Functional Expression of TRPV1 Ion Channel in the Canine Peripheral Blood Mononuclear Cells
Abstract
:1. Introduction
2. Results
2.1. Phylogenetic Analysis of Canine TRP Ion Channels Family and TRPV1 Orthologs
2.2. TRPV1 Expression in the Canine PBMC
2.3. Patch-Clamp Recording of Canine PBMC in Response to Capsaicin Treatment
2.4. Effect of Temperature on Calcium Influx in Canine PBMC
2.5. Regulation of Intracellular Ca2+ Level by Capsaicin, Capsazepine and BAPTA
3. Discussion
4. Materials and Methods
4.1. Phylogenetic Analysis
4.2. PBMC Isolation and Cell Culture
4.3. RT-qPCR
4.4. Western Blot
4.5. Patch-Clamp
4.6. Calcium Assay
4.7. Statistics
5. Conclusions
Supplementary Materials
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Becchetti, A.; Munaron, L.; Arcangeli, A. The Role of Ion Channels and Transporters in Cell Proliferation and Cancer. Front. Physiol. 2013, 4, 312. [Google Scholar] [CrossRef] [Green Version]
- Kim, J.B. Channelopathies. Korean J. Pediatr 2014, 57, 1–18. [Google Scholar] [CrossRef] [Green Version]
- Santos, R.; Ursu, O.; Gaulton, A.; Bento, A.P.; Donadi, R.S.; Bologa, C.G.; Karlsson, A.; Al-Lazikani, B.; Hersey, A.; Oprea, T.I.; et al. A Comprehensive Map of Molecular Drug Targets. Nat. Rev. Drug Discov. 2017, 16, 19–34. [Google Scholar] [CrossRef]
- Hutchings, C.J.; Colussi, P.; Clark, T.G. Ion Channels as Therapeutic Antibody Targets. MAbs 2019, 11, 265–296. [Google Scholar] [CrossRef] [PubMed]
- Krawczyk, K.; Xue, S.; Buchmann, P.; Charpin-El-Hamri, G.; Saxena, P.; Hussherr, M.D.; Shao, J.; Ye, H.; Xie, M.; Fussenegger, M. Electrogenetic Cellular Insulin Release for Real-time Glycemic Control in Type 1 Diabetic Mice. Science 2020, 368, 993–1001. [Google Scholar] [CrossRef] [PubMed]
- Berndt, A.; Lee, S.Y.; Ramakrishnan, C.; Deisseroth, K. Structure-guided Transformation of Channelrhodopsin into a Light-activated Chloride Channel. Science 2014, 344, 420–424. [Google Scholar] [CrossRef] [Green Version]
- Stanley, S.A.; Sauer, J.; Kane, R.S.; Dordick, J.S.; Friedman, J.M. Remote Regulation of Glucose Homeostasis in Mice Using Genetically Encoded Nanoparticles. Nat. Med. 2015, 21, 92–98. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Stanley, S.A.; Kelly, L.; Latcha, K.N.; Schmidt, S.F.; Yu, X.; Nectow, A.R.; Sauer, J.; Dyke, J.P.; Dordick, J.S.; Friedman, J.M. Bidirectional Electromagnetic Control of the Hypothalamus Regulates Feeding and Metabolism. Nature 2016, 531, 647–650. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Pan, Y.; Yoon, S.; Sun, J.; Huang, Z.; Lee, C.; Allen, M.; Wu, Y.; Chang, Y.J.; Sadelain, M.; Shung, K.K.; et al. Mechanogenetics for the Remote and Noninvasive Control of Cancer Immunotherapy. Proc. Natl. Acad. Sci. USA 2018, 115, 992–997. [Google Scholar] [CrossRef] [Green Version]
- Tam, M.; Gómez, S.; González-Gross, M.; Marcos, A. Possible Roles of Magnesium on the Immune System. Eur. J. Clin. Nutr. 2003, 57, 1193–1197. [Google Scholar] [CrossRef] [Green Version]
- Prasad, A.S. Zinc in Human Health: Effect of Zinc on Immune Cells. Mol. Med. 2008, 14, 353–357. [Google Scholar] [CrossRef]
- Feske, S.; Wulff, H.; Skolnik, E.Y. Ion Channels in Innate and Adaptive Immunity. Annu. Rev. Immunol. 2015, 33, 291–353. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Winslow, M.M.; Crabtree, G.R. Immunology. Decoding Calcium Signaling. Science 2005, 307, 56–57. [Google Scholar] [CrossRef]
- Feske, S.; Gwack, Y.; Prakriya, M.; Srikanth, S.; Puppel, S.H.; Tanasa, B.; Hogan, P.G.; Lewis, R.S.; Daly, M.; Rao, A. A Mutation in Orai1 Causes Immune Deficiency by Abrogating CRAC Channel Function. Nature 2006, 441, 179–185. [Google Scholar] [CrossRef] [PubMed]
- Fung-Leung, W.P.; Edwards, W.; Liu, Y.; Ngo, K.; Angsana, J.; Castro, G.; Wu, N.; Liu, X.; Swanson, R.V.; Wickenden, A.D. T Cell Subset and Stimulation Strength-Dependent Modulation of T Cell Activation by Kv1.3 Blockers. PLoS ONE 2017, 12, e0170102. [Google Scholar] [CrossRef]
- Cahalan, M.D.; Chandy, K.G. The Functional Network of Ion Channels in T Lymphocytes. Immunol. Rev. 2009, 231, 59–87. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Bose, T.; Cieślar-Pobuda, A.; Wiechec, E. Role of Ion Channels in Regulating Ca²⁺ Homeostasis during the Interplay between Immune and Cancer Cells. Cell Death Dis. 2015, 6, e1648. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Hardie, R.C. Photosensitive TRPs. Handb. Exp. Pharmacol. 2014, 223, 795–826. [Google Scholar] [CrossRef] [PubMed]
- Nilius, B.; Voets, T. TRP Channels: A TR(I)P through a World of Multifunctional Cation Channels. Pflugers Arch. 2005, 451, 1–10. [Google Scholar] [CrossRef] [PubMed]
- Nilius, B.; Owsianik, G. The Transient Receptor Potential Family of Ion Channels. Genome Biol. 2011, 12, 218. [Google Scholar] [CrossRef] [Green Version]
- Chávez, A.E.; Chiu, C.Q.; Castillo, P.E. TRPV1 Activation by Endogenous Anandamide Triggers Postsynaptic Long-term Depression in Dentate gyrus. Nat. Neurosci. 2010, 13, 1511–1518. [Google Scholar] [CrossRef] [Green Version]
- Boonen, B.; Alpizar, Y.A.; Sanchez, A.; López-Requena, A.; Voets, T.; Talavera, K. Differential Effects of Lipopolysaccharide on Mouse Sensory TRP Channels. Cell Calcium 2018, 73, 72–81. [Google Scholar] [CrossRef]
- Premkumar, L.S. Transient Receptor Potential Channels as Targets for Phytochemicals. ACS Chem. Neurosci. 2014, 5, 1117–1130. [Google Scholar] [CrossRef] [Green Version]
- Nakamura, T.; Miyoshi, N.; Ishii, T.; Nishikawa, M.; Ikushiro, S.; Watanabe, T. Activation of Transient Receptor Potential Ankyrin 1 by Quercetin and Its Analogs. Biosci. Biotechnol. Biochem. 2016, 80, 949–954. [Google Scholar] [CrossRef] [Green Version]
- Parenti, A.; De Logu, F.; Geppetti, P.; Benemei, S. What is the Evidence for the Role of TRP Channels in Inflammatory and Immune Cells? Br. J. Pharmacol. 2016, 173, 953–969. [Google Scholar] [CrossRef] [PubMed]
- Khalil, M.; Alliger, K.; Weidinger, C.; Yerinde, C.; Wirtz, S.; Becker, C.; Engel, M.A. Functional Role of Transient Receptor Potential Channels in Immune Cells and Epithelia. Front. Immunol. 2018, 9, 174. [Google Scholar] [CrossRef] [PubMed]
- Santoni, G.; Farfariello, V.; Liberati, S.; Morelli, M.B.; Nabissi, M.; Santoni, M.; Amantini, C. The Role of Transient Receptor Potential Vanilloid Type-2 Ion Channels in Innate and Adaptive Immune Responses. Front. Immunol. 2013, 4, 34. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Scheraga, R.G.; Southern, B.D.; Grove, L.M.; Olman, M.A. The Role of TRPV4 in Regulating Innate Immune Cell Function in Lung Inflammation. Front. Immunol. 2020, 11, 1211. [Google Scholar] [CrossRef]
- Michalick, L.; Kuebler, W.M. TRPV4-A Missing Link Between Mechanosensation and Immunity. Front. Immunol. 2020, 11, 413. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Majhi, R.K.; Sahoo, S.S.; Yadav, M.; Pratheek, B.M.; Chattopadhyay, S.; Goswami, C. Functional Expression of TRPV Channels in T Cells and Their Implications in Immune Regulation. FEBS J. 2015, 282, 2661–2681. [Google Scholar] [CrossRef] [PubMed]
- Ghoneum, M.H.; Gimzewski, J.K.; Ghoneum, A.; Katano, H.; Paw U, C.N.; Agrawal, A. Inhibition of TRPV1 Channel Activity in Human CD4⁺ T Cells by Nanodiamond and Nanoplatinum Liquid, DPV576. Nanomaterials 2018, 8, 770. [Google Scholar] [CrossRef] [Green Version]
- Melzer, N.; Hicking, G.; Göbel, K.; Wiendl, H. TRPM2 Cation Channels Modulate T Cell Effector Functions and Contribute to Autoimmune CNS Inflammation. PLoS ONE 2012, 7, e47617. [Google Scholar] [CrossRef]
- Beceiro, S.; Radin, J.N.; Chatuvedi, R.; Piazuelo, M.B.; Horvarth, D.J.; Cortado, H.; Gu, Y.; Dixon, B.; Gu, C.; Lange, I.; et al. TRPM2 Ion Channels Regulate Macrophage Polarization and Gastric Inflammation during Helicobacter pylori Infection. Mucosal. Immunol. 2017, 10, 493–507. [Google Scholar] [CrossRef]
- Sakaguchi, T.; Okumura, R.; Ono, C.; Okuzaki, D.; Kawai, T.; Okochi, Y.; Tanimura, N.; Murakami, M.; Kayama, H.; Umemoto, E.; et al. TRPM5 Negatively Regulates Calcium-Dependent Responses in Lipopolysaccharide-Stimulated B Lymphocytes. Cell Rep. 2020, 31, 107755. [Google Scholar] [CrossRef]
- Romagnani, A.; Vettore, V.; Rezzonico-Jost, T.; Hampe, S.; Rottoli, E.; Nadolni, W.; Perotti, M.; Meier, M.A.; Hermanns, C.; Geiger, S.; et al. TRPM7 Kinase Activity is Essential for T Cell Colonization and Alloreactivity in the Gut. Nat. Commun. 2017, 8, 1917. [Google Scholar] [CrossRef] [PubMed]
- Caterina, M.J.; Schumacher, M.A.; Tominaga, M.; Rosen, T.A.; Levine, J.D.; David, J. The Capsaicin Receptor: A Heat-activated Ion Channel in the Pain Pathway. Nature 1997, 389, 816–824. [Google Scholar] [CrossRef] [PubMed]
- Tsvetkov, E.A.; Potatieva, N.N.; Bolshakov, K.V. Voltage-Dependent Interaction of Capsaicine and Protons on TRPV1-Receptors. Acta Nat. 2017, 9, 75–80. [Google Scholar] [CrossRef] [PubMed]
- Zhang, F.; Jara-Oseguera, A.; Chang, T.H.; Bae, C.; Hanson, S.M.; Swartz, K.J. Heat Activation is Intrinsic to the Pore Domain of TRPV1. Proc. Natl. Acad. Sci. USA 2018, 115, E317–E324. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Bertin, S.; Aoki-Nonaka, Y.; de Jong, P.R.; Nohara, L.L.; Xu, H.; Stanwood, S.R.; Srikanth, S.; Lee, J.; To, K.; Abramson, L.; et al. The Ion Channel TRPV1 Regulates the Activation and Proinflammatory Properties of CD4⁺ T Cells. Nat. Immunol. 2014, 15, 1055–1063. [Google Scholar] [CrossRef]
- Saunders, C.I.; Kunde, D.A.; Crawford, A.; Geraghty, D.P. Expression of Transient Receptor Potential Vanilloid 1 (TRPV1) and 2 (TRPV2) in Human Peripheral Blood. Mol. Immunol. 2007, 44, 1429–1435. [Google Scholar] [CrossRef]
- Inada, H.; Iida, T.; Tominaga, M. Different Expression Patterns of TRP Genes in Murine B and T Lymphocytes. Biochem. Biophys. Res. Commun. 2006, 350, 762–767. [Google Scholar] [CrossRef]
- Bujak, J.K.; Kosmala, D.; Szopa, I.M.; Majchrzak, K.; Bednarczyk, P. Inflammation, Cancer and Immunity-Implication of TRPV1 Channel. Front. Oncol. 2019, 9, 1087. [Google Scholar] [CrossRef]
- Roger, S.; Gillet, L.; Le Guennec, J.Y.; Besson, P. Voltage-gated Sodium Channels and Cancer: Is Excitability Their Primary Role? Front. Pharmacol. 2015, 6, 152. [Google Scholar] [CrossRef] [Green Version]
- Phelps, P.T.; Anthes, J.C.; Correll, C.C. Cloning and Functional Characterization of Dog Transient Receptor Potential Vanilloid Receptor-1 (TRPV1). Eur. J. Pharmacol. 2005, 513, 57–66. [Google Scholar] [CrossRef] [PubMed]
- Lucroy, M.D.; Suckow, M.A. Predictive Modeling for Cancer Drug Discovery Using Canine Models. Expert Opin. Drug Discov. 2020, 15, 731–738. [Google Scholar] [CrossRef]
- Bujak, J.K.; Pingwara, R.; Nelson, M.H.; Majchrzak, K. Adoptive Cell Transfer: New Perspective Treatment in Veterinary Oncology. Acta Vet. Scand. 2018, 60, 60. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Overgaard, N.H.; Fan, T.M.; Schachtschneider, K.M.; Principe, D.R.; Schook, L.B.; Jungersen, G. Of Mice, Dogs, Pigs, and Men: Choosing the Appropriate Model for Immuno-Oncology Research. ILAR J. 2018, 59, 247–262. [Google Scholar] [CrossRef]
- Cha, S.K.; Kim, J.H.; Huang, C.L. Flow-induced Activation of TRPV5 and TRPV6 Channels Stimulates Ca(2+)-activated K(+) Channel Causing Membrane Hyperpolarization. Biochim. Biophys. Acta 2013, 1833, 3046–3053. [Google Scholar] [CrossRef] [Green Version]
- Voets, T. TRP Channels and Thermosensation. Handb. Exp. Pharmacol. 2014, 223, 729–741. [Google Scholar] [CrossRef] [PubMed]
- Chu, Y.; Cohen, B.E.; Chuang, H.H. A Single TRPV1 Amino Acid Controls Species Sensitivity to Capsaicin. Sci. Rep. 2020, 10, 8038. [Google Scholar] [CrossRef] [PubMed]
- Yang, F.; Zheng, J. Understand Spiciness: Mechanism of TRPV1 Channel Activation by Capsaicin. Protein Cell 2017, 8, 169–177. [Google Scholar] [CrossRef] [Green Version]
- Gavva, N.R.; Klionsky, L.; Qu, Y.; Shi, L.; Tamir, R.; Edenson, S.; Zhang, T.J.; Viswanadhan, V.N.; Toth, A.; Pearce, L.V.; et al. Molecular Determinants of Vanilloid Sensitivity in TRPV1. J. Biol. Chem. 2004, 279, 20283–20295. [Google Scholar] [CrossRef] [Green Version]
- Montell, C. Physiology, Phylogeny, and Functions of the TRP Superfamily of Cation Channels. Sci. STKE 2001, 2001, re1. [Google Scholar] [CrossRef] [PubMed]
- Latorre, R.; Zaelzer, C.; Brauchi, S. Structure–functional Intimacies of Transient Receptor Potential Channels. Q. Rev. Biophys. 2009, 42, 201–246. [Google Scholar] [CrossRef] [PubMed]
- Caterina, M.J.; Rosen, T.A.; Tominaga, M.; Brake, A.J.; Julius, D. A Capsaicin-receptor Homologue with a High Threshold for Noxious Heat. Nature 1999, 398, 436–441. [Google Scholar] [CrossRef] [PubMed]
- Perálvarez-Marín, A.; Doñate-Macian, P.; Gaudet, R. What Do We Know about the Transient Receptor Potential Vanilloid 2 (TRPV2) Ion Channel? FEBS J. 2013, 280, 5471–5487. [Google Scholar] [CrossRef] [Green Version]
- Zhang, F.; Hanson, S.M.; Jara-Oseguera, A.; Krepkiy, D.; Bae, C.; Pearce, L.V.; Blumberg, P.M.; Newstead, S.; Swartz, K.J. Engineering Vanilloid-sensitivity into the Rat TRPV2 Channel. Elife 2016, 5. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Jordt, S.E.; Julius, D. Molecular Basis for Species-specific Sensitivity to “Hot” Chili Peppers. Cell 2002, 108, 421–430. [Google Scholar] [CrossRef] [Green Version]
- Gau, P.; Poon, J.; Ufret-Vincenty, C.; Snelson, C.D.; Gordon, S.E.; Raible, D.W.; Dhaka, A. The Zebrafish Ortholog of TRPV1 is Required for Heat-induced Locomotion. J. Neurosci. 2013, 33, 5249–5260. [Google Scholar] [CrossRef] [Green Version]
- Spinsanti, G.; Zannolli, R.; Panti, C.; Ceccarelli, I.; Marsili, L.; Bachiocco, V.; Frati, F.; Aloisi, A.M. Quantitative Real-Time PCR Detection of TRPV1-4 Gene Expression in Human Leukocytes from Healthy and Hyposensitive Subjects. Mol. Pain 2008, 4, 51. [Google Scholar] [CrossRef] [Green Version]
- Veldhuis, N.A.; Lew, M.J.; Abogadie, F.C.; Poole, D.P.; Jennings, E.A.; Ivanusic, J.J.; Eilers, H.; Bunnett, N.W.; McIntyre, P. N-glycosylation Determines Ionic Permeability and Desensitization of the TRPV1 Capsaicin Receptor. J. Biol. Chem. 2012, 287, 21765–21772. [Google Scholar] [CrossRef] [Green Version]
- Schumacher, M.A.; Eilers, H. TRPV1 Splice Variants: Structure and Function. Front. Biosci. 2010, 15, 872–882. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Vos, M.H.; Neelands, T.R.; McDonald, H.A.; Choi, W.; Kroeger, P.E.; Puttfarcken, P.S.; Faltynek, C.R.; Moreland, R.B.; Han, P. TRPV1b Overexpression Negatively Regulates TRPV1 Responsiveness to Capsaicin, Heat and Low pH in HEK293 Cells. J. Neurochem. 2006, 99, 1088–1102. [Google Scholar] [CrossRef] [PubMed]
- Storti, B.; Di Rienzo, C.; Cardarelli, F.; Bizzarri, R.; Beltram, F. Unveiling TRPV1 Spatio-temporal Organization in Live Cell Membranes. PLoS ONE 2015, 10, e0116900. [Google Scholar] [CrossRef] [PubMed]
- Zhao, R.; Tsang, S.Y. Versatile Roles of Intracellularly Located TRPV1 Channel. J. Cell. Physiol. 2017, 232, 1957–1965. [Google Scholar] [CrossRef] [PubMed]
- Lozano, C.; Córdova, C.; Marchant, I.; Zúñiga, R.; Ochova, P.; Ramírez-Barrantes, R.; González-Arriagada, W.A.; Rodriguez, B.; Olivero, P. Intracellular Aggregated TRPV1 is Associated with Lower Survival in Breast Cancer Patients. Breast Cancer 2018, 10, 161–168. [Google Scholar] [CrossRef] [Green Version]
- Kochukov, M.Y.; McNearney, T.A.; Yin, H.; Zhang, L.; Ma, F.; Ponomareva, L.; Abshire, S.; Westlund, K.N. Tumor Necrosis Factor-alpha (TNF-alpha) Enhances Functional Thermal and Chemical Responses of TRP Cation Channels in Human Synoviocytes. Mol. Pain 2009, 5, 49. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Nakazawa, Y.; Donaldson, P.J.; Petrova, R.S. Verification and Spatial Mapping of TRPV1 and TRPV4 Expression in the Embryonic and Adult Mouse Lens. Exp. Eye Res. 2019, 186, 107707. [Google Scholar] [CrossRef]
- Liu, Y.J.; Lin, X.X.; Fang, J.Q.; Fang, F. Involvement of MrgprC in Electroacupuncture Analgesia for Attenuating CFA-Induced Thermal Hyperalgesia by Suppressing the TRPV1 Pathway. Evid. Based Complement. Altern. Med. 2018, 2018, 9102107. [Google Scholar] [CrossRef] [Green Version]
- Wu, Y.; Liu, Y.; Hou, P.; Yan, Z.; Kong, W.; Liu, B.; Li, X.; Yao, J.; Zhang, Y.; Qin, F.; et al. TRPV1 Channels are Functionally Coupled with BK(mSlo1) Channels in Rat Dorsal Root Ganglion (DRG) Neurons. PLoS ONE 2013, 8, e78203. [Google Scholar] [CrossRef]
- Fischer, M.J.; Balasuriya, D.; Jeggle, P.; Goetze, T.A.; McNaughton, P.A.; Reeh, P.W.; Edwardson, J.M. Direct Evidence for Functional TRPV1/TRPA1 Heteromers. Pflugers Arch. 2014, 466, 2229–2241. [Google Scholar] [CrossRef]
- Geron, M.; Kumar, R.; Zhou, W.; Faraldo-Gómez, J.D.; Vásquez, V.; Priel, A. TRPV1 Pore Turret Dictates Distinct DkTx and Capsaicin Gating. Proc. Natl. Acad. Sci. USA 2018, 115, E11837–E11846. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Velisetty, P.; Stein, R.A.; Sierra-Valdez, F.J.; Vásquez, V.; Cordero-Morales, J.F. Expression and Purification of the Pain Receptor TRPV1 for Spectroscopic Analysis. Sci. Rep. 2017, 7, 9861. [Google Scholar] [CrossRef] [PubMed]
- Fischer, B.S.; Qin, D.; Kim, K.; McDonald, T.V. Capsaicin Inhibits Jurkat T-cell Activation by Blocking Calcium Entry Current I(CRAC). J. Pharmacol. Exp. Ther. 2001, 299, 238–246. [Google Scholar] [PubMed]
- Lu, G.; Henderson, D.; Liu, L.; Reinhart, P.H.; Simon, S.A. TRPV1b, a Functional Human Vanilloid Receptor Splice Variant. Mol. Pharmacol. 2005, 67, 1119–1127. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Shin, J.S.; Wang, M.H.; Hwang, S.W.; Cho, H.; Cho, S.Y.; Kwon, M.J.; Lee, S.Y.; Oh, U. Differences in Sensitivity of Vanilloid Receptor 1 Transfected to Human Embryonic Kidney Cells and Capsaicin-activated Channels in Cultured Rat Dorsal Root Ganglion Neurons to Capsaicin Receptor Agonists. Neurosci. Lett. 2001, 299, 135–139. [Google Scholar] [CrossRef]
- Voolstra, O.; Huber, A. Post-Translational Modifications of TRP Channels. Cells 2014, 3, 258–287. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Prescott, E.D.; Julius, D. A Modular PIP2 Binding Site as a Determinant of Capsaicin Receptor Sensitivity. Science 2003, 300, 1284–1288. [Google Scholar] [CrossRef]
- Staruschenko, A.; Jeske, N.A.; Akopian, A.N. Contribution of TRPV1-TRPA1 Interaction to the Single Channel Properties of the TRPA1 Channel. J. Biol. Chem. 2010, 285, 15167–15177. [Google Scholar] [CrossRef] [Green Version]
- Shibasaki, K.; Sugio, S.; Takao, K.; Yamanaka, A.; Miyakawa, T.; Tominaga, M.; Ishizaki, Y. TRPV4 Activation at the Physiological Temperature is a Critical Determinant of Neuronal Excitability and Behavior. Pflugers Arch. 2015, 467, 2495–2507. [Google Scholar] [CrossRef]
- Cao, E.; Cordero-Morales, J.F.; Liu, B.; Qin, F.; Julius, D. TRPV1 Channels are Intrinsically Heat Sensitive and Negatively Regulated by Phosphoinositide Lipids. Neuron 2013, 77, 667–679. [Google Scholar] [CrossRef] [Green Version]
- Kashio, M.; Tominaga, M. The TRPM2 Channel: A Thermo-sensitive Metabolic Sensor. Channels 2017, 11, 426–433. [Google Scholar] [CrossRef]
- Xiao, B.; Coste, B.; Mathur, J.; Patapoutian, A. Temperature-dependent STIM1 Activation Induces Ca2+ influx and Modulates Gene Expression. Nat. Chem. Biol. 2011, 7, 351–358. [Google Scholar] [CrossRef] [Green Version]
- Mamatova, K.N.; Kang, T.M. Activation of Rat Transient Receptor Potential Cation Channel Subfamily V Member 1 Channels by 2-aminoethoxydiphenyl Borate. Integr. Med. Res. 2013, 2, 112–123. [Google Scholar] [CrossRef] [Green Version]
- Wang, C.; Hu, H.Z.; Colton, C.K.; Wood, J.D.; Zhu, M.X. An Alternative Splicing Product of the Murine trpv1 Gene Dominant Negatively Modulates the Activity of TRPV1 Channels. J. Biol. Chem. 2004, 279, 37423–37430. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Wang, J.-P.; Tseng, C.-S.; Sun, S.-P.; Chen, Y.-S.; Tsai, C.-R.; Hsu, M.-F. Capsaicin Stimulates the Non-store-operated Ca2+ Entry but Inhibits the Store-operated Ca2+ Entry in Neutrophils. Toxicol. Appl. Pharmacol. 2005, 209, 134–144. [Google Scholar] [CrossRef]
- Feske, S.; Concepcion, A.R.; Coetzee, W.A. Eye on Ion Channels in Immune Cells. Sci. Signal. 2019, 12. [Google Scholar] [CrossRef] [PubMed]
- Pecze, L.; Jósvay, K.; Blum, W.; Petrovics, G.; Vizler, C.; Oláh, Z.; Schwaller, B. Activation of Endogenous TRPV1 Fails to Induce Overstimulation-based Cytotoxicity in Breast and Prostate Cancer Cells but not in Pain-sensing Neurons. Biochim. Biophys. Acta 2016, 1863, 2054–2064. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Cheng, W.; Yang, F.; Liu, S.; Colton, C.K.; Wang, C.; Cui, Y.; Cao, X.; Zhu, M.X.; Sun, C.; Wang, K.; et al. Heteromeric Heat-sensitive Transient Receptor Potential Channels Exhibit Distinct Temperature and Chemical Response. J. Biol. Chem. 2012, 287, 7279–7288. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Pearce, L.V.; Ann, J.; Blumberg, P.M.; Lee, J. Combination of a Rapidly Penetrating Agonist and a Slowly Penetrating Antagonist Affords Agonist Action of Limited Duration at the Cellular Level. Biomol. Ther. 2019, 27, 435–441. [Google Scholar] [CrossRef]
- Kistner, K.; Siklosi, N.; Babes, A.; Khalil, M.; Selescu, T.; Zimmermann, K.; Wirtz, S.; Becker, C.; Neurath, M.F.; Reeh, P.W.; et al. Systemic Desensitization through TRPA1 Channels by Capsazepine and Mustard Oil—A Novel Strategy against Inflammation and Pain. Sci. Rep. 2016, 6, 28621. [Google Scholar] [CrossRef] [Green Version]
- Lin, Y.J.; Lin, R.L.; Ruan, T.; Khosravi, M.; Lee, L.Y. A Synergistic Effect of Simultaneous TRPA1 and TRPV1 Activations on Vagal Pulmonary C-fiber Afferents. J. Appl. Physiol. 2015, 118, 273–281. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Sahoo, S.S.; Majhi, R.K.; Tiwari, A.; Acharya, T.; Kumar, P.S.; Saha, S.; Kumar, A.; Goswami, C.; Chattopadhyay, S. Transient Receptor Potential Ankyrin1 Channel is Endogenously Expressed in T Cells and is Involved in Immune Functions. Biosci. Rep. 2019, 39. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Bertin, S.; Aoki-Nonaka, Y.; Lee, J.; de Jong, P.R.; Kim, P.; Han, T.; Yu, T.; To, K.; Takahashi, N.; Boland, B.S.; et al. The TRPA1 Ion Channel is Expressed in CD4+ T Cells and Restrains T-cell-mediated Colitis through Inhibition of TRPV1. Gut 2017, 66, 1584–1596. [Google Scholar] [CrossRef] [PubMed]
- Qiu, L.; Wang, Y.; Qu, H. Loading Calcium Fluorescent Probes into Protoplasts to Detect Calcium in the Flesh Tissue Cells of Malus domestica. Hortic Res. 2020, 7, 91. [Google Scholar] [CrossRef]
- Palmer, A.E.; Tsien, R.Y. Measuring Calcium Signaling Using Genetically Targetable Fluorescent Indicators. Nat. Protoc. 2006, 1, 1057–1065. [Google Scholar] [CrossRef]
- Sievers, F.; Wilm, A.; Dineen, D.; Gibson, T.J.; Karplus, K.; Li, W.; Lopez, R.; McWilliam, H.; Remmert, M.; Söding, J.; et al. Fast, Scalable Generation of High-quality Protein Multiple Sequence Alignments Using Clustal Omega. Mol. Syst. Biol. 2011, 7, 539. [Google Scholar] [CrossRef] [PubMed]
- Castresana, J. Selection of Conserved Blocks from Multiple Alignments for Their Use in Phylogenetic Analysis. Mol. Biol. Evol. 2000, 17, 540–552. [Google Scholar] [CrossRef] [Green Version]
- Gouy, M.; Guindon, S.; Gascuel, O. SeaView Version 4: A Multiplatform Graphical User Interface for Sequence Alignment and Phylogenetic Tree Building. Mol. Biol. Evol. 2010, 27, 221–224. [Google Scholar] [CrossRef] [Green Version]
- Huelsenbeck, J.P.; Ronquist, F. MRBAYES: Bayesian Inference of Phylogenetic Trees. Bioinformatics 2001, 17, 754–755. [Google Scholar] [CrossRef] [Green Version]
- Junier, T.; Zdobnov, E.M. The Newick Utilities: High-throughput Phylogenetic Tree Processing in the UNIX Shell. Bioinformatics 2010, 26, 1669–1670. [Google Scholar] [CrossRef] [Green Version]
- Lemoine, F.; Correia, D.; Lefort, V.; Doppelt-Azeroual, O.; Mareuil, F.; Cohen-Boulakia, S.; Gascuel, O. NGPhylogeny.fr: New Generation Phylogenetic Services for Non-specialists. Nucleic Acids Res. 2019, 47, W260–W265. [Google Scholar] [CrossRef] [Green Version]
- Felsenstein, J. PHYLIP-phylogeny inference package (Version 3.2). Cladistics 2002, 5, 164–166. [Google Scholar]
- Untergasser, A.; Cutcutache, I.; Koressaar, T.; Ye, J.; Faircloth, B.C.; Remm, M.; Rozen, S.G. Primer3—New Capabilities and Interfaces. Nucleic Acids Res. 2012, 40, e115. [Google Scholar] [CrossRef] [Green Version]
- Ye, J.; Coulouris, G.; Zaretskaya, I.; Cutcutache, I.; Rozen, S.; Madden, T.L. Primer-BLAST: A Tool to Design Target-specific Primers for Polymerase Chain Reaction. BMC Bioinform. 2012, 13, 134. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Brinkhof, B.; Spee, B.; Rothuizen, J.; Penning, L.C. Development and Evaluation of Canine Reference Genes for Accurate Quantification of Gene Expression. Anal. Biochem. 2006, 356, 36–43. [Google Scholar] [CrossRef] [PubMed]
- Livak, K.J.; Schmittgen, T.D. Analysis of Relative Gene Expression Data Using Real-time Quantitative PCR and the 2(-Delta Delta C(T)) Method. Methods 2001, 25, 402–408. [Google Scholar] [CrossRef] [PubMed]
Target Name | Accession Number | Forward Primer | Reverse Primer | Size (bp) |
---|---|---|---|---|
TRPV1 | NM_001003970.1 | AACATGCTCATTGCCCTCAT | GACCTCATCCACCCTGAAAC | 216 |
TRPV2 | XM_546641.6 | TGAACTGCTCTTCCTGGTCC | GCAAGCCGCGTGTGTAATAG | 143 |
TRPV4 | NM_001127315.1 | CCTGTATGAGTCCTCCGTGG | CTCTGTGGCTGCTTCTCGAT | 135 |
TRPM2 | XM_022413206.1 | GGACAACGCCTGGATTGAGA | GTGGTTGGCATACAGTGGGA | 160 |
TRPM5 | XM_022405530.1 | ATGGCAAGTTTGTGAAGGTGC | GACTTCATGGCAAACGACCG | 136 |
TRPM7 | XM_535475.6 | TCAGCAACTCGTCAGGTGTTT | AAGCATCCGTTGGACTCTGT | 167 |
RPS-19 | Xm_533657 | CCTTCCTCAAAAA/GTCTGGG | GTTCTCATCGTAGGGAGCAAG | 95 |
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations. |
© 2021 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (http://creativecommons.org/licenses/by/4.0/).
Share and Cite
Bujak, J.K.; Kosmala, D.; Majchrzak-Kuligowska, K.; Bednarczyk, P. Functional Expression of TRPV1 Ion Channel in the Canine Peripheral Blood Mononuclear Cells. Int. J. Mol. Sci. 2021, 22, 3177. https://doi.org/10.3390/ijms22063177
Bujak JK, Kosmala D, Majchrzak-Kuligowska K, Bednarczyk P. Functional Expression of TRPV1 Ion Channel in the Canine Peripheral Blood Mononuclear Cells. International Journal of Molecular Sciences. 2021; 22(6):3177. https://doi.org/10.3390/ijms22063177
Chicago/Turabian StyleBujak, Joanna K., Daria Kosmala, Kinga Majchrzak-Kuligowska, and Piotr Bednarczyk. 2021. "Functional Expression of TRPV1 Ion Channel in the Canine Peripheral Blood Mononuclear Cells" International Journal of Molecular Sciences 22, no. 6: 3177. https://doi.org/10.3390/ijms22063177