Zhuang, M.; Lv, H.; Liu, Y.; et al. Utilization of Ogura CMS germplasm with the clubroot resistance gene by fertility restoration and cytoplasm replacement in Brassica oleracea L. Hortic. Res. 2020, 7, 61. [Google Scholar] [CrossRef] [PubMed]
Ijms 22 13230 g001 550
Figure 1. Chloroplast genome maps of normal-type (A) and Ogura-type (B) cabbage. The intraloop genes are shown with a clockwise transcription direction, while the extraloop genes are shown with the opposite. The different functional genes are shown in different colors. The gray histogram shows the GC content, and the gray line in the middle represents the 50% threshold line.
Figure 1. Chloroplast genome maps of normal-type (A) and Ogura-type (B) cabbage. The intraloop genes are shown with a clockwise transcription direction, while the extraloop genes are shown with the opposite. The different functional genes are shown in different colors. The gray histogram shows the GC content, and the gray line in the middle represents the 50% threshold line.
Ijms 22 13230 g001
Ijms 22 13230 g002 550
Figure 2. Mitochondrial genome maps of normal-type (A) and Ogura-type (B) cabbage. Genes with names inside the circle are transcribed clockwise. Genes with names outside the circle are transcribed counterclockwise. The colors of the genes denote the functions of the gene products.
Figure 2. Mitochondrial genome maps of normal-type (A) and Ogura-type (B) cabbage. Genes with names inside the circle are transcribed clockwise. Genes with names outside the circle are transcribed counterclockwise. The colors of the genes denote the functions of the gene products.
Ijms 22 13230 g002
Ijms 22 13230 g003 550
Figure 3. Synteny analysis of the mitochondrial genomes. (A) Normal-type cabbage on the X-axis, plotted against the Ogura-type cabbage on the Y-axis. (B) Ogura-type radish on the X-axis, plotted against the Ogura-type cabbage on the Y-axis. (C) Validation of structural variations between normal- and Ogura-type cabbage mtDNA. 3-1: normal-type cabbage 19-3-1; 3-2: Ogura-type cabbage 19-3-2; P1~P15: Primers 1~Primers 15.
Figure 3. Synteny analysis of the mitochondrial genomes. (A) Normal-type cabbage on the X-axis, plotted against the Ogura-type cabbage on the Y-axis. (B) Ogura-type radish on the X-axis, plotted against the Ogura-type cabbage on the Y-axis. (C) Validation of structural variations between normal- and Ogura-type cabbage mtDNA. 3-1: normal-type cabbage 19-3-1; 3-2: Ogura-type cabbage 19-3-2; P1~P15: Primers 1~Primers 15.
Ijms 22 13230 g003
Ijms 22 13230 g004 550
Figure 4. Distribution of alien cytoplasm in Ogura-type cabbage. (A) Syntenic comparison among 19-3-1, 19-3-2 and NC_018551 mtDNAs. (B) Detection results of alloplasmic markers. 19-3-1: Normal-type cabbage; 19-3-2: Ogura-type cabbage; NC_018551: Ogura-type radish; 19-2202: Bel CMS cabbage; R1~R9: Region 1~Region 9.
Figure 4. Distribution of alien cytoplasm in Ogura-type cabbage. (A) Syntenic comparison among 19-3-1, 19-3-2 and NC_018551 mtDNAs. (B) Detection results of alloplasmic markers. 19-3-1: Normal-type cabbage; 19-3-2: Ogura-type cabbage; NC_018551: Ogura-type radish; 19-2202: Bel CMS cabbage; R1~R9: Region 1~Region 9.
Ijms 22 13230 g004
Ijms 22 13230 g005 550
Figure 5. Mitochondrial genome map of the Bel CMS cabbage. Genes with names inside the circle are transcribed clockwise. Genes with names outside the circle are transcribed counterclockwise. The colors of the genes denote the functions of the gene products.
Figure 5. Mitochondrial genome map of the Bel CMS cabbage. Genes with names inside the circle are transcribed clockwise. Genes with names outside the circle are transcribed counterclockwise. The colors of the genes denote the functions of the gene products.
Ijms 22 13230 g005
Ijms 22 13230 g006 550
Figure 6. Syntenic comparison among 19-3-1, 19-2202 and NC_018551 mtDNAs. (A,B) Normal-type cabbage and Ogura-type radish on the X-axis, plotted against the Bel CMS cabbage on the Y-axis. (C) Distribution of alien cytoplasm in the Bel CMS mitochondrial genome. 19-3-1: Normal-type cabbage; 19-2202: Bel CMS cabbage. NC_018551: Ogura-type radish.
Figure 6. Syntenic comparison among 19-3-1, 19-2202 and NC_018551 mtDNAs. (A,B) Normal-type cabbage and Ogura-type radish on the X-axis, plotted against the Bel CMS cabbage on the Y-axis. (C) Distribution of alien cytoplasm in the Bel CMS mitochondrial genome. 19-3-1: Normal-type cabbage; 19-2202: Bel CMS cabbage. NC_018551: Ogura-type radish.
Ijms 22 13230 g006
Ijms 22 13230 g007 550
Figure 7. Phenotypic observations of Ogura CMS and Bel CMS cabbage under field conditions. (A,B) Flower buds of Ogura CMS (A) and Bel CMS (B) at the early flowering stage; (C) Floral organs between Ogura CMS (left) and Bel CMS (right); (D–F) Pollen staining observation in normal-type (D), Ogura CMS (E) and Bel CMS (F) cabbage.
Figure 7. Phenotypic observations of Ogura CMS and Bel CMS cabbage under field conditions. (A,B) Flower buds of Ogura CMS (A) and Bel CMS (B) at the early flowering stage; (C) Floral organs between Ogura CMS (left) and Bel CMS (right); (D–F) Pollen staining observation in normal-type (D), Ogura CMS (E) and Bel CMS (F) cabbage.
Ijms 22 13230 g007
Ijms 22 13230 g008 550
Figure 8. Difference of three homologous sterility genes. (A) Sequence alignment of three homologous sterility genes. (B) Amplification results of the molecular marker ‘OKB’. 1~3: Ogura CMS; 4~5: Kos CMS; 7~9: Bel CMS; 10~12: fertile line; NTC: no template control.
Figure 8. Difference of three homologous sterility genes. (A) Sequence alignment of three homologous sterility genes. (B) Amplification results of the molecular marker ‘OKB’. 1~3: Ogura CMS; 4~5: Kos CMS; 7~9: Bel CMS; 10~12: fertile line; NTC: no template control.
Ijms 22 13230 g008
Table
Table 1. Functional classification of chloroplast genomic protein-coding genes.
Table 1. Functional classification of chloroplast genomic protein-coding genes.
FunctionGene Name
ATP synthaseatpA, atpB, atpE, atpF *, atpH, atpI
Cytochrome b/f complexpetA, petB, petD, petG, petL, petN
NADH dehydrogenasendhA *, ndhB *, ndhC, ndhD, ndhE, ndhF, ndhG, ndhH, ndhI, ndhJ, ndhK
Photosystem IpsaA, psaB, psaC, psaI, psaJ
Photosystem IIpsbA, psbB, psbC, psbD, psbE, psbF, psbH, psbI, psbJ, psbK, psbL, psbM, psbN, psbT, psbZ
Ribosomal protein (SSU)rps2, rps3, rps4, rps7, rps8, rps11, rps12#, rps14, rps15, rps16, rps18, rps19
Ribosomal protein (LSU)rpl2 *, rpl14, rpl16, rpl20, rpl22, rpl23, rpl32, rpl33, rpl36
Ribosomal RNArrn4.51, rrn51, rrn161, rrn231
RNA polymeraserpoA, rpoB, rpoC1 *, rpoC2
Unknown functionycf11, ycf2, ycf3 **, ycf4
Other geneaccD, ccsA, cemA, clpP **, matK, rbcL, infA
* Gene with one intron, ** Gene with two introns, # Transsplicing gene, 1 Gene with two copies in the IR region.
Table
Table 2. Differences in coding genes among 19-3-2, 19-3-1 and NC_018551.
Table 2. Differences in coding genes among 19-3-2, 19-3-1 and NC_018551.
Gene19-3-2 vs. 19-3-119-3-2 vs. NC_018551
NucleotideAmino AcidNucleotideAmino Acid
rrn181398 A/GSynonymous
atp8 370 A/C124 I/L
449 T/C150 V/A
ccmB 352 C/T118 R/Q
ccmC 126 A/G49 G/E
146 G/ASynonymous
338 G/A113 R/K
351 G/ASynonymous
477 C/GSynonymous
533 G/C178 G/A
551 G/A184 G/D
ccmFC 282 C/T95 E/K
305 G/T102 F/L
779 A/CSynonymous
1279 A/G427 L/S
ccmFN2 377 T/C126 L/S
cox1 108 G/ASynonymous
110 A/TSynonymous
799 A/CSynonymous
cox2 378 A/G127 W/R
nad3 264 A/GSynonymous
nad4 77 C/T26 P/L
1205 C/T402 P/L
1399 G/C467 V/L
rpL16 506 C/T169 P/L
rpL2 464 G/A155 G/D
840 C/TSynonymous
919 G/ASynonymous
920 T/C307 V/T
1004 C/T335 S/L
rpL5 515 T/C172 L/P
rps12 12 A/C4 F/L
335 T/G111 R/S
344 T/GSynonymous
rps3 75 T/G25 D/E
1254 A/CSynonymous
1320 A/CSynonymous
rps4 188 A/C103 S/F
775 G/ASynonymous
Table
Table 3. Location and length of alien cytoplasm in Ogura-type cabbage mtDNA.
Table 3. Location and length of alien cytoplasm in Ogura-type cabbage mtDNA.
RegionLocationStartEndLengthNumber of Markers
R1MT195164515512
R2998313,79038083
R315,67917,96022822
R4MT21501573942394
R5757311,39038183
R651,43156,88754574
R765,52167,24717272
R8167,906173,82159166
R9175,701182,52068206
Table
Table 4. Location and length of alien cytoplasm in the Bel CMS mitochondrial genome.
Table 4. Location and length of alien cytoplasm in the Bel CMS mitochondrial genome.
RegionLocationStartEndLength
R7 + R1MT133,64937,2173569
R8MT229,99635,8315836
R937,71544,5346820
R1066,62871,9895362
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations.

Share and Cite

MDPI and ACS Style

Chen, L.; Ren, W.; Zhang, B.; Chen, W.; Fang, Z.; Yang, L.; Zhuang, M.; Lv, H.; Wang, Y.; Ji, J.; et al. Organelle Comparative Genome Analysis Reveals Novel Alloplasmic Male Sterility with orf112 in Brassica oleracea L. Int. J. Mol. Sci. 2021, 22, 13230. https://doi.org/10.3390/ijms222413230

AMA Style

Chen L, Ren W, Zhang B, Chen W, Fang Z, Yang L, Zhuang M, Lv H, Wang Y, Ji J, et al. Organelle Comparative Genome Analysis Reveals Novel Alloplasmic Male Sterility with orf112 in Brassica oleracea L. International Journal of Molecular Sciences. 2021; 22(24):13230. https://doi.org/10.3390/ijms222413230

Chicago/Turabian Style

Chen, Li, Wenjing Ren, Bin Zhang, Wendi Chen, Zhiyuan Fang, Limei Yang, Mu Zhuang, Honghao Lv, Yong Wang, Jialei Ji, and et al. 2021. "Organelle Comparative Genome Analysis Reveals Novel Alloplasmic Male Sterility with orf112 in Brassica oleracea L." International Journal of Molecular Sciences 22, no. 24: 13230. https://doi.org/10.3390/ijms222413230

Note that from the first issue of 2016, this journal uses article numbers instead of page numbers. See further details here.

Article Metrics

Back to TopTop