Effect of Compressive Stress in Tumor Microenvironment on Malignant Tumor Spheroid Invasion Process
Abstract
:1. Introduction
2. Materials and Methods
2.1. Fabrication of Tumor Spheroids Confined in Agarose Gels
2.2. Imposing External Compressive Stress on Tumor Spheroids by Mechanical Loading of Agarose Gel
2.3. Morphometric Analysis of Tumor Spheroids
2.4. Numerical Analysis of Growth-Induced Compressive Force on the Spheroids
2.5. RT-PCR Analysis
2.6. Statistical Analysis
3. Results
3.1. Effect of Hydrogel Stiffness on Invasion Process of Tumor Spheroid
3.2. Relationships between Spheroid Growth and Growth-Induced Compressive Force from Surrounding Hydrogel
3.3. Effect of External Compressive Force on Growth of Spheroids
3.4. Attenuation of Gene Expression of Tumor Spheroids in Hydrogels
4. Discussion
5. Conclusions
Supplementary Materials
Author Contributions
Funding
Informed Consent Statement
Data Availability Statement
Conflicts of Interest
References
- Rawla, P.; Sunkara, T.; Barsouk, A. Epidemiology of colorectal cancer: Incidence, mortality, survival, and risk factors. Przegla̜d Gastroenterol. 2019, 14, 89–103. [Google Scholar] [CrossRef] [PubMed]
- Gjorevski, N.; Boghaert, E.; Nelson, C.M. Regulation of Epithelial-Mesenchymal Transition by Transmission of Mechanical Stress through Epithelial Tissues. Cancer Microenviron. 2012, 5, 29–38. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Stylianopoulos, T.; Martin, J.D.; Chauhan, V.P.; Jain, S.R.; Diop-Frimpong, B.; Bardeesy, N.; Smith, B.L.; Ferrone, C.R.; Hornicek, F.J.; Boucher, Y.; et al. Causes, consequences, and remedies for growth-induced solid stress in murine and human tumors. Proc. Natl. Acad. Sci. USA 2012, 109, 15101–15108. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Northcott, J.M.; Dean, I.S.; Mouw, J.K.; Weaver, V.M. Feeling Stress: The Mechanics of Cancer Progression and Aggression. Front. Cell Dev. Biol. 2018, 6, 17. [Google Scholar] [CrossRef] [PubMed]
- Liu, C.; Pei, H.; Tan, F. Matrix Stiffness and Colorectal Cancer. OncoTargets Ther. 2020, 13, 2747–2755. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Ciasca, G.; Papi, M.; Minelli, E.; Palmieri, V.; De Spirito, M. Changes in cellular mechanical properties during onset or progression of colorectal cancer. World J. Gastroenterol. 2016, 22, 7203–7214. [Google Scholar] [CrossRef] [PubMed]
- Taubenberger, A.V.; Bray, L.J.; Haller, B.; Shaposhnykov, A.; Binner, M.; Freudenberg, U.; Guck, J.; Werner, C. 3D extracellular matrix interactions modulate tumour cell growth, invasion and angiogenesis in engineered tumour microenvironments. Acta Biomater. 2016, 36, 73–85. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Mahajan, V.; Beck, T.; Gregorczyk, P.; Ruland, A.; Alberti, S.; Guck, J.; Werner, C.; Schlüßler, R.; Taubenberger, A.V. Mapping Tumor Spheroid Mechanics in Dependence of 3D Microenvironment Stiffness and Degradability by Brillouin Microscopy. Cancers 2021, 13, 5549. [Google Scholar] [CrossRef] [PubMed]
- Morikura, T.; Miyata, S. Effect of Mechanical Compression on Invasion Process of Malignant Melanoma Using In Vitro Three-Dimensional Cell Culture Device. Micromachines 2019, 10, 666. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Morikura, T.; Miyata, S. Mechanical Intermittent Compression Affects the Progression Rate of Malignant Melanoma Cells in a Cycle Period-Dependent Manner. Diagnostics 2021, 11, 1112. [Google Scholar] [CrossRef] [PubMed]
- Subhash, G.; Liu, Q.; Moore, D.F.; Ifju, P.G.; Haile, M.A. Concentration Dependence of Tensile Behavior in Agarose Gel Using Digital Image Correlation. Exp. Mech. 2010, 51, 255–262. [Google Scholar] [CrossRef]
- Yokokura, T.; Nakashima, Y.; Yonemoto, Y.; Hikichi, Y.; Nakanishi, Y. Method for measuring Young’s modulus of cells using a cell compression microdevice. Int. J. Eng. Sci. 2017, 114, 41–48. [Google Scholar] [CrossRef]
- Trickey, W.R.; Baaijens, F.P.; Laursen, T.; Alexopoulos, L.G.; Guilak, F. Determination of the Poisson’s ratio of the cell: Recovery properties of chondrocytes after release from complete micropipette aspiration. J. Biomech. 2006, 39, 78–87. [Google Scholar] [CrossRef] [PubMed]
- Tanaka, S.; Kobayashi, W.; Haraguchi, M.; Ishihata, K.; Nakamura, N.; Ozawa, M. Snail1 expression in human colon cancer DLD-1 cells confers invasive properties without N-cadherin expression. Biochem. Biophys. Rep. 2016, 8, 120–126. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Taubenberger, A.V.; Girardo, S.; Träber, N.; Fischer-Friedrich, E.; Kräter, M.; Wagner, K.; Kurth, T.; Richter, I.; Haller, B.; Binner, B.; et al. 3D Microenvironment Stiffness Regulates Tumor Spheroid Growth and Mechanics via p21 and ROCK. Adv. Biosyst. 2019, 3, 1900128. [Google Scholar] [CrossRef] [PubMed]
- Helmlinger, G.; Netti, P.; Lichtenbeld, H.C.; Melder, R.J.; Jain, R.K. Solid stress inhibits the growth of multicellular tumor spheroids. Nat. Biotechnol. 1997, 15, 778–783. [Google Scholar] [CrossRef] [PubMed]
- Kalli, M.; Stylianopoulos, T. Defining the Role of Solid Stress and Matrix Stiffness in Cancer Cell Proliferation and Metastasis. Front. Oncol. 2018, 8, 55. [Google Scholar] [CrossRef] [PubMed]
- Shen, Y.; Wang, X.; Lu, J.; Salfenmoser, M.; Wirsik, N.M.; Schleussner, N.; Imle, A.; Valls, A.F.; Radhakrishnan, P.; Liang, J.; et al. Reduction of Liver Metastasis Stiffness Improves Response to Bevacizumab in Metastatic Colorectal Cancer. Cancer Cell 2020, 37, 800–817.e7. [Google Scholar] [CrossRef] [PubMed]
- Kulwatno, J.; Gearhart, J.; Gong, X.; Herzog, N.; Getzin, M.; Skobe, M.; Mills, K.L. Growth of tumor emboli within a vessel model reveals dependence on the magnitude of mechanical constraint. Integr. Biol. 2021, 13, 1–16. [Google Scholar] [CrossRef] [PubMed]
- Nia, H.; Datta, M.; Seano, G.; Huang, P.; Munn, L.L.; Jain, R.K. Quantifying solid stress and elastic energy from excised or in situ tumors. Nat. Protoc. 2018, 13, 1091–1105. [Google Scholar] [CrossRef] [PubMed]
Agarose | Young’s Modulus (kPa) | Poison Ratio (–) | Mass Concentration (kg/m3) |
---|---|---|---|
0.5 | 2.71 | 0.5 | 1.0 × 103 |
0.75 | 3.58 | ||
1.0 | 9.93 | ||
1.5 | 18.2 | ||
2.0 | 34.5 |
Gene Name | Gene Bank Number | Sequence(5′–3′) |
---|---|---|
Col1a2 | NM_000089.4 | Forward GAGGGCAACAGCAGGTTCACTTA |
Reverse GCACCGTCAAGGCTGAGAAC | ||
Gapdh | NM_002046.7 | Forward TCAGCACCACCGATGTCCA |
Reverse TGGTGAAGACGCCAGTGGA |
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations. |
© 2022 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Nishi, R.; Oda, Y.; Morikura, T.; Miyata, S. Effect of Compressive Stress in Tumor Microenvironment on Malignant Tumor Spheroid Invasion Process. Int. J. Mol. Sci. 2022, 23, 7091. https://doi.org/10.3390/ijms23137091
Nishi R, Oda Y, Morikura T, Miyata S. Effect of Compressive Stress in Tumor Microenvironment on Malignant Tumor Spheroid Invasion Process. International Journal of Molecular Sciences. 2022; 23(13):7091. https://doi.org/10.3390/ijms23137091
Chicago/Turabian StyleNishi, Ryota, Yudai Oda, Takashi Morikura, and Shogo Miyata. 2022. "Effect of Compressive Stress in Tumor Microenvironment on Malignant Tumor Spheroid Invasion Process" International Journal of Molecular Sciences 23, no. 13: 7091. https://doi.org/10.3390/ijms23137091