Long-Term Vitamin D Deficiency Results in the Inhibition of Cell Proliferation and Alteration of Multiple Gastric Epithelial Cell Lineages in Mice
Abstract
:1. Introduction
2. Results
2.1. Creating VD Deficient Mouse Model
2.2. Reduction in Mucous Cells in SDD and Their Expansion in VDD Stomachs
2.3. Reduced Proliferation and High Apoptosis Rates in VDD Mice
2.4. Increased Zymogenic Cell Lineage in VD Deficient Corpus
2.5. Variable Endocrine Cell Lineages Response due to Chronic VD Deficiency
2.6. Impaired Function for Parietal Cells in SDD and VDD Groups
2.7. Chronic VD Deficiency Causes Changes in VDR Expression with Induction or Repression of Respective Target Genes
3. Discussion
4. Materials and Methods
4.1. Experimental Animals
4.2. Mice and Diets
4.3. Histology and Immunohistochemistry
4.4. Analysis of Proliferation and Apoptosis
4.5. Morphometric Analysis
4.6. RNA Extraction
4.7. cDNA Synthesis
4.8. Gene Expression
4.9. Quantitative Real-Time PCR
4.10. Determination of Serum VD Levels by LC-MS-MS
4.11. Gastric Content pH Measurement
4.12. Statistical Analysis
5. Conclusions
Supplementary Materials
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
Appendix A
Genes | Primer Sequence (5′->3′) | Product Size (bp) | |
---|---|---|---|
Gapdh | TCAAGAAGGTGGTGAAGCAGG | TATTATGGGGGTCTGGGATGG | 350 |
Muc5ac | CTGGTTTGACACTGACTTCCC | CTCCTCTCGGTGACAGAGTCT | 103 |
Muc6 | AGCCCACATTCCCTATCAGC | CACAGTGGAAGATTGCGAGAG | 192 |
Atp4a | GCCTGTCACTGACAGCAAAGAGG | GGTCTTCTGTGGTGTCCGCC | 189 |
Atp4b | AACAGAATTGTCAAGTTCCTC | AGACTGAAGGTGCCATTG | 140 |
Chga | TCAAATGCCCTATCCAAGTCC | GCCAACCGTACTTCAAACTTCG | 134 |
Pgc | TGCAAGGCATTGTAGACACA | CTCCTATGGTCTGCAGAAGTTCATT | 81 |
Gast | CATCATCTGGACCAGGGACCAA | CCTCCATTCGTGGCCTCTGCT | 150 |
Ghrl | GGCAGGCTCCAGCTTCCT | CTGGTGGCTTCTTGGATTCC | 71 |
IF | CTTGGCCCTGACCTGTATGT | TAGGTTGCTCAGGTGTCACG | 191 |
Mt1 | GGGCCCCACTCAACCTCATAG | AGCAGTAAGACCCCAACCAGTGT | 352 |
Mt2 | AACCGCTACTGCTGCATCTGTCATGCCCAGGTCCAGTGGAG | AAACTGCGCAAATCACTCGGTCTC | 341 |
Tff2 | GAACTTTCTTCTGGCTTGCAG | 468 | |
Pdia3 | ACTGGAGAGGTTCCTGTTGTGG | CAGGTATCTCTTCAAGTTGCCATC | 138 |
Vdr | GAATGTGCCTCGGATCTGTG | ATGCGGCAATCTCCATTGAAG | 150 |
Cav1 | GACCCCAAGCATCTCAACGA | GCCATAGGGATGCCGAAGA | 173 |
Mapk | CGAAATGACCGGCTACGTGG | CACTTCATCGTAGGTCAGGC | 505 |
Src | TCCACACCTCTCCGAAGCAA | CATGCTGATGGCCTGTGTCA | 151 |
Pthlh | AATGCATTGGGATCAAACTGTCT | GCCTTGGCAAAAGGGAAAA | 75 |
Pth1r | GCTTCCTGCCACCACCAAT | GGGAATGTCATAGTAACTGG | 102 |
Trpv6 | ATCGATGGCCCTGCGAACT | CAGAGTAGAGGCCATCTTGTTGCTG | 358 |
P21 | GCCTTAGCCCTCACTCTGTG | AGCTGGCCTTAGAGGTGACA | 431 |
Lgr5 | TCTTCACCTCCTACCTGGACCT | GGCGTAGTCTGCTATGTGGTGT | 419 |
Nanog | CCTGATTCTTCTACCAGTCCA | GGCCTGAGAGAACACAGTCC | 123 |
Adipoq | CCTGGAGAGAAGGGAGAGAAA | CGAATGGGTACATTGGGAAC | 209 |
References
- Christodoulou, S.; Goula, T.; Ververidis, A.; Drosos, G. Vitamin D and Bone Disease. BioMed Res. Int. 2013, 2013, 396541. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Lo, T.-H.; Wu, T.-Y.; Li, P.-C.; Ding, D.-C. Effect of Vitamin D Supplementation during Pregnancy on Maternal and Perinatal Outcomes. Tzu-Chi Med. J. 2019, 31, 201. [Google Scholar] [CrossRef]
- Illescas-Montes, R.; Melguizo-Rodríguez, L.; Ruiz, C.; Costela-Ruiz, V.J. Vitamin D and Autoimmune Diseases. Life Sci. 2019, 233, 116744. [Google Scholar] [CrossRef] [PubMed]
- Barbarawi, M.; Kheiri, B.; Zayed, Y.; Barbarawi, O.; Dhillon, H.; Swaid, B.; Yelangi, A.; Sundus, S.; Bachuwa, G.; Alkotob, M.L.; et al. Vitamin D Supplementation and Cardiovascular Disease Risks in More Than 83,000 Individuals in 21 Randomized Clinical Trials: A Meta-Analysis. JAMA Cardiol. 2019, 4, 765–776. [Google Scholar] [CrossRef]
- Jagannath, V.A.; Filippini, G.; Di Pietrantonj, C.; Asokan, G.V.; Robak, E.W.; Whamond, L.; Robinson, S.A. Vitamin D for the Management of Multiple Sclerosis. Cochrane Database Syst. Rev. 2018, 2018, CD008422. [Google Scholar] [CrossRef]
- Sirajudeen, S.; Shah, I.; Al Menhali, A. A Narrative Role of Vitamin D and Its Receptor: With Current Evidence on the Gastric Tissues. Int. J. Mol. Sci. 2019, 20, 3832. [Google Scholar] [CrossRef] [Green Version]
- Boyan, B.D.; Sylvia, V.L.; Dean, D.D.; Del Toro, F.; Schwartz, Z. Differential Regulation of Growth Plate Chondrocytes by 1alpha,25-(OH)2D3 and 24R,25-(OH)2D3 Involves Cell-Maturation-Specific Membrane-Receptor-Activated Phospholipid Metabolism. Crit. Rev. Oral Biol. Med. 2002, 13, 143–154. [Google Scholar] [CrossRef] [Green Version]
- Ali, I.I.; Shah, I.; Marzouk, S.; Karam, S.M.; Al Menhali, A. Vitamin D Is Necessary for Murine Gastric Epithelial Homeostasis. Biology 2021, 10, 705. [Google Scholar] [CrossRef]
- Mahmood, F.; Xu, R.; Awan, M.U.N.; Song, Y.; Han, Q.; Xia, X.; Zhang, J. PDIA3: Structure, Functions and Its Potential Role in Viral Infections. Biomed. Pharmacother. 2021, 143, 112110. [Google Scholar] [CrossRef]
- Ribeiro, M.C.; Moore, S.M.; Kishi, N.; Macklis, J.D.; MacDonald, J.L. Vitamin D Supplementation Rescues Aberrant NF-ΚB Pathway Activation and Partially Ameliorates Rett Syndrome Phenotypes in Mecp2 Mutant Mice. Eneuro 2020, 7, ENEURO.0167-20.2020. [Google Scholar] [CrossRef]
- Nair, R.; Maseeh, A. Vitamin D: The “Sunshine” Vitamin. J. Pharmacol. Pharmacother. 2012, 3, 118–126. [Google Scholar] [CrossRef]
- Lu, Z.; Chen, T.C.; Zhang, A.; Persons, K.S.; Kohn, N.; Berkowitz, R.; Martinello, S.; Holick, M.F. An Evaluation of the Vitamin D3 Content in Fish: Is the Vitamin D Content Adequate to Satisfy the Dietary Requirement for Vitamin D? J. Steroid Biochem. Mol. Biol. 2007, 103, 642–644. [Google Scholar] [CrossRef] [Green Version]
- Spiro, A.; Buttriss, J.L. Vitamin D: An Overview of Vitamin D Status and Intake in Europe. Nutr. Bull. 2014, 39, 322–350. [Google Scholar] [CrossRef] [Green Version]
- An, R.; Liu, J. Fast-Food and Full-Service Restaurant Consumption in Relation to Daily Energy and Nutrient Intakes among US Adult Cancer Survivors, 2003–2012. Nutr. Health 2013, 22, 181–195. [Google Scholar] [CrossRef]
- Wacker, M.; Holick, M.F. Sunlight and Vitamin D: A Global Perspective for Health. Dermatoendocrinol. 2013, 5, 51–108. [Google Scholar] [CrossRef] [Green Version]
- Al-Zohily, B.; Al-Menhali, A.; Gariballa, S.; Haq, A.; Shah, I. Epimers of Vitamin D: A Review. Int. J. Mol. Sci. 2020, 21, 470. [Google Scholar] [CrossRef] [Green Version]
- Shah, I.; Al-Dabbagh, B.; Gariballa, S.; Al-Menhali, A.; Muhammad, N.; Yasin, J.; Ashraf, S.S. Application of a New Vitamin D Blood Test on the Emirati Population. J. Steroid Biochem. Mol. Biol. 2018, 180, 118–128. [Google Scholar] [CrossRef]
- Amrein, K.; Scherkl, M.; Hoffmann, M.; Neuwersch-Sommeregger, S.; Köstenberger, M.; Tmava Berisha, A.; Martucci, G.; Pilz, S.; Malle, O. Vitamin D Deficiency 2.0: An Update on the Current Status Worldwide. Eur. J. Clin. Nutr. 2020, 74, 1498–1513. [Google Scholar] [CrossRef]
- Glendenning, P.; Taranto, M.; Noble, J.M.; Musk, A.A.; Hammond, C.; Goldswain, P.R.; Fraser, W.D.; Vasikaran, S.D. Current Assays Overestimate 25-Hydroxyvitamin D3 and Underestimate 25-Hydroxyvitamin D2 Compared with HPLC: Need for Assay-Specific Decision Limits and Metabolite-Specific Assays. Ann. Clin. Biochem. 2006, 43, 23–30. [Google Scholar] [CrossRef]
- Karam, S.M.; Leblond, C.P. Dynamics of Epithelial Cells in the Corpus of the Mouse Stomach. I. Identification of Proliferative Cell Types and Pinpointing of the Stem Cell. Anat. Rec. 1993, 236, 259–279. [Google Scholar] [CrossRef]
- Xiao, S.; Zhou, L. Gastric Stem Cells: Physiological and Pathological Perspectives. Front. Cell Dev. Biol. 2020, 8, 571536. [Google Scholar] [CrossRef]
- Engevik, A.C.; Kaji, I.; Goldenring, J.R. The Physiology of the Gastric Parietal Cell. Physiol. Rev. 2020, 100, 573–602. [Google Scholar] [CrossRef]
- Smith, M.E.; Morton, D.G. 3—The Stomach: Basic Functions. In The Digestive System, 2nd ed.; Smith, M.E., Morton, D.G., Eds.; Churchill Livingstone: London, UK, 2010; pp. 39–50. ISBN 978-0-7020-3367-4. [Google Scholar]
- Yao, X.; Smolka, A.J. Gastric Parietal Cell Physiology and Helicobacter Pylori-Induced Disease. Gastroenterology 2019, 156, 2158–2173. [Google Scholar] [CrossRef] [Green Version]
- Ogias, D.; Rattes, I.C.; Hosoya, L.Y.M.; Zulian, J.G.; Yan, C.Y.I.; Gama, P. Neonatal-Maternal Separation Primes Zymogenic Cells in the Rat Gastric Mucosa through Glucocorticoid Receptor Activity. Sci. Rep. 2018, 8, 9823. [Google Scholar] [CrossRef] [Green Version]
- Willet, S.G.; Mills, J.C. Stomach Organ and Cell Lineage Differentiation: From Embryogenesis to Adult Homeostasis. Cell Mol. Gastroenterol. Hepatol. 2016, 2, 546–559. [Google Scholar] [CrossRef] [Green Version]
- Gómez-Santos, L.; Alonso, E.; Díaz-Flores, L.; Madrid, J.F.; Sáez, F.J. Transdifferentiation of Mucous Neck Cells into Chief Cells in Fundic Gastric Glands Shown by GNA Lectin Histochemistry. Tissue Cell 2017, 49, 746–750. [Google Scholar] [CrossRef]
- Sun, J. Vitamin D and Mucosal Immune Function. Curr. Opin. Gastroenterol. 2010, 26, 591–595. [Google Scholar] [CrossRef] [Green Version]
- Uberti, F.; Bardelli, C.; Morsanuto, V.; Ghirlanda, S.; Molinari, C. Role of Vitamin D3 Combined to Alginates in Preventing Acid and Oxidative Injury in Cultured Gastric Epithelial Cells. BMC Gastroenterol. 2016, 16, 127. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Ooms, N.; van Daal, H.; Beijers, A.M.; Gerrits, G.P.J.M.; Semmekrot, B.A.; van den Ouweland, J.M.W. Time-Course Analysis of 3-Epi-25-Hydroxyvitamin D3 Shows Markedly Elevated Levels in Early Life, Particularly from Vitamin D Supplementation in Preterm Infants. Pediatr. Res. 2016, 79, 647–653. [Google Scholar] [CrossRef] [Green Version]
- Karras, S.N.; Fakhoury, H.; Muscogiuri, G.; Grant, W.B.; van den Ouweland, J.M.; Colao, A.M.; Kotsa, K. Maternal Vitamin D Levels during Pregnancy and Neonatal Health: Evidence to Date and Clinical Implications. Ther. Adv. Musculoskelet Dis. 2016, 8, 124–135. [Google Scholar] [CrossRef] [Green Version]
- Vranić, L.; Mikolašević, I.; Milić, S. Vitamin D Deficiency: Consequence or Cause of Obesity? Medicina 2019, 55, 541. [Google Scholar] [CrossRef] [Green Version]
- Drincic, A.; Fuller, E.; Heaney, R.P.; Armas, L.A.G. 25-Hydroxyvitamin D Response to Graded Vitamin D₃ Supplementation among Obese Adults. J. Clin. Endocrinol. Metab. 2013, 98, 4845–4851. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Seldeen, K.L.; Pang, M.; Rodríguez-Gonzalez, M.; Hernandez, M.; Sheridan, Z.; Yu, P.; Troen, B.R. A Mouse Model of Vitamin D Insufficiency: Is There a Relationship between 25(OH) Vitamin D Levels and Obesity? Nutr. Metab. 2017, 14, 26. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Mansoor, K.M.K.; Iqbal, S.; Nowshad, N.; Abdelmannan, D. Interplay between Vitamin D, Obesity, and Other Metabolic Factors in a Multiethnic Adult Cohort. Dubai Diabetes Endocrinol. J. 2020, 26, 152–157. [Google Scholar] [CrossRef]
- Bonnet, L.; Karkeni, E.; Couturier, C.; Astier, J.; Defoort, C.; Svilar, L.; Tourniaire, F.; Mounien, L.; Landrier, J.-F. Four Days High Fat Diet Modulates Vitamin D Metabolite Levels and Enzymes in Mice. J. Endocrinol. 2021, 248, 87–93. [Google Scholar] [CrossRef]
- Den Brink, G.R.V.; Tytgat, K.M.A.J.; van der Hulst, R.W.M.; van der Loos, C.M.; Einerhand, A.W.C.; Büller, H.A.; Dekker, J. H Pylori Colocalises with MUC5AC in the Human Stomach. Gut 2000, 46, 601–607. [Google Scholar] [CrossRef]
- Burclaff, J.; Willet, S.G.; Sáenz, J.B.; Mills, J.C. Proliferation and Differentiation of Gastric Mucous Neck and Chief Cells During Homeostasis and Injury-Induced Metaplasia. Gastroenterology 2020, 158, 598–609. [Google Scholar] [CrossRef]
- Karam, S.M.; Leblond, C.P. Dynamics of Epithelial Cells in the Corpus of the Mouse Stomach. III. Inward Migration of Neck Cells Followed by Progressive Transformation into Zymogenic Cells. Anat. Rec. 1993, 236, 297–313. [Google Scholar] [CrossRef]
- Fernández-Barral, A.; Costales-Carrera, A.; Buira, S.P.; Jung, P.; Ferrer-Mayorga, G.; Larriba, M.J.; Bustamante-Madrid, P.; Domínguez, O.; Real, F.X.; Guerra-Pastrián, L.; et al. Vitamin D Differentially Regulates Colon Stem Cells in Patient-Derived Normal and Tumor Organoids. FEBS J. 2020, 287, 53–72. [Google Scholar] [CrossRef] [Green Version]
- Ahearn, T.U.; McCullough, M.L.; Flanders, W.D.; Long, Q.; Sidelnikov, E.; Fedirko, V.; Daniel, C.R.; Rutherford, R.E.; Shaukat, A.; Bostick, R.M. A Randomized Clinical Trial of the Effects of Supplemental Calcium and Vitamin D3 on Markers of Their Metabolism in Normal Mucosa of Colorectal Adenoma Patients. Cancer Res. 2011, 71, 413–423. [Google Scholar] [CrossRef] [Green Version]
- Bouillon, R.; Marcocci, C.; Carmeliet, G.; Bikle, D.; White, J.H.; Dawson-Hughes, B.; Lips, P.; Munns, C.F.; Lazaretti-Castro, M.; Giustina, A.; et al. Skeletal and Extraskeletal Actions of Vitamin D: Current Evidence and Outstanding Questions. Endocr. Rev. 2019, 40, 1109–1151. [Google Scholar] [CrossRef] [Green Version]
- Ng, K.Y.; Ma, M.T.; Leung, K.K.; Leung, P.S. Vitamin D and Vitamin A Receptor Expression and the Proliferative Effects of Ligand Activation of These Receptors on the Development of Pancreatic Progenitor Cells Derived from Human Fetal Pancreas. Stem Cell Rev. Rep. 2011, 7, 53–63. [Google Scholar] [CrossRef]
- Jeong, Y.; Swami, S.; Krishnan, A.V.; Williams, J.D.; Martin, S.; Horst, R.L.; Albertelli, M.A.; Feldman, B.J.; Feldman, D.; Diehn, M. Inhibition of Mouse Breast Tumor Initiating Cells by Calcitriol and Dietary Vitamin D. Mol. Cancer Ther. 2015, 14, 1951–1961. [Google Scholar] [CrossRef] [Green Version]
- Tabasi, N.; Rastin, M.; Mahmoudi, M.; Ghoryani, M.; Mirfeizi, Z.; Rabe, S.Z.T.; Reihani, H. Influence of Vitamin D on Cell Cycle, Apoptosis, and Some Apoptosis Related Molecules in Systemic Lupus Erythematosus. Iran J. Basic Med. Sci. 2015, 18, 1107–1111. [Google Scholar]
- Zheng, Y.; Trivedi, T.; Lin, R.C.; Fong-Yee, C.; Nolte, R.; Manibo, J.; Chen, Y.; Hossain, M.; Horas, K.; Dunstan, C.; et al. Loss of the Vitamin D Receptor in Human Breast and Prostate Cancers Strongly Induces Cell Apoptosis through Downregulation of Wnt/β-Catenin Signaling. Bone Res. 2017, 5, 17023. [Google Scholar] [CrossRef]
- Kato, S. The Function of Vitamin D Receptor in Vitamin D Action. J. Biochem. 2000, 127, 717–722. [Google Scholar] [CrossRef]
- Khanal, R.C.; Nemere, I. The ERp57/GRp58/1,25D3-MARRS Receptor: Multiple Functional Roles in Diverse Cell Systems. Curr. Med. Chem. 2007, 14, 1087–1093. [Google Scholar] [CrossRef]
- Ocklenburg, T.; Neumann, F.; Wolf, A.; Vogel, J.; Göpelt, K.; Baumann, M.; Baumann, J.; Kranz, P.; Metzen, E.; Brockmeier, U. In Oxygen-Deprived Tumor Cells ERp57 Provides Radioprotection and Ensures Proliferation via c-Myc, PLK1 and the AKT Pathway. Sci. Rep. 2021, 11, 7199. [Google Scholar] [CrossRef]
- Hettinghouse, A.; Liu, R.; Liu, C.-J. Multifunctional Molecule ERp57: From Cancer to Neurodegenerative Diseases. Pharmacol. Ther. 2018, 181, 34–48. [Google Scholar] [CrossRef]
- Oliver, J.D.; Roderick, H.L.; Llewellyn, D.H.; High, S. ERp57 Functions as a Subunit of Specific Complexes Formed with the ER Lectins Calreticulin and Calnexin. Mol. Biol. Cell 1999, 10, 2573–2582. [Google Scholar] [CrossRef] [Green Version]
- Turano, C.; Gaucci, E.; Grillo, C.; Chichiarelli, S. ERp57/GRP58: A Protein with Multiple Functions. Cell Mol. Biol. Lett. 2011, 16, 539–563. [Google Scholar] [CrossRef] [PubMed]
- Sun, Q.; Gao, Y.; Qiao, L.; Yuan, Y.; Liu, Q. 25(OH)-Vitamin D Alleviates Neonatal Infectious Pneumonia via Regulating TGFβ-Mediated Nuclear Translocation Mechanism of YAP/TAZ. Bioengineered 2021, 12, 8931–8942. [Google Scholar] [CrossRef] [PubMed]
- Sana, S.; Kayani, M.A. Role of Vitamin D Deficiency and MRNA Expression of VDR and RXR in Haematological Cancers. Mol. Biol. Rep. 2021, 48, 4431–4439. [Google Scholar] [CrossRef] [PubMed]
- Chen, J.; Lobachev, K.S.; Grindel, B.J.; Farach-Carson, M.C.; Hyzy, S.L.; El-Baradie, K.B.; Olivares-Navarrete, R.; Doroudi, M.; Boyan, B.D.; Schwartz, Z. Chaperone Properties of Pdia3 Participate in Rapid Membrane Actions of 1α,25-Dihydroxyvitamin D3. Mol. Endocrinol. 2013, 27, 1065–1077. [Google Scholar] [CrossRef] [Green Version]
- Lee, S.M.; Pike, J.W. The Vitamin D Receptor Functions as a Transcription Regulator in the Absence of 1,25-Dihydroxyvitamin D3. J. Steroid Biochem. Mol. Biol. 2016, 164, 265–270. [Google Scholar] [CrossRef] [Green Version]
- Wang, G.; Lei, L.; Zhao, X.; Zhang, J.; Zhou, M.; Nan, K. Calcitriol Inhibits Cervical Cancer Cell Proliferation Through Downregulation of HCCR1 Expression. Oncol. Res. 2015, 22, 301–309. [Google Scholar] [CrossRef]
- Chojnacki, C.; Wiśniewska-Jarosińska, M.; Kulig, G.; Majsterek, I.; Reiter, R.J.; Chojnacki, J. Evaluation of Enterochromaffin Cells and Melatonin Secretion Exponents in Ulcerative Colitis. World J. Gastroenterol. 2013, 19, 3602–3607. [Google Scholar] [CrossRef]
- Chojnacki, C.; Popławski, T.; Blasiak, J.; Chojnacki, J.; Reiter, R.J.; Klupinska, G. Expression of Melatonin Synthesizing Enzymes in Helicobacter Pylori Infected Gastric Mucosa. Biomed Res. Int. 2013, 2013, 845032. [Google Scholar] [CrossRef] [Green Version]
- Namikawa, T.; Araki, K.; Ogata, T. Localization of Cytoskeletal Filaments during Membrane Rearrangement in Rat Parietal Cells Stimulated with Gastrin. Arch. Histol. Cytol. 1998, 61, 47–56. [Google Scholar] [CrossRef] [Green Version]
- Zhu, L.; Liu, Y.; Forte, J.G. Ezrin Oligomers Are the Membrane-Bound Dormant Form in Gastric Parietal Cells. Am. J. Physiol.-Cell Physiol. 2005, 288, C1242–C1254. [Google Scholar] [CrossRef] [Green Version]
- Sohail, A.; Al Menhali, A.; Hisaindee, S.; Shah, I. An LC-MS/MS Method for Analysis of Vitamin D Metabolites and C3 Epimers in Mice Serum: Oral Supplementation Compared to UV Irradiation. Molecules 2021, 26, 5182. [Google Scholar] [CrossRef]
- Al Menhali, A.; Keeley, T.M.; Demitrack, E.S.; Samuelson, L.C. Gastrin Induces Parathyroid Hormone-like Hormone Expression in Gastric Parietal Cells. Am. J. Physiol. Gastrointest. Liver Physiol. 2017, 312, G649–G657. [Google Scholar] [CrossRef] [Green Version]
- Jain, R.N.; Brunkan, C.S.; Chew, C.S.; Samuelson, L.C. Gene Expression Profiling of Gastrin Target Genes in Parietal Cells. Physiol. Genom. 2006, 24, 124–132. [Google Scholar] [CrossRef] [Green Version]
- Primer-Blast Results. Available online: https://www.ncbi.nlm.nih.gov/tools/primer-blast/primertool.cgi?ctg_time=1652269015&job_key=q6F0QKlUpPyDxjTDOaMQ8UO4AcNuqxrebw (accessed on 11 May 2022).
- Lynch, I.J.; Rudin, A.; Xia, S.-L.; Stow, L.R.; Shull, G.E.; Weiner, I.D.; Cain, B.D.; Wingo, C.S. Impaired Acid Secretion in Cortical Collecting Duct Intercalated Cells from H-K-ATPase-Deficient Mice: Role of HKα Isoforms. Am. J. Physiol.-Ren. Physiol. 2008, 294, F621–F627. [Google Scholar] [CrossRef] [Green Version]
- Černyšiov, V.; Mauricas, M.; Girkontaite, I. Melatonin Inhibits Granulocyte Adhesion to ICAM via MT3/QR2 and MT2 Receptors. Int. Immunol. 2015, 27, 599–608. [Google Scholar] [CrossRef] [Green Version]
- Hagerling, C.; Owyong, M.; Sitarama, V.; Wang, C.-Y.; Lin, C.; van den Bijgaart, R.J.E.; Koopman, C.D.; Brenot, A.; Nanjaraj, A.; Wärnberg, F.; et al. LGR5 in Breast Cancer and Ductal Carcinoma in Situ: A Diagnostic and Prognostic Biomarker and a Therapeutic Target. BMC Cancer 2020, 20, 542. [Google Scholar] [CrossRef]
- Bower, J.; Fast, D.; Garofolo, F.; Gouty, D.; Hayes, R.; Lowes, S.; Nicholson, R.; LeLacheur, R.; Bravo, J.; Shoup, R.; et al. 8th GCC: Consolidated Feedback to US FDA on the 2013 Draft FDA Guidance on Bioanalytical Method Validation. Bioanalysis 2014, 6, 2957–2963. [Google Scholar] [CrossRef]
- Jain, R.N.; Al-Menhali, A.A.; Keeley, T.M.; Ren, J.; El-Zaatari, M.; Chen, X.; Merchant, J.L.; Ross, T.S.; Chew, C.S.; Samuelson, L.C. Hip1r Is Expressed in Gastric Parietal Cells and Is Required for Tubulovesicle Formation and Cell Survival in Mice. J. Clin. Investig. 2008, 118, 2459–2470. [Google Scholar] [CrossRef] [Green Version]
Genes Studied | 2^(−DDCt) ± SD | ||
---|---|---|---|
SDL | SDD | VDD | |
Chga | 1.49 ± 1.10 | 1.42 ± 2.2 | 2.28 ± 2.02 |
Gast | 1.47 ± 1.47 | 1.55 ± 2.06 | 0.22 ± 0.81 (p < 0.05) |
Ghrl | 0.95 ± 0.40 | 2.58 ± 1.02 (p ≤ 0.01) | 0.44 ± 0.36 |
Hdc | 1.16 ± 0.74 | 3.79 ± 8.144 | 0.18 ± 0.17 |
Mt1 | 1.53 ± 1.66 | 156.25 ± 240.62 (p < 0.05) | 13.21 ± 22.20 |
Mt2 | 2.33 ± 4.17 | 195.64 ± 304.58 (p < 0.05) | 1.9 ± 2.02 |
Genes Studied | 2^(−DDCt) ± SD | ||
---|---|---|---|
SDL | SDD | VDD | |
Cav1 | 2.37 ± 4.5 | 4.23 ± 5.17 | 3.76 ± 8.55 |
Src | 1.05 ± 0.43 | 0.76 ± 0.6 | 0.56 ± 0.54 |
p21 | 7.23 ± 13.40 | 560.72 ± 994.18 | 56,925.58 ± 26,196.44 (p ≤ 0.0001) |
Trpv6 | 1.47 ± 1.56 | 26.21 ± 9.12 (p ≤ 0.0001) | 6.78 ± 1.76 |
Pthlh | 1.84 ± 1.48 | 20.16 ± 25.65 | 0.32 ± 0.39 |
Pthr1 | 1.09 ± 0.46 | 8.74 ± 7.06 (p ≤ 0.01) | 3.12 ± 1.56 |
No. | Analytes | Retention Time (min) | Precursor | Product | Collision Energy (eV) |
---|---|---|---|---|---|
(m/z) | (m/z) | ||||
1 | 1,25(OH)2D3 | 3.82 | 399.1 | 381.3 * | −14 |
2 | 1,25(OH)2D2 | 3.948 | 411.1 | 135.3 * | −13 |
133.1 | −12 | ||||
3 | 25(OH)D3 | 6.98 | 383.2 | 365.3 * | −15 |
107.1 | −30 | ||||
4 | 25(OH)D2 | 7.76 | 395.1 | 377.3 * | −17 |
81.1 | −38 | ||||
5 | 3-epi-25(OH)D3 | 7.69 | 383.2 | 365.3 * | −15 |
107.1 | −30 | ||||
6 | 3-epi-25(OH)D2 | 8.52 | 395.1 | 377.1 * | −17 |
81.1 | −38 | ||||
7 | Vitamin-D3 | 15.104 | 385 | 367 * | −13 |
259 | −16 | ||||
91 | −56 | ||||
8 | Vitamin-D2 | 15.072 | 397.1 | 379.4 * | −17 |
69 | −19 | ||||
9 | 7αC4 | 14.48 | 401.5 | 383.25 | −16 |
97.1 * | −29 | ||||
91.2 | −23 | ||||
10 | [25 hydroxyvitamin-D3 (6,19,19-d3)] | 6.98 | 386.3 | 368.2 | −15 |
257.2 * | −183 | ||||
95.2 | −35 |
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations. |
© 2022 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Sirajudeen, S.; Shah, I.; Ayoub, M.A.; Karam, S.M.; Al Menhali, A. Long-Term Vitamin D Deficiency Results in the Inhibition of Cell Proliferation and Alteration of Multiple Gastric Epithelial Cell Lineages in Mice. Int. J. Mol. Sci. 2022, 23, 6684. https://doi.org/10.3390/ijms23126684
Sirajudeen S, Shah I, Ayoub MA, Karam SM, Al Menhali A. Long-Term Vitamin D Deficiency Results in the Inhibition of Cell Proliferation and Alteration of Multiple Gastric Epithelial Cell Lineages in Mice. International Journal of Molecular Sciences. 2022; 23(12):6684. https://doi.org/10.3390/ijms23126684
Chicago/Turabian StyleSirajudeen, Shaima, Iltaf Shah, Mohammed Akli Ayoub, Sherif M. Karam, and Asma Al Menhali. 2022. "Long-Term Vitamin D Deficiency Results in the Inhibition of Cell Proliferation and Alteration of Multiple Gastric Epithelial Cell Lineages in Mice" International Journal of Molecular Sciences 23, no. 12: 6684. https://doi.org/10.3390/ijms23126684