A Novel Role for the DNA Repair Enzyme 8-Oxoguanine DNA Glycosylase in Adipogenesis
Abstract
:1. Introduction
2. Results
2.1. OGG1 Expression and Activity Increases during Adipogenesis
2.2. Ogg1−/− Preadipocytes Differentiate More Efficiently, While Ogg1Tg Cells Have Reduced Lipid Accretion
2.3. OGG1 Overexpression Inhibits Adipogenic Differentiation and Lipid Accumulation in 3T3-L1 Cells
2.4. OGG1 Alters Cellular PARylation in Adipocytes
3. Discussion
4. Material and Methods
4.1. Animals
4.2. Isolation of Preadipocytes from the Stromal Vascular Fraction (SVF)
4.3. Adipocyte Differentiation
4.4. Oil Red O Staining
4.5. Adenoviral Construct and Transduction
4.6. Western Blotting
4.7. Gene Expression
4.8. OGG1 Activity Assay
4.9. Statistics
Supplementary Materials
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Abolhassani, N.; Leon, J.; Sheng, Z.; Oka, S.; Hamasaki, H.; Iwaki, T.; Nakabeppu, Y. Molecular pathophysiology of impaired glucose metabolism, mitochondrial dysfunction, and oxidative DNA damage in Alzheimer’s disease brain. Mech. Ageing Dev. 2016, 161, 95–104. [Google Scholar] [CrossRef] [PubMed]
- Nakabeppu, Y. Cellular levels of 8-oxoguanine in either DNA or the nucleotide pool play pivotal roles in carcinogenesis and survival of cancer cells. Int. J. Mol. Sci. 2014, 15, 12543–12557. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Audebert, M.; Chevillard, S.; Levalois, C.; Gyapay, G.; Vieillefond, A.; Klijanienko, J.; Vielh, P.; El Naggar, A.K.; Oudard, S.; Boiteux, S.; et al. Alterations of the DNA repair gene OGG1 in human clear cell carcinomas of the kidney. Cancer Res. 2000, 60, 4740–4744. [Google Scholar]
- Sagun, K.C.; Cárcamo, J.M.; Golde, D.W. Antioxidants prevent oxidative DNA damage and cellular transformation elicited by the over-expression of c-MYC. Mutat. Res. 2006, 593, 64–79. [Google Scholar] [CrossRef]
- Fleming, A.M.; Zhu, J.; Ding, Y.; Burrows, C.J. 8-Oxo-7,8-dihydroguanine in the Context of a Gene Promoter G-Quadruplex Is an On–Off Switch for Transcription. ACS Chem. Biol. 2017, 12, 2417–2426. [Google Scholar] [CrossRef]
- Pan, L.; Zhu, B.; Hao, W.; Zeng, X.; Vlahopoulos, S.A.; Hazra, T.K.; Hegde, M.L.; Radak, Z.; Bacsi, A.; Brasier, A.R.; et al. Oxidized Guanine Base Lesions Function in 8-Oxoguanine DNA Glycosylase-1-mediated Epigenetic Regulation of Nuclear Factor κB-driven Gene Expression. J. Biol. Chem. 2016, 291, 25553–25566. [Google Scholar] [CrossRef] [Green Version]
- Park, J.W.; Han, Y.I.; Kim, S.W.; Kim, T.M.; Yeom, S.C.; Kang, J.; Park, J. 8-OxoG in GC-rich Sp1 binding sites enhances gene transcription in adipose tissue of juvenile mice. Sci. Rep. 2019, 9, 15618. [Google Scholar] [CrossRef]
- Perillo, B.; Ombra, M.N.; Bertoni, A.; Cuozzo, C.; Sacchetti, S.; Sasso, A.; Chiariotti, L.; Malorni, A.; Abbondanza, C.; Avvedimento, E.V. DNA oxidation as triggered by H3K9me2 demethylation drives estrogen-induced gene expression. Science 2008, 319, 202–206. [Google Scholar] [CrossRef]
- Klungland, A.; Bjelland, S. Oxidative damage to purines in DNA: Role of mammalian Ogg1. DNA Repair 2007, 6, 481–488. [Google Scholar] [CrossRef]
- Klungland, A.; Rosewell, I.; Hollenbach, S.; Larsen, E.; Daly, G.; Epe, B.; Seeberg, E.; Lindahl, T.; Barnes, D.E. Accumulation of premutagenic DNA lesions in mice defective in removal of oxidative base damage. Proc. Natl. Acad. Sci. USA 1999, 96, 13300–13305. [Google Scholar] [CrossRef] [Green Version]
- Nishioka, K.; Ohtsubo, T.; Oda, H.; Fujiwara, T.; Kang, D.; Sugimachi, K.; Nakabeppu, Y. Expression and differential intracellular localization of two major forms of human 8-oxoguanine DNA glycosylase encoded by alternatively spliced OGG1 mRNAs. Mol. Biol. Cell 1999, 10, 1637–1652. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Radicella, J.P.; Dherin, C.; Desmaze, C.; Fox, M.S.; Boiteux, S. Cloning and characterization of hOGG1, a human homolog of the OGG1 gene of Saccharomyces cerevisiae. Proc. Natl. Acad. Sci. USA 1997, 94, 8010–8015. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Rosenquist, T.A.; Zharkov, D.O.; Grollman, A.P. Cloning and characterization of a mammalian 8-oxoguanine DNA glycosylase. Proc. Natl. Acad. Sci. USA 1997, 94, 7429–7434. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Sampath, H.; McCullough, A.K.; Lloyd, R.S. Regulation of DNA glycosylases and their role in limiting disease. Free Radic. Res. 2012, 46, 460–478. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Paz-Elizur, T.; Sevilya, Z.; Leitner-Dagan, Y.; Elinger, D.; Roisman, L.C.; Livneh, Z. DNA repair of oxidative DNA damage in human carcinogenesis: Potential application for cancer risk assessment and prevention. Cancer Lett. 2008, 266, 60–72. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Chevillard, S.; Radicella, J.P.; Levalois, C.; Lebeau, J.; Poupon, M.F.; Oudard, S.; Dutrillaux, B.; Boiteux, S. Mutations in OGG1, a gene involved in the repair of oxidative DNA damage, are found in human lung and kidney tumours. Oncogene 1998, 16, 3083–3086. [Google Scholar] [CrossRef] [Green Version]
- Lu, R.; Nash, H.M.; Verdine, G.L. A mammalian DNA repair enzyme that excises oxidatively damaged guanines maps to a locus frequently lost in lung cancer. Curr. Biol. 1997, 7, 397–407. [Google Scholar] [CrossRef] [Green Version]
- Michaels, M.L.; Miller, J.H. The GO system protects organisms from the mutagenic effect of the spontaneous lesion 8-hydroxyguanine (7,8-dihydro-8-oxoguanine). J. Bacteriol. 1992, 174, 6321–6325. [Google Scholar] [CrossRef] [Green Version]
- Okasaka, T.; Matsuo, K.; Suzuki, T.; Ito, H.; Hosono, S.; Kawase, T.; Watanabe, M.; Yatabe, Y.; Hida, T.; Mitsudomi, T.; et al. hOGG1 Ser326Cys polymorphism and risk of lung cancer by histological type. J. Hum. Genet. 2009, 54, 739–745. [Google Scholar] [CrossRef] [Green Version]
- Sakumi, K.; Tominaga, Y.; Furuichi, M.; Xu, P.; Tsuzuki, T.; Sekiguchi, M.; Nakabeppu, Y. Ogg1 knockout-associated lung tumorigenesis and its suppression by Mth1 gene disruption. Cancer Res. 2003, 63, 902–905. [Google Scholar]
- Thomas, D.; Scot, A.D.; Barbey, R.; Padula, M.; Boiteux, S. Inactivation of OGG1 increases the incidence of G:C→T:A transversions in Saccharomyces cerevisiae: Evidence for endogenous oxidative damage to DNA in eukaryotic cells. Mol. Gen. Genet. 1997, 254, 171–178. [Google Scholar] [CrossRef] [PubMed]
- Fukae, J.; Takanashi, M.; Kubo, S.; Nishioka, K.; Nakabeppu, Y.; Mori, H.; Mizuno, Y.; Hattori, N. Expression of 8-oxoguanine DNA glycosylase (OGG1) in Parkinson’s disease and related neurodegenerative disorders. Acta Neuropathol. 2005, 109, 256–262. [Google Scholar] [CrossRef] [PubMed]
- Nakabeppu, Y.; Tsuchimoto, D.; Yamaguchi, H.; Sakumi, K. Oxidative damage in nucleic acids and Parkinson’s disease. J. Neurosci. Res. 2007, 85, 919–934. [Google Scholar] [CrossRef] [PubMed]
- Cardozo-Pelaez, F.; Cox, D.P.; Bolin, C. Lack of the DNA repair enzyme OGG1 sensitizes dopamine neurons to manganese toxicity during development. Gene Expr. 2005, 12, 315–323. [Google Scholar] [CrossRef] [PubMed]
- Dezor, M.; Dorszewska, J.; Florczak, J.; Kempisty, B.; Jaroszewska-Kolecka, J.; Rozycka, A.; Polrolniczak, A.; Bugaj, R.; Jagodzinski, P.P.; Kozubski, W. Expression of 8-oxoguanine DNA glycosylase 1 (OGG1) and the level of p53 and TNF-alphalpha proteins in peripheral lymphocytes of patients with Alzheimer’s disease. Folia Neuropathol. 2011, 49, 123–131. [Google Scholar]
- Iida, T.; Furuta, A.; Nishioka, K.; Nakabeppu, Y.; Iwaki, T. Expression of 8-oxoguanine DNA glycosylase is reduced and associated with neurofibrillary tangles in Alzheimer’s disease brain. Acta Neuropathol. 2002, 103, 20–25. [Google Scholar] [CrossRef]
- Dorszewska, J.; Kempisty, B.; Jaroszewska-Kolecka, J.; Rozycka, A.; Florczak, J.; Lianeri, M.; Jagodzinski, P.P.; Kozubski, W. Expression and polymorphisms of gene 8-oxoguanine glycosylase 1 and the level of oxidative DNA damage in peripheral blood lymphocytes of patients with Alzheimer’s disease. DNA Cell Biol. 2009, 28, 579–588. [Google Scholar] [CrossRef]
- Shao, C.; Xiong, S.; Li, G.M.; Gu, L.; Mao, G.; Markesbery, W.R.; Lovell, M.A. Altered 8-oxoguanine glycosylase in mild cognitive impairment and late-stage Alzheimer’s disease brain. Free Radic. Biol. Med. 2008, 45, 813–819. [Google Scholar] [CrossRef] [Green Version]
- Mao, G.; Pan, X.; Zhu, B.B.; Zhang, Y.; Yuan, F.; Huang, J.; Lovell, M.A.; Lee, M.P.; Markesbery, W.R.; Li, G.M.; et al. Identification and characterization of OGG1 mutations in patients with Alzheimer’s disease. Nucleic Acids Res. 2007, 35, 2759–2766. [Google Scholar] [CrossRef] [Green Version]
- Sampath, H. Oxidative DNA damage in disease—Insights gained from base excision repair glycosylase-deficient mouse models. Environ. Mol. Mutagenesis 2014, 55, 689–703. [Google Scholar] [CrossRef] [Green Version]
- Sampath, H.; Vartanian, V.; Rollins, M.R.; Sakumi, K.; Nakabeppu, Y.; Lloyd, R.S. 8-Oxoguanine DNA glycosylase (OGG1) deficiency increases susceptibility to obesity and metabolic dysfunction. PLoS ONE 2012, 7, e51697. [Google Scholar] [CrossRef] [PubMed]
- Vartanian, V.; Tumova, J.; Dobrzyn, P.; Dobrzyn, A.; Nakabeppu, Y.; Lloyd, R.S.; Sampath, H. 8-oxoguanine DNA glycosylase (OGG1) deficiency elicits coordinated changes in lipid and mitochondrial metabolism in muscle. PLoS ONE 2017, 12, e0181687. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Daimon, M.; Oizumi, T.; Toriyama, S.; Karasawa, S.; Jimbu, Y.; Wada, K.; Kameda, W.; Susa, S.; Muramatsu, M.; Kubota, I.; et al. Association of the Ser326Cys polymorphism in the OGG1 gene with type 2 DM. Biochem. Biophys. Res. Commun. 2009, 386, 26–29. [Google Scholar] [CrossRef]
- Thameem, F.; Puppala, S.; Lehman, D.M.; Stern, M.P.; Blangero, J.; Abboud, H.E.; Duggirala, R.; Habib, S.L. The Ser(326)Cys Polymorphism of 8-Oxoguanine Glycosylase 1 (OGG1) Is Associated with Type 2 Diabetes in Mexican Americans. Hum. Hered. 2010, 70, 97–101. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Corella, D.; Ramírez-Sabio, J.B.; Coltell, O.; Ortega-Azorín, C.; Estruch, R.; Martínez-González, M.A.; Salas-Salvadó, J.; Sorlí, J.V.; Castañer, O.; Arós, F.; et al. Effects of the Ser326Cys Polymorphism in the DNA Repair OGG1 Gene on Cancer, Cardiovascular, and All-Cause Mortality in the PREDIMED Study: Modulation by Diet. J. Acad. Nutr. Diet. 2018, 118, 589–605. [Google Scholar] [CrossRef] [Green Version]
- Komakula, S.S.B.; Tumova, J.; Kumaraswamy, D.; Burchat, N.; Vartanian, V.; Ye, H.; Dobrzyn, A.; Lloyd, R.S.; Sampath, H. The DNA Repair Protein OGG1 Protects Against Obesity by Altering Mitochondrial Energetics in White Adipose Tissue. Sci. Rep. 2018, 8, 14886. [Google Scholar] [CrossRef]
- Orlicky, D.J.; DeGregori, J.; Schaack, J. Construction of stable coxsackievirus and adenovirus receptor-expressing 3T3-L1 cells. J. Lipid Res. 2001, 42, 910–915. [Google Scholar] [CrossRef]
- Noren Hooten, N.; Kompaniez, K.; Barnes, J.; Lohani, A.; Evans, M.K. Poly(ADP-ribose) Polymerase 1 (PARP-1) Binds to 8-Oxoguanine-DNA Glycosylase (OGG1). J. Biol. Chem. 2011, 286, 44679–44690. [Google Scholar] [CrossRef] [Green Version]
- Gibson, B.A.; Kraus, W.L. New insights into the molecular and cellular functions of poly(ADP-ribose) and PARPs. Nat. Rev. Mol. Cell Biol. 2012, 13, 411–424. [Google Scholar] [CrossRef]
- Devalaraja-Narashimha, K.; Padanilam, B.J. PARP1 deficiency exacerbates diet-induced obesity in mice. J. Endocrinol. 2010, 205, 243–252. [Google Scholar] [CrossRef] [Green Version]
- Huang, D.; Camacho, C.V.; Setlem, R.; Ryu, K.W.; Parameswaran, B.; Gupta, R.K.; Kraus, W.L. Functional Interplay between Histone H2B ADP-Ribosylation and Phosphorylation Controls Adipogenesis. Mol. Cell 2020, 79, 934–949.e914. [Google Scholar] [CrossRef] [PubMed]
- Luo, X.; Ryu, K.W.; Kim, D.-S.; Nandu, T.; Medina, C.J.; Gupte, R.; Gibson, B.A.; Soccio, R.E.; Yu, Y.; Gupta, R.K.; et al. PARP-1 Controls the Adipogenic Transcriptional Program by PARylating C/EBPβ and Modulating Its Transcriptional Activity. Mol. Cell 2017, 65, 260–271. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Sampath, H.; Lloyd, R.S. Roles of OGG1 in transcriptional regulation and maintenance of metabolic homeostasis. DNA Repair 2019, 81, 102667. [Google Scholar] [CrossRef] [PubMed]
- Lia, D.; Reyes, A.; de Melo Campos, J.T.A.; Piolot, T.; Baijer, J.; Radicella, J.P.; Campalans, A. Mitochondrial maintenance under oxidative stress depends on mitochondrially localised α-OGG1. J. Cell Sci. 2018, 131, jcs213538. [Google Scholar] [CrossRef] [Green Version]
- Wang, W.; Esbensen, Y.; Kunke, D.; Suganthan, R.; Rachek, L.; Bjoras, M.; Eide, L. Mitochondrial DNA Damage Level Determines Neural Stem Cell Differentiation Fate. J. Neurosci. 2011, 31, 9746–9751. [Google Scholar] [CrossRef] [Green Version]
- Yuzefovych, L.V.; Schuler, A.M.; Chen, J.; Alvarez, D.F.; Eide, L.; Ledoux, S.P.; Wilson, G.L.; Rachek, L.I. Alteration of mitochondrial function and insulin sensitivity in primary mouse skeletal muscle cells isolated from transgenic and knockout mice: Role of ogg1. Endocrinology 2013, 154, 2640–2649. [Google Scholar] [CrossRef]
- Noren Hooten, N.; Fitzpatrick, M.; Kompaniez, K.; Jacob, K.D.; Moore, B.R.; Nagle, J.; Barnes, J.; Lohani, A.; Evans, M.K. Coordination of DNA repair by NEIL1 and PARP-1: A possible link to aging. Aging 2012, 4, 674–685. [Google Scholar] [CrossRef]
- Sampath, H.; Batra, A.K.; Vartanian, V.; Carmical, J.R.; Prusak, D.; King, I.B.; Lowell, B.; Earley, L.F.; Wood, T.G.; Marks, D.L.; et al. Variable penetrance of metabolic phenotypes and development of high-fat diet-induced adiposity in NEIL1-deficient mice. Am. J. Physiol. Endocrinol. Metab. 2011, 300, E724–E734. [Google Scholar] [CrossRef] [Green Version]
- Vartanian, V.; Lowell, B.; Minko, I.G.; Wood, T.G.; Ceci, J.D.; George, S.; Ballinger, S.W.; Corless, C.L.; McCullough, A.K.; Lloyd, R.S. The metabolic syndrome resulting from a knockout of the NEIL1 DNA glycosylase. Proc. Natl. Acad. Sci. USA 2006, 103, 1864. [Google Scholar] [CrossRef] [Green Version]
- Liu, M.; Doublié, S.; Wallace, S.S. Neil3, the final frontier for the DNA glycosylases that recognize oxidative damage. Mutat. Res. 2013, 743, 4–11. [Google Scholar] [CrossRef] [Green Version]
- Liu, M.; Bandaru, V.; Bond, J.P.; Jaruga, P.; Zhao, X.; Christov, P.P.; Burrows, C.J.; Rizzo, C.J.; Dizdaroglu, M.; Wallace, S.S. The mouse ortholog of NEIL3 is a functional DNA glycosylase in vitro and in vivo. Proc. Natl. Acad. Sci. USA 2010, 107, 4925–4930. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Bai, P.; Canto, C.; Brunyánszki, A.; Huber, A.; Szántó, M.; Cen, Y.; Yamamoto, H.; Houten, S.M.; Kiss, B.; Oudart, H.; et al. PARP-2 regulates SIRT1 expression and whole-body energy expenditure. Cell Metab. 2011, 13, 450–460. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Szántó, M.; Bai, P. The role of ADP-ribose metabolism in metabolic regulation, adipose tissue differentiation, and metabolism. Genes Dev. 2020, 34, 321–340. [Google Scholar] [CrossRef] [PubMed]
- Chu, D.-T.; Malinowska, E.; Gawronska-Kozak, B.; Kozak, L.P. Expression of adipocyte biomarkers in a primary cell culture models reflects preweaning adipobiology. J. Biol. Chem. 2014, 289, 18478–18488. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Rim, J.-S.; Mynatt, R.L.; Gawronska-Kozak, B. Mesenchymal stem cells from the outer ear: A novel adult stem cell model system for the study of adipogenesis. FASEB J. 2005, 19, 1205–1207. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Kim, J.; Xu, M.; Xo, R.; Mates, A.; Wilson, G.L.; Pearsall, A.W.I.; Grishko, V. Mitochondrial DNA damage is involved in apoptosis caused by pro-inflammatory cytokines in human OA chondrocytes. Osteoarthr. Cartil. 2010, 18, 424–432. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- German, P.; Szaniszlo, P.; Hajas, G.; Radak, Z.; Bacsi, A.; Hazra, T.K.; Hegde, M.L.; Ba, X.; Boldogh, I. Activation of cellular signaling by 8-oxoguanine DNA glycosylase-1-initiated DNA base excision repair. DNA Repair 2013, 12, 856–863. [Google Scholar] [CrossRef] [Green Version]
ANTIBODY NAME | SOURCE | CAT. NO. |
---|---|---|
OGG1 | Abcam | 62826 |
SCD1 | Abcam | 39969 |
PPAR© | Cell Signaling | 2435S |
β-ACTIN | Sigma-Aldrich | A5316 |
PARP-1 | Pierce | MA5-15031 |
ANTI-PAR | Trevigen | 4335-MC100 |
GAPDH | Cell Signaling | 5174 |
GENE NAME | FORWARD PRIMER (5′ ⋙ 3′) | REVERSE PRIMER (5′ ⋙ 3′) |
---|---|---|
mOgg1 | GCCAACAAAGAACTGGGAAA | CCCTCTGGCCTCTTAGATCC |
hOGG1 | GCTGGAGGCCGTGCGCAAGTAC | TGGGGTCTTGTCGCAGCAGTCG |
Scd1 | TGCGATACACTCTGGTGCTC | AGGATATTCTCCCGGGATTG |
Ppar-© | AAGCCCATCGAGGACATCCA | CGGGTGGGACTTTCCTGCTA |
C/ebp-α | CAAAGCCAAGAAGTCGGTGGACAA | TCATTGTGACTGGTCAACTCCAGC |
Pref-1 | GACCCACCCTGTGACCCC | CAGGCAGCTCGTGCACCCC |
Neil1 | GCCAGCCACTTTGTGAATGAG | AAGCTGAGATGTGGTAGGCAC |
Neil2 | GGGAGGCCCTCGTGGAT | TGTCCCGAAGCCAGTCCTT |
Neil3 | AAGTGATGGCAGCCCTCTGT | CCTCACAACTCGGAGAACACAA |
Nth1 | TGCTCTCCAGCCAGACCAA | CCCGGAGCCGTTGCA |
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations. |
© 2021 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (http://creativecommons.org/licenses/by/4.0/).
Share and Cite
Komakula, S.S.B.; Blaze, B.; Ye, H.; Dobrzyn, A.; Sampath, H. A Novel Role for the DNA Repair Enzyme 8-Oxoguanine DNA Glycosylase in Adipogenesis. Int. J. Mol. Sci. 2021, 22, 1152. https://doi.org/10.3390/ijms22031152
Komakula SSB, Blaze B, Ye H, Dobrzyn A, Sampath H. A Novel Role for the DNA Repair Enzyme 8-Oxoguanine DNA Glycosylase in Adipogenesis. International Journal of Molecular Sciences. 2021; 22(3):1152. https://doi.org/10.3390/ijms22031152
Chicago/Turabian StyleKomakula, Sai Santosh Babu, Bhavya Blaze, Hong Ye, Agnieszka Dobrzyn, and Harini Sampath. 2021. "A Novel Role for the DNA Repair Enzyme 8-Oxoguanine DNA Glycosylase in Adipogenesis" International Journal of Molecular Sciences 22, no. 3: 1152. https://doi.org/10.3390/ijms22031152