Effect of the Size of Titanium Particles Released from Dental Implants on Immunological Response
Abstract
:1. Introduction
2. Results
3. Discussion
4. Materials and Methods
4.1. Dental Implants
4.2. Specific Surface Area
4.3. Granulometry
4.4. Scanning Electron Microscopy
4.5. Ion Release
4.6. Preparation of Samples for Cell Cultures
4.7. Cytotoxicity Assay
4.8. Gene Expression Analysis
4.9. Cytokine Release Analysis
4.10. Statistical Analysis
5. Conclusions
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Conflicts of Interest
References
- Adell, R.; Lekholm, U.; Rockler, B.; Brånemark, P.I. A 15-year study of osseointegrated implants in the treatment of the edentulous jaw. Int. J. Oral Surg. 1981, 10, 387–416. [Google Scholar]
- Albrektsson, T.; Zarb, G.; Worthington, P.; Eriksson, A.R. The long-term efficacy of currently used dental implants: A review and proposed criteria of success. Int. J. Oral Maxillofac. Implant. 1986, 1, 11–25. [Google Scholar]
- Velasco-Ortega, E.; Ortiz-Garcia, I.; Jiménez-Guerra, A.; Núñez-Márquez, E.; Moreno-Muñoz, J.; Luis Rondón-Romero, J.L.; Cabanillas-Balsera, D.; Gil, J.; Muñoz-Guzón, F.; Monsalve-Guil, L. Osseointegration of sandblasted and acid-etched implant surfaces. A histological and histomorphometric study in the rabbit. Int. J. Mol. Sci. 2021, 22, 8507. [Google Scholar] [CrossRef]
- Herrero-Climent, M.; López-Jarana, P.; Lemos, B.F.; Gil, F.J.; Falcao, C.; Rios-Santos, J.V.; Rios-Carrasco, B. Relevant design aspects to improve the stability of titanium dental implants. Materials 2020, 13, 1910. [Google Scholar] [CrossRef] [Green Version]
- Zhou, Z.; Shi, Q.; Wang, J.; Chen, X.; Hao, Y.; Zhang, Y.; Wang, X. The unfavorable role of titanium particles released from dental implants. Nanotheranostics 2021, 5, 321–332. [Google Scholar] [CrossRef]
- Eger, M.; Sterer, N.; Liron, T.; Kohavi, D.; Gabet, Y. Scaling of titanium implants entrains inflammation-induced osteolysis. Sci. Rep. 2017, 7, 39612. [Google Scholar]
- Xu, J.; Aoki, H.; Kasugai, S.; Otsuka, M. Enhancement of mineralization on porous titanium surface by filling with nano-hydroxyapatite particles fabricated with a vacuum spray method. Mater. Sci. Eng. C Mater. Biol. Appl. 2020, 111, 110772. [Google Scholar]
- Berryman, Z.; Bridger, L.; Hussaini, H.M.; Rich, A.M.; Atieh, M.; Tawse-Smith, A. Titanium particles: An emerging risk factor for peri-implant bone loss. Saudi Dent. J. 2020, 32, 283–292. [Google Scholar]
- He, X.; Reichl, F.-X.; Wang, Y.; Michalke, B.; Milz, S.; Yang, Y.; Stolper, P.; Lindemaier, G.; Graw, M.; Hickel, R.; et al. Analysis of titanium and other metals in human jawbones with dental implants—A case series study. Dent. Mater. 2016, 32, 1042–1051. [Google Scholar]
- Heringa, M.B.; Peters, R.J.B.; Bleys, R.L.A.W.; Van Der Lee, M.K.; Tromp, P.C.; Van Kesteren, P.C.E.; Van Eijkeren, J.C.H.; Undas, A.; Oomen, A.G.; Bouwmeester, H. Detection of titanium particles in human liver and spleen and possible health implications. Part. Fibre Toxicol. 2018, 15, 15. [Google Scholar]
- Vara, J.C.; Delgado, J.; Estrada-Martínez, A.; Pérez-Pevida, E.; Brizuela, A.; Bosch, B.; Pérez, R.; Gil, J. Effect of the Nature of the Particles Released from Bone Level Dental Implants: Physicochemical and Biological Characterization. Coatings 2022, 12, 219. [Google Scholar] [CrossRef]
- Velasco, E.; Monsalve-Guil, L.; Jimenez, A.; Ortiz, I.; Moreno-Muñoz, J.; Nuñez-Marquez, E.; Pegueroles, M.; Perez, R.; Gil, F.J. Importance of the Roughness and Residual Stresses of Dental Implants on Fatigue and Osseointegration Behavior. In Vivo Study in Rabbits. J. Oral Implant. 2016, 42, 469–476. [Google Scholar]
- Wu, X.; Cai, C.; Gil, J.; Jantz, E.; Al Sakka, Y.; Padial-Molina, M.; Suárez-López del Amo, F. Characteristics of Particles and Debris Released after Implantoplasty: A Comparative Study. Materials 2022, 15, 602. [Google Scholar] [CrossRef]
- Toledano-Serrabona, J.; Gil, F.J.; Camps-Font, O.; Valmaseda-Castellon, E.; Gay-Escoda, C.; Sánchez-Garcés, M.A. Physicochemical and Biological Characterization of Ti6Al4V particles obtained by Implantoplasty: An In vivo study. Part I. Materials 2021, 14, 6507. [Google Scholar] [CrossRef]
- Toledano-Serrabona, J.; Sánchez-Garcés, M.A.; Gay-Escoda, C.; Valmaseda-Castellon, E.; Camps-Font, O.; Verdeguer, P.; Molmeneu, M.; Gil, F.J. Mechanical properties and corrosión behavior of Ti6Al4V particles obtained by Implatoplasty. An in vivo study. Part II. Materials 2021, 14, 6519. [Google Scholar] [CrossRef]
- Barrak, F.N.; Li, S.; Muntane, A.M.; Jones, J.R. Particle release from implantoplasty of dental implants and impact on cells. Int. J. Implant. Dent. 2020, 6, 50. [Google Scholar] [CrossRef]
- Soto-Alvaredo, J.; Blanco, E.; Bettmer, J.; Hevia, D.; Sainz, R.M.; López Cháves, C.; Sánchez, C.; Llopis, J.; Sanz-Medel, J.; Montes-Bayón, M. Evaluation of the biological effect of Ti generated debris from metal implants: Ions and nanoparticles. Metallomics 2014, 6, 1702–1708. [Google Scholar] [CrossRef]
- Xiao, G.; Song, K.; He, Y.; Wang, W.; Zhang, Y.; Dai, W. Prediction and experimental research of abrasive belt grinding residual stress for titanium alloy based on analytical method. Int. J. Adv. Manuf. Technol. 2021, 115, 1111–1125. [Google Scholar] [CrossRef]
- Aparicio, C.; Gil, F.J.; Fonseca, C.; Barbosa, M.; Planell, J.A. Corrosion behaviour of commercially pure tianium shot blasted with different materials and sizes of shot particles for dental implant applications. Biomaterials 2003, 24, 263–273. [Google Scholar]
- Suárez-López del Amo, F.; Rudek, I.; Wagner, V.P.; Martins, M.D.; O’Valle, F.; Galindo-Moreno, P.; Giannobile, W.V.; Wang, H.L.; Castilho, R.M. Titanium Activates the DNA Damage Response Pathway in Oral Epithelial Cells: A Pilot Study. Int. J. Oral Maxillofac. Implant. 2017, 32, 1413–1420. [Google Scholar]
- Gil, F.J.; Manero, J.M.; Ginebra, M.P.; Planell, J.A. The effect of cooling rate on the cyclic deformation of β−annealed Ti-6Al-4V. Mat.Sci Eng A. 2003, 349, 150–155. [Google Scholar]
- Ramel, C.F.; Lüssi, A.; Özcan, M.; Jung, R.E.; Hämmerle, C.H.F.; Thoma, D.S. Surface roughness of dental implants and treatment time using six different implantoplasty procedures. Clin. Oral Implant. Res. 2016, 27, 776–781. [Google Scholar]
- Ravidà, A.; Siqueira, R.; Saleh, I.; Saleh, M.H.A.; Giannobile, A.; Wang, H.L. Lack of Clinical Benefit of Implantoplasty to Improve Implant Survival Rate. J. Dent. Res. 2020, 27, 0022034520944158. [Google Scholar]
- Gil, F.J.; Rodríguez, D.; Planell, J.A. Grain growth kinetics of pure titanium. Scripta Met. Mat. 1995, 33, 1361–1366. [Google Scholar]
- Callejas, J.A.; Brizuela, A.; Ríos-Carrasco, B.; Gil, J. The Characterization of Titanium Particles Released from Bone-Level Titanium Dental Implants: Effect of the Size of Particles on the Ion Release and Cytotoxicity Behaviour. Materials 2022, 15, 3636. [Google Scholar] [CrossRef]
- Fretwurst, T.; Buzanich, G.; Nahles, S.; Woelber, J.P.; Riesemeier, H.; Nelson, K. Metal elements in tissue with dental peri-implantitis: A pilot study. Clin. Oral Implant. Res. 2016, 27, 1178–1186. [Google Scholar]
- Harrison, R.M.; Yin, J. Particulate matter in the atmosphere: Which particle properties are important for its effects on health? Sci. Total Environ. 2000, 249, 85–101. [Google Scholar]
- Manero, J.M.; Gil, F.J.; Padrós, E.; Planell, J.A. Applications of Environmental Scanning Electron Microscopy (ESEM) in Biomaterials Field. Microsc. Res. Techn. 2003, 61, 469–480. [Google Scholar]
- Nicholson, J.W. Titanium Alloys for Dental Implants: A Review. Prosthesis 2020, 2, 100–116. [Google Scholar]
- Su, Y.H.; Peng, B.Y.; Wang, P.D.; Feng, S.W. Evaluation of the implant stability and the marginal bone level changes during the first three months of dental implant healing process: A prospective clinical study. J. Mech. Behav. Biomed. Mater. 2020, 110, 103899. [Google Scholar] [CrossRef]
- Schwarz, F.; Derks, J.; Monje, A.; Wang, H.-L.L. Peri-implantitis. J. Clin. Periodontol. 2018, 45, S267–S290. [Google Scholar]
- Noronha Oliveira, M.; Schunemann, W.V.H.; Mathew, M.T.; Henriques, B.; Magini, R.S.; Teughels, W.; Souza, J.C.M. Can degradation products released from dental implants affect peri-implant tissues? J. Periodontal Res. 2018, 53, 1–11. [Google Scholar]
- Gil, F.J.; Manzanares, N.; Badet, A.; Aparicio, C.; Ginebra, M.P. Biomimetic treatment on dental implants for short-term bone regeneration. Clin.Oral Inv. 2014, 18, 59–66. [Google Scholar]
- Díez-Tercero, L.; Delgado, L.M.; Bosch-Rué, E.; Perez, R.A. Evaluation of the immunomodulatory effects of cobalt, copper and magnesium ions in a pro inflammatory environment. Sci. Rep. 2021, 11, 11707. [Google Scholar]
- Deng, Y.; Govers, C.; ter Beest, E.; van Dijk, A.J.; Hettinga, K.; Wichers, H.J. A THP-1 Cell Line-Based Exploration of Immune Responses Toward Heat-Treated BLG. Front. Nutr. 2021, 7, 350. [Google Scholar]
- Loeffler, H.; Jonitz-Heincke, A.; Peters, K.; Mueller-Hilke, B.; Fiedler, T.; Bader, R.; Klinder, A. Comparison of Inflammatory Effects in THP-1 Monocytes and Macrophages after Exposure to Metal Ions. Materials 2020, 13, 1150. [Google Scholar]
- Veiseh, O.; Doloff, J.; Ma, M. Size- and shape-dependent foreign body immune response to materials implanted in rodents and non-human primates. Nat. Mater. 2015, 14, 643–651. [Google Scholar] [CrossRef] [Green Version]
- Lakhkar, N.J.; MDay, R.; Kim, H.W.; Ludka, K.; Mordan, N.J.; Salih, V.; Knowles, J.C. Titanium phosphate glass microcarriers induce enhanced osteogenic cell proliferation and human mesenchymal stem cell protein expression. J. Tissue Eng. 2015, 6, 2041731415617741. [Google Scholar] [CrossRef] [Green Version]
- Bressan, E.; Ferroni, L.; Gardin, C.; Bellin, G.; Sbricoli, L.; Sivolella, S.; Brunello, G.; Schwartz-Arad, D.; Mijiritsky, E.; Penarrocha, M.; et al. Metal Nanoparticles Released from Dental Implant Surfaces: Potential Contribution to Chronic Inflammation and Peri-Implant Bone Loss. Materials 2019, 12, 2036. [Google Scholar]
- Cheng, W.; Meng, B. The research of Ti particles on the behavior of mouse bone mesenchymal stem cells in vitro. Chin. J. Oral Implantol. 2010, 15, 51–54. [Google Scholar]
- Lochner, K.; Fritsche, A.; Jonitz, A.; Hansmann, D.; Mueller, P.; Mueller-Hilke, B. The potential role of human osteoblasts for periprosthetic osteolysis following exposure to wear particles. Int. J. Mol. Med. 2011, 28, 1055–1063. [Google Scholar]
- Costa, B.C.; Alves, A.C.; Toptan, F.; Pinto, A.M.; Grenho, L.; Fernandes, M.H. Exposure effects of endotoxin-free titanium-based wear particles to human osteoblasts. J. Mech. Behav. Biomed. Mater. 2019, 95, 143–152. [Google Scholar]
- Happe, A.; Sielker, S.; Hanisch, M.; Jung, S. The Biological Effect of Particulate Titanium Contaminants of Dental Implants on Human Osteoblasts and Gingival Fibroblasts. Int. J. Oral Maxillofac. Implant. 2019, 34, 673–680. [Google Scholar]
- Meng, B.; Yang, X.; Chen, Y.; Zhai, J.; Liang, X. Effect of titanium particles on osteoclast activity in vitro. Mol. Med. Rep. 2010, 3, 1065–1069. [Google Scholar]
- Kongseng, S.; Yoovathaworn, K.; Wongprasert, K.; Chunhabundit, R.; Sukwong, P.; Pissuwan, D. Cytotoxic and inflammatory responses of TiO2 nanoparticles on human peripheral blood mononuclear cells. J. Appl. Toxicol. 2016, 36, 1364–1373. [Google Scholar]
- Wang, B.H.; Liu, C.Y.; Wang, X.Y.; Li, Y. Effect of Ti particles on the surface of dental implants on periodontal ligament stem cells. Beijing J. Stomatol. 2019, 27, 137–142. [Google Scholar]
- Díez-Tercero, L.; Delgado, L.M.; Perez, R.A. Modulation of Macrophage Response by Copper and Magnesium Ions in Combination with Low Concentrations of Dexamethasone. Biomedicines 2022, 10, 764. [Google Scholar]
- Costa-Berenguer, X.; García-García, M.; Sánchez-Torres, A.; Sanz-Alonso, M.; Figueiredo, R.; Valmaseda-Castellón, E. Effect of implantoplasty on fracture resistance and surface roughness of standard diameter dental implants. Clin. Oral Implant. Res. 2018, 29, 46–54. [Google Scholar]
- Sinha, P.; Datar, A.; Jeong, C.; Deng, X.; Chung, Y.G.; Lin, L.C. Surface area determination of porous materials using the Brunauer–Emmett–Teller (BET) method: Limitations and improvements. J. Phys. Chem. C 2019, 123, 20195–20209. [Google Scholar]
- Wataha, J.C.; Lockwood, P.E.; Khajotia, S.S. Effect of pH on element release from dental casting alloys. J. Prosthet. Dent. 1998, 80, 691–698. [Google Scholar] [CrossRef]
- Gil, F.J.; Rodríguez, D.; Planell, J.A.; Cortada, M.; Giner, L.; Costa, S. Galvanic corrosion behaviour of Titanium implants coupled to dental alloys. J. Mat. Sci. Mat. Med. 2000, 11, 287–293. [Google Scholar] [CrossRef]
- Wang, L.H.; Fan, L.J.; Gu, Z.Y. Phenomena and mechanism of bone resorption induced by titanium ion. Int. J. Stomatol. 2009, 36, 441–443. [Google Scholar]
Samples | Average Equivalent Diameter (μm) |
---|---|
Ti-5 μm | 5.9 |
Ti-10 μm | 9.7 |
Ti-15 μm | 14.7 |
Ti-30 μm | 30.3 |
Samples | Specific Surface (m2/g) |
---|---|
Ti-5 μm | 0.5124 ± 0.0234 |
Ti-10 μm | 0.4888 ± 0.0342 |
Ti-15 μm | 0.4702 ± 0.0119 |
Ti-30 μm | 0.2001 ± 0.0589 |
Time/Samples | Ti-5 μm | Ti-10 μm | Ti-15 μm | Ti-30 μm |
---|---|---|---|---|
1 day | 575 ± 12 *° | 525 ± 10 *° | 508 ± 10 **° | 485 ± 15 ***° |
3 days | 715 ± 19 *°° | 701 ±12 *°° | 650 ± 12 **°° | 505 ± 12 ***° |
7 days | 725 ± 21 *°° | 718 ± 23 *°° | 700 ± 23 *°°° | 575 ± 13 **°° |
14 days | 796 ± 10 *°°° | 752 ± 17 **°° | 732 ± 11 **°°° | 612 ± 19 ***°°° |
21 days | 800 ± 18 *°°° | 777 ± 15 **°°° | 755 ± 15 **°°°° | 625 ± 10 ***°°° |
Inflammatory Character | Gene | Forward (Sequence 5′–3′) | Reverse (Sequence 5′–3′) |
---|---|---|---|
Proinflammatory | TNFα | TTCCAGACTTCCTTGAGACACG | AAACATGTCTGAGCCAAGGC |
IL-1β | GACACATGGGATAACGAGGC | ACGCAGGACAGGTACAGATT | |
CCR7 | GGCTGGTCGTGTTGACCTAT | ACGTAGCGGTCAATGCTGAT | |
Anti-inflammatory | IL-10 | AAGCCTGACCACGCTTTCTA | ATGAAGTGGTTGGGGAATGA |
TGF-β | TTGATGTCACCGGAGTTGTG | TGATGTCCACTTGCAGTGTG | |
CD206 | CCTGGAAAAAGCTGTGTGTCAC | AGTGGTGTTGCCCTTTTTGC | |
Housekeeping gene | Β-actin | AGAGCTACGAGCTGCCTGAC | AGCACTGTGTTGGCGTACAG |
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations. |
© 2022 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Callejas, J.A.; Gil, J.; Brizuela, A.; Pérez, R.A.; Bosch, B.M. Effect of the Size of Titanium Particles Released from Dental Implants on Immunological Response. Int. J. Mol. Sci. 2022, 23, 7333. https://doi.org/10.3390/ijms23137333
Callejas JA, Gil J, Brizuela A, Pérez RA, Bosch BM. Effect of the Size of Titanium Particles Released from Dental Implants on Immunological Response. International Journal of Molecular Sciences. 2022; 23(13):7333. https://doi.org/10.3390/ijms23137333
Chicago/Turabian StyleCallejas, Juan Antonio, Javier Gil, Aritza Brizuela, Román A. Pérez, and Begoña M. Bosch. 2022. "Effect of the Size of Titanium Particles Released from Dental Implants on Immunological Response" International Journal of Molecular Sciences 23, no. 13: 7333. https://doi.org/10.3390/ijms23137333