Modulation of Innate Immune Toxicity by Silver Nanoparticle Exposure and the Preventive Effects of Pterostilbene
Abstract
:1. Introduction
2. Results
2.1. Characterization of AgNPs and PLGA-PTE
2.2. Effects of AgNPs and PLGA-PTE on Zebrafish Embryos
2.3. Innate Immune Response Affected by Exposure to AgNPs and PLGA-PTE Alone or Combined
2.4. The Addition of PLGA-PTE Ameliorates the Toxic Effect of AgNPs in Immune Cells
3. Discussion
4. Materials and Methods
4.1. Synthesis of AgNPs and PLGA-PTE
4.2. AgNPs and PLGA-PTE Characterization
4.3. Drug Loading and Drug Release Analysis of PLGA-PTE
4.4. Zebrafish Maintenance and Treatment
4.5. Functional Analysis of Immunocytes
4.6. Reactive Oxygen Species (ROS) Analysis
4.7. Mitochondrial Damage Analysis
4.8. Quantitative Reverse Transcription PCR (RT-qPCR)
4.9. Statistical Analysis
5. Conclusions
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Bao, S.; Tang, W.; Fang, T. Sex-dependent and organ-specific toxicity of silver nanoparticles in livers and intestines of adult zebrafish. Chemosphere 2020, 249, 126172. [Google Scholar] [CrossRef]
- Gaillet, S.; Rouanet, J.-M. Silver nanoparticles: Their potential toxic effects after oral exposure and underlying mechanisms—A review. Food Chem. Toxicol. 2015, 77, 58–63. [Google Scholar] [CrossRef] [PubMed]
- Mao, B.-H.; Tsai, J.-C.; Chen, C.-W.; Yan, S.-J.; Wang, Y.-J. Mechanisms of silver nanoparticle-induced toxicity and important role of autophagy. Nanotoxicology 2016, 10, 1021–1040. [Google Scholar] [CrossRef]
- Ferdous, Z.; Nemmar, A. Health Impact of Silver Nanoparticles: A Review of the Biodistribution and Toxicity Following Various Routes of Exposure. Int. J. Mol. Sci. 2020, 21, 2375. [Google Scholar] [CrossRef] [Green Version]
- Bilyy, R.; Bila, G.; Vishchur, O.; Vovk, V.; Herrmann, M. Neutrophils as Main Players of Immune Response Towards Nondegradable Nanoparticles. Nanomaterials 2020, 10, 1273. [Google Scholar] [CrossRef] [PubMed]
- Vuković, B.; Milić, M.; Dobrošević, B.; Milić, M.; Ilić, K.; Pavičić, I.; Šerić, V.; Vrček, I.V. Surface Stabilization Affects Toxicity of Silver Nanoparticles in Human Peripheral Blood Mononuclear Cells. Nanomaterials 2020, 10, 7. [Google Scholar] [CrossRef] [PubMed]
- Chen, L.; Wu, H.; Le, L.; Yang, P.; Fu, F.; Liu, W.; Xu, H. Exposure to silver nanoparticles induces immunological dysfunction in pregnant mice. Environ. Toxicol. 2020, 35, 1161–1169. [Google Scholar] [CrossRef] [PubMed]
- Cronin, J.G.; Jones, N.; Thornton, C.A.; Jenkins, G.J.S.; Doak, S.H.; Clift, M.J.D. Nanomaterials and Innate Immunity: A Perspective of the Current Status in Nanosafety. Chem. Res. Toxicol. 2020, 33, 1061–1073. [Google Scholar] [CrossRef] [PubMed]
- International Organization for Standardization. Water Quality—Determination of the Acute Lethal Toxicity of Substances to a Freshwater Fish [Brachydanio Rerio Hamilton-Buchanan (Teleostei, Cyprinidae)]; ISO: Geneva, Switzerland, 1996. [Google Scholar]
- Tortella, G.; Rubilar, O.; Durán, N.; Diez, M.; Martínez, M.; Parada, J.; Seabra, A. Silver nanoparticles: Toxicity in model organisms as an overview of its hazard for human health and the environment. J. Hazard. Mater. 2020, 390, 121974. [Google Scholar] [CrossRef] [PubMed]
- Sullivan, C.; Kim, C.H. Zebrafish as a model for infectious disease and immune function. Fish Shellfish Immunol. 2008, 25, 341–350. [Google Scholar] [CrossRef]
- Muhammad, Q.; Jang, Y.; Kang, S.H.; Moon, J.; Kim, W.J.; Park, H. Modulation of immune responses with nanoparticles and reduction of their immunotoxicity. Biomater. Sci. 2020, 8, 1490–1501. [Google Scholar] [CrossRef]
- Chen, R.-J.; Wu, P.-H.; Ho, C.-T.; Way, T.-D.; Pan, M.-H.; Chen, H.-M.; Ho, Y.-S.; Wang, Y.-J. P53-dependent downregulation of hTERT protein expression and telomerase activity induces senescence in lung cancer cells as a result of pterostilbene treatment. Cell Death Dis. 2017, 8, e2985. [Google Scholar] [CrossRef] [Green Version]
- Lee, Y.-H.; Chen, Y.-Y.; Yeh, Y.-L.; Wang, Y.-J.; Chen, R.-J. Stilbene Compounds Inhibit Tumor Growth by the Induction of Cellular Senescence and the Inhibition of Telomerase Activity. Int. J. Mol. Sci. 2019, 20, 2716. [Google Scholar] [CrossRef] [Green Version]
- Wang, Y.J.; Chen, Y.Y.; Hsiao, C.M.; Pan, M.H.; Wang, B.J.; Chen, Y.C.; Ho, C.T.; Huang, K.C.; Chen, R.J. Induction of Autophagy by Pterostilbene Contributes to the Prevention of Renal Fibrosis via Attenuating NLRP3 Inflammasome Activation and Epithelial-Mesenchymal Transition. Front. Cell Dev. Biol. 2020, 8, 436. [Google Scholar] [CrossRef]
- Perečko, T.; Drábiková, K.; Lojek, A.; Číž, M.; Ponist, S.; Bauerová, K.; Nosál, R.; Harmatha, J.; Jančinová, V. The Effects of Pterostilbene on Neutrophil Activity in Experimental Model of Arthritis. BioMed Res. Int. 2013, 2013, 1–7. [Google Scholar] [CrossRef] [Green Version]
- Guo, C.; Sinnott, B.; Niu, B.; Lowry, M.B.; Fantacone, M.L.; Gombart, A.F. Synergistic induction of human cathelicidin antimicrobial peptide gene expression by vitamin D and stilbenoids. Mol. Nutr. Food Res. 2014, 58, 528–536. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Brule, S.V.D.; Ambroise, J.; Lecloux, H.; Levard, C.; Soulas, R.; de Temmerman, P.-J.; Palmai-Pallag, M.; Marbaix, E.; Lison, D. Dietary silver nanoparticles can disturb the gut microbiota in mice. Part. Fibre Toxicol. 2015, 13, 38. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Gopalakrishnan, V.; Spencer, C.N.; Nezi, L.; Reuben, A.; Andrews, M.C.; Karpinets, T.V.; Prieto, P.A.; Vicente, D.; Hoffman, K.; Wei, S.C.; et al. Gut microbiome modulates response to anti–PD-1 immunotherapy in melanoma patients. Science 2018, 359, 97–103. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Maurer, L.L.; Meyer, J.N. A systematic review of evidence for silver nanoparticle-induced mitochondrial toxicity. Environ. Sci. Nano 2016, 3, 311–322. [Google Scholar] [CrossRef]
- Amiri, S.; Yousefi-Ahmadipour, A.; Hosseini, M.-J.; Haj-Mirzaian, A.; Momeny, M.; Hosseini-Chegeni, H.; Mokhtari, T.; Kharrazi, S.; Hassanzadeh, G.; Amini, S.M.; et al. Maternal exposure to silver nanoparticles are associated with behavioral abnormalities in adulthood: Role of mitochondria and innate immunity in developmental toxicity. Neurotoxicology 2018, 66, 66–77. [Google Scholar] [CrossRef]
- Asharani, P.V.; Yi, L.W.; Zhiyuan, G.; Suresh, V. Toxicity of silver nanoparticles in zebrafish models. Nanotechnology 2008, 19, 255102. [Google Scholar] [CrossRef]
- Chen, Z.-Y.; Li, N.-J.; Cheng, F.-Y.; Hsueh, J.-F.; Huang, C.-C.; Lu, F.-I.; Fu, T.-F.; Yan, S.-J.; Lee, Y.-H.; Wang, Y.-J. The Effect of the Chorion on Size-Dependent Acute Toxicity and Underlying Mechanisms of Amine-Modified Silver Nano-particles in Zebrafish Embryos. Int. J. Mol. Sci. 2020, 21, 8. [Google Scholar]
- Kim, K.-T.; Truong, L.; Wehmas, L.; Tanguay, R.L. Silver nanoparticle toxicity in the embryonic zebrafish is governed by particle dispersion and ionic environment. Nanotechnology 2013, 24, 115101. [Google Scholar] [CrossRef] [Green Version]
- Yeo, M.K.; Pak, S.W. Exposing Zebrafish to Silver Nanoparticles during Caudal Fin Regeneration Disrupts Caudal Fin Growth and p53 Signaling. Mol. Cell. Toxicol. 2008, 4, 311–317. [Google Scholar]
- Khan, I.; Bahuguna, A.; Krishnan, M.; Shukla, S.; Lee, H.; Min, S.-H.; Choi, D.K.; Cho, Y.; Bajpai, V.K.; Huh, Y.S.; et al. The effect of biogenic manufactured silver nanoparticles on human endothelial cells and zebrafish model. Sci. Total Environ. 2019, 679, 365–377. [Google Scholar] [CrossRef] [PubMed]
- Petrarca, C.; Clemente, E.; Amato, V.; Pedata, P.; Sabbioni, E.; Bernardini, G.; Iavicoli, I.; Cortese, S.; Niu, Q.; Otsuki, T.; et al. Engineered metal based nanoparticles and innate immunity. Clin. Mol. Allergy 2015, 13, 1–12. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Luster, M.I.; Portier, C.; Paît, D.G.; White, K.L., Jr.; Gennings, C.; Munson, A.E.; Rosenthal, G.J. Risk assessment in immunotoxicology: I. Sensitivity and predictability of immune tests. Toxicol. Sci. 1992, 18, 200–210. [Google Scholar] [CrossRef]
- Scapini, P.; Lapinet-Vera, J.A.; Gasperini, S.; Calzetti, F.; Bazzoni, F.; Cassatella, M.A. The neutrophil as a cellular source of chemokines. Immunol. Rev. 2000, 177, 195–203. [Google Scholar] [CrossRef] [PubMed]
- Gamucci, O.; Bertero, A.; Gagliardi, M.; Bardi, G. Biomedical nanoparticles: Overview of their surface immune-compatibility. Coatings 2014, 4, 139–159. [Google Scholar] [CrossRef] [Green Version]
- Yang, E.-J.; Kim, S.; Kim, J.S.; Choi, I.-H. Inflammasome formation and IL-1β release by human blood monocytes in response to silver nanoparticles. Biomaterials 2012, 33, 6858–6867. [Google Scholar] [CrossRef]
- Feltis, B.N.; O’Keefe, S.J.; Harford, A.J.; Piva, T.J.; Turney, T.W.; Wright, P.F.A. Independent cytotoxic and inflammatory responses to zinc oxide nanoparticles in human monocytes and macrophages. Nanotoxicology 2011, 6, 757–765. [Google Scholar] [CrossRef]
- Muñoz, L.E.; Bilyy, R.; Biermann, M.H.C.; Kienhöfer, D.; Maueröder, C.; Hahn, J.; Brauner, J.M.; Weidner, D.; Chen, J.; Scharin-Mehlmann, M.; et al. Nanoparticles size-dependently initiate self-limiting NETosis-driven inflammation. Proc. Natl. Acad. Sci. USA 2016, 113, E5856–E5865. [Google Scholar]
- Spiljar, M.; Merkler, D.; Trajkovski, M. The Immune System Bridges the Gut Microbiota with Systemic Energy Homeostasis: Focus on TLRs, Mucosal Barrier, and SCFAs. Front. Immunol. 2017, 8, 1353. [Google Scholar] [CrossRef] [Green Version]
- Garlanda, C.; Dinarello, C.A.; Mantovani, A. The Interleukin-1 Family: Back to the Future. Immunity 2013, 39, 1003–1018. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Ogryzko, N.V.; Hoggett, E.E.; Solaymani-Kohal, S.; Tazzyman, S.; Chico, T.J.A.; Renshaw, S.A.; Wilson, H.L. Zebrafish tissue injury causes upregulation of interleukin-1 and caspase-dependent amplification of the inflammatory response. Dis. Model. Mech. 2013, 7, 259–264. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Raja, G.; Jang, Y.-K.; Suh, J.-S.; Kim, H.-S.; Ahn, S.H.; Kim, T.-J. Microcellular Environmental Regulation of Silver Nanoparticles in Cancer Therapy: A Critical Review. Cancers 2020, 12, 3. [Google Scholar] [CrossRef] [Green Version]
- Xu, J.; Wang, J.; Qiu, J.; Liu, H.; Wang, Y.; Cui, Y.; Humphry, R.; Wang, N.; Durkan, C.; Chen, Y.; et al. Nanoparticles retard immune cells recruitment in vivo by inhibiting chemokine expression. Biomaterials 2021, 265, 120392. [Google Scholar] [CrossRef] [PubMed]
- Chen, R.-J.; Kuo, H.-C.; Cheng, L.-H.; Lee, Y.-H.; Chang, W.-T.; Wang, B.-J.; Wang, Y.-J.; Cheng, H.-C. Apoptotic and Nonapoptotic Activities of Pterostilbene against Cancer. Int. J. Mol. Sci. 2018, 19, 287. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Chen, R.-J.; Lee, Y.-H.; Yeh, Y.-L.; Wu, W.-S.; Ho, C.-T.; Li, C.-Y.; Wang, B.-J.; Wang, Y.-J. Autophagy-inducing effect of pterostilbene: A prospective therapeutic/preventive option for skin diseases. J. Food Drug Anal. 2017, 25, 125–133. [Google Scholar] [CrossRef]
- Qureshi, A.A.; Guan, X.Q.; Reis, J.C.; Papasian, C.J.; Jabre, S.; Morrison, D.C.; Qureshi, N. Inhibition of nitric oxide and inflammatory cytokines in LPS-stimulated murine macrophages by resveratrol, a potent proteasome inhibitor. Lipids Health Dis. 2012, 11, 76. [Google Scholar] [CrossRef] [Green Version]
- MacNee, W.; Donaldson, K. Mechanism of lung injury caused by PM10 and ultrafine particles with special reference to COPD. Eur. Respir. J. 2003, 21, 47S–51S. [Google Scholar] [CrossRef] [PubMed]
- Loynes, C.A.; Martin, J.S.; Robertson, A.; Trushell, D.M.I.; Ingham, P.W.; Whyte, M.K.B.; Renshaw, S.A. Pivotal Advance: Pharmacological manipulation of inflammation resolution during spontaneously resolving tissue neutrophilia in the zebrafish. J. Leukoc. Biol. 2009, 87, 203–212. [Google Scholar] [CrossRef] [PubMed]
- Heidemann, J.; Domschke, W.; Kucharzik, T.; Maaser, C. Intestinal Microvascular Endothelium and Innate Immunity in Inflammatory Bowel Disease: A Second Line of Defense? Infect. Immun. 2006, 74, 5425–5432. [Google Scholar] [CrossRef] [Green Version]
- Akinwumi, B.C.; Bordun, K.-A.M.; Anderson, H.D. Biological Activities of Stilbenoids. Int. J. Mol. Sci. 2018, 19, 792. [Google Scholar] [CrossRef] [Green Version]
Characterization | Method | Condition | Results |
---|---|---|---|
Size | TEM | Dry | 8.89 ± 1.68 nm |
Morphology | TEM | Dry | Spherical |
Composition and purity | EDX | Dry | Ag (99.6%) |
Zeta potential | PALS | Water | −28.85 mV |
Hydrodynamic size | DLS | Water | 13.2 ± 3.1 nm |
Polydispersity index (PDI) | DLS | Water | 1.32 × 10−8 |
λmax | UV-Vis | Water | 391 nm |
Gene Name | 5′ → 3′ Forward Sequence | 3′ → 5′ Reverse Sequence |
---|---|---|
IL-1β | TTGAAAGTGCGCTTCAGCA | CGGTCCTTCCTGAAGAACA |
IL-6 | AGACCGCTGCCTGTCTAAAA | TTTGATGTCGTTCACCAGGA |
IL-8 | GTCGCTGCATTGAAACAGAA | CTTAACCCATGGAGCAGAGG |
IL-10 | TCACGTCATGAACGAGATCC | CCTCTTGCATTTCACCATATCC |
IL-22 | CATCGAGGAACAACGGTGTACA | CACGAGCACAGCAAAGCAAT |
NF-κB | AGGAGCGCAGGATACACAG | CAGGAAACAGCTTCTCCCAC |
TLR2 | TGTCTCCCACCCTGAAACTC | TAGTGCCACCTTCCTTCACC |
Myd88 | TCCGAAAGAAACTGGGTCTG | TCGTCATCTAAAATTTCTTTGAGC |
Lysozyme | GATTTGAGGGATTCTCCATTGG | CCGTAGTCCTTCCCCGTATCA |
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations. |
© 2021 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (http://creativecommons.org/licenses/by/4.0/).
Share and Cite
Chen, R.-J.; Huang, C.-C.; Pranata, R.; Lee, Y.-H.; Chen, Y.-Y.; Wu, Y.-H.; Wang, Y.-J. Modulation of Innate Immune Toxicity by Silver Nanoparticle Exposure and the Preventive Effects of Pterostilbene. Int. J. Mol. Sci. 2021, 22, 2536. https://doi.org/10.3390/ijms22052536
Chen R-J, Huang C-C, Pranata R, Lee Y-H, Chen Y-Y, Wu Y-H, Wang Y-J. Modulation of Innate Immune Toxicity by Silver Nanoparticle Exposure and the Preventive Effects of Pterostilbene. International Journal of Molecular Sciences. 2021; 22(5):2536. https://doi.org/10.3390/ijms22052536
Chicago/Turabian StyleChen, Rong-Jane, Chiao-Ching Huang, Rosita Pranata, Yu-Hsuan Lee, Yu-Ying Chen, Yuan-Hua Wu, and Ying-Jan Wang. 2021. "Modulation of Innate Immune Toxicity by Silver Nanoparticle Exposure and the Preventive Effects of Pterostilbene" International Journal of Molecular Sciences 22, no. 5: 2536. https://doi.org/10.3390/ijms22052536
APA StyleChen, R.-J., Huang, C.-C., Pranata, R., Lee, Y.-H., Chen, Y.-Y., Wu, Y.-H., & Wang, Y.-J. (2021). Modulation of Innate Immune Toxicity by Silver Nanoparticle Exposure and the Preventive Effects of Pterostilbene. International Journal of Molecular Sciences, 22(5), 2536. https://doi.org/10.3390/ijms22052536