Next Article in Journal
Dually Responsive Nanoparticles for Drug Delivery Based on Quaternized Chitosan
Previous Article in Journal
In Situ Collection and Rapid Detection of Pathogenic Bacteria Using a Flexible SERS Platform Combined with a Portable Raman Spectrometer
 
 
Search for Articles:
Title / Keyword
Author / Affiliation / Email
Journal
Article Type
 
 
Advanced Search
 
Section
Special Issue
Volume
Issue
Number
Page
 
Journals
IJMS
Volume 23
Issue 13
10.3390/ijms23137341
ijms-logo
Submit to this Journal Review for this Journal Propose a Special Issue
► Article Menu

Article Menu

share Share announcement Help format_quote Cite question_answer Discuss in SciProfiles thumb_up
...
Endorse textsms
...
Comment
first_page
settings
Order Article Reprints
Font Type:
Arial Georgia Verdana
Font Size:
Aa Aa Aa
Line Spacing:
Column Width:
Background:
Article

The Calcium-Dependent Protein Kinase TaCDPK27 Positively Regulates Salt Tolerance in Wheat

by
Jie-Yu Yue
,
Jin-Lan Jiao
,
Wen-Wen Wang
and
Hua-Zhong Wang
*
Tianjin Key Laboratory of Animal and Plant Resistance, College of Life Sciences, Tianjin Normal University, Tianjin 300387, China
*
Author to whom correspondence should be addressed.
Int. J. Mol. Sci. 2022, 23(13), 7341; https://doi.org/10.3390/ijms23137341
Submission received: 1 April 2022 / Revised: 20 June 2022 / Accepted: 29 June 2022 / Published: 1 July 2022
(This article belongs to the Topic Plant Responses and Tolerance to Salinity Stress)
Browse Figures
Versions Notes

Abstract

:
As essential calcium ion (Ca2+) sensors in plants, calcium-dependent protein kinases (CDPKs) function in regulating the environmental adaptation of plants. However, the response mechanism of CDPKs to salt stress is not well understood. In the current study, the wheat salt-responsive gene TaCDPK27 was identified. The open reading frame (ORF) of TaCDPK27 was 1875 bp, coding 624 amino acids. The predicted molecular weight and isoelectric point were 68.905 kDa and 5.6, respectively. TaCDPK27 has the closest relationship with subgroup III members of the CDPK family of rice. Increased expression of TaCDPK27 in wheat seedling roots and leaves was triggered by 150 mM NaCl treatment. TaCDPK27 was mainly located in the cytoplasm. After NaCl treatment, some of this protein was transferred to the membrane. The inhibitory effect of TaCDPK27 silencing on the growth of wheat seedlings was slight. After exposure to 150 mM NaCl for 6 days, the NaCl stress tolerance of TaCDPK27-silenced wheat seedlings was reduced, with shorter lengths of both roots and leaves compared with those of the control seedlings. Moreover, silencing of TaCDPK27 further promoted the generation of reactive oxygen species (ROS); reduced the activities of superoxide dismutase (SOD), peroxidase (POD) and catalase (CAT); aggravated the injury to photosystem II (PS II); and increased programmed cell death (PCD) in wheat leaves under NaCl treatment, confirming that the TaCDPK27-silenced seedlings exhibited more NaCl injury than control seedlings. Taken together, the decrease in NaCl tolerance in TaCDPK27-silenced seedlings was due to excessive ROS accumulation and subsequent aggravation of the NaCl-induced PCD. TaCDPK27 may be essential for positively regulating salt tolerance in wheat seedlings.

1. Introduction

Plant growth is affected by various environmental stresses (such as, salinity, drought, cold, etc.) throughout the plant life cycle, reducing growth and productivity [1,2,3]. To survive these stresses, plants have developed multi-level defense strategies that guarantee normal growth and productivity [4,5,6]. Various proteinaceous and non-proteinaceous elements are essential in these plant defense responses [3]. Proteinaceous factors with this role include enzymes, transcription factors, and receptors, and such non-proteinaceous elements include a number of secondary messengers, such as calcium ions (Ca2+), cyclic nucleotides, hydrogen ion (H+), lipids, and reactive oxygen species (ROS) [7,8,9,10,11]. Among them, Ca2+ is a vital secondary messenger that functions in signal transduction in plant growth and development [12]. Upon stimulation by the external environment, plants experience concentration fluctuation of the cytoplasmic Ca2+ called Ca2+ oscillation, which is perceived signals to trigger downstream responses [13]. These Ca2+ signals activate calcium-sensing proteins, thereby regulating the expression of defense genes and activating the distinct physiological and biochemical response pathways of plants [14]. Plants have four types of calcium-sensing proteins, including calmodulin (CaM), CaM-like protein (CML), calcineurin B-like protein (CBL), and calcium-dependent protein kinase (CDPK) [15]. As for the CDPKs we were concerned with in this study, plant CDPKs have four functional domains consisting of a highly variable N-terminal domain (dual leucine-zipper kinase, DLK) motif, serine (Ser)/threonine (Thr) kinase catalytic domain (S-TKc), autoinhibitory junction domain, and CaM-like domain [16,17]. In addition, the four EF-hand motifs distribute in the N-termini of CDPK sequences and are responsible for protein activation via binding Ca2+ [16,17].
Growing evidence has confirmed the important roles of plant CDPKs in stress signal transduction [16]. Barley HvCPK2a and wheat TaCDPK34 are CDPKs proved to be involved in the plant response to drought stress with opposite roles [18,19]. Overexpression of HvCPK2a led to increased drought sensitivity in barley [18], while it is silencing of TaCDPK34 that leads to a similar phenotype in wheat [19]. Rice OsCDPK21 and OsCDPK10, Glycyrrhiza uralensis GuCDPKs, maize ZmCDPK11, and apple MdCDPK1a are CDPKs improved by plant responses to salt stress [17,20,21,22,23]. OsCDPK21 confer salt tolerance by modulating the abscisic acid (ABA) signal pathway and phosphorylating OsGF14e, a 14-3-3 protein [21]. OsCPK10 and MdCDPK1a achieved this by positively regulating the cellular anti-oxidative capacity [20,23]. OsCDPK12, another rice CDPK, also plays an antioxidation role to protect plants from early leaf senescence [24]. GuCPKs contribute salt tolerance of G. Uralensis plants by increasing glycyrrhizic acid and flavonoid synthesis [16]. MdCDPK1a of apple also functions in plant cold tolerance, and a similar role is played by another rice CDPK, OsCPK24, which can inhibit the glutaredoxin OsGrx10 to maintain high levels of glutathione [23,25]. ZmCDPK7, another maize CDPK, positively regulates maize tolerance to heat stress [8]. In addition to the roles of CDPKs in plant responses to abiotic stresses, roles of plant CDPKs in plant responses to biotic stressed have also been reported. AtCDPK28, an Arabidopsis CDPK, inhibits the BIK1-mediated immune response by phosphorylating BIK1 for turnover [26]. The above-mentioned rice OsCDPK10 and another wheat CDPK, TaCDPK7-D, however, function as positive regulators, respectively, in rice resistance to blast disease and in wheat resistance to Rhizoctonia cerealis infection with the assistance of several defense-related genes and ACO2 controlling ethylene biosynthesis [20,27].
Plant CDPK is a multi-protein family with 34 members in Arabidopsis thaliana [28], 31 CDPKs in rice [21], 30 CDPKs in poplar [29], 41 CDPKs in cotton [30], and 20 CDPKs in bread wheat [19]. To date, only a small number of plant CDPKs have been functionally characterized. The common wheat (Triticum aestivum L.) is a major food crop worldwide that provides dietary carbohydrates for more than one-third of the world’s population [31]. In this study, we report the characterization of a new wheat CDPK gene, TaCDPK27-5B, and provide evidence to show that TaCDPK27-5B is engaged in wheat response to salt stress.

2. Results

2.1. NaCl Treatment Increases Ca2+ Levels in the Roots of Wheat Seedlings

To detect whether the Ca2+ signal is involved in the wheat response to NaCl treatment, the fluorescence dye Fluo-3/AM was used to measure the level of intracellular Ca2+ in the roots of wheat seedlings subjected to NaCl treatment. The fluorescence intensity of Ca2+-bound Fluo-3 positively associates with the level of Ca2+ in the cell. A confocal laser scanning microscope showed that 6 h and 144 h treatment with 150 mM NaCl resulted in intensively enhanced Fluo-3 fluorescence in seedling roots suggesting an elevated level of Ca2+.This NaCl-induced elevation of the Ca2+ level was compromised by application of the Ca2+-channel blocker La3+ (Figure 1). These results suggest that the second messenger Ca2+ in seeding roots responds to NaCl stress by migrating into cells.

2.2. Cloning and Characterization of the Wheat CDPK Gene TaCDPK27B

After amplification, the complete coding sequence (CDS) of the salt-responsive unigene (accession no. TraesCS5B02G109300) was acquired. Sequence analysis showed that the whole length of the open reading frame (ORF) was 1875 bp, which encoded 624 amino acids with a molecular weight and theoretical isoelectric point (pI) of 68.905 kDa and 5.6, respectively. The protein had the typical characteristics of CDPKs, an N-terminal variable domain; S-TKc, an autoinhibitory domain; and four EF-hand motifs that could activate proteins by binding Ca2+ (Figure 2). The deduced amino acid alignment analysis indicated 99% similarity to CDPK27-like isoform X in both Triticum dicoccoides and Aegilops tauschii subsp. strangulata, and it was located on chromosome 5B, so we named it TaCDPK27B (TaCDPK27). According to Chen et al. (2020) [32], TaCDPK2B was used as a probe to search for homologs in the Triticeae-GeneTribe database. TraesCS5D02G124000, located on chromosome 5D, and TraesCS5A02G107900, located on chromosome 5A, were identified as TaCDPK27B homologs in wheat and designated TaCDPK27D and TaCDPK27A, respectively. The ORF nucleotide sequences of TaCDPK27A, TaCDPK27B, and TaCDPK27D share identities of 53–98% and encode peptide sequences of 564, 624, and 624 amino acids, respectively. Phylogenetic analysis showed that the TaCDPK27-5A protein shared high similarities with OsCDPK24 and OsCDPK28. Both TaCDPK27-5B and TaCDPK27-5D shared high similarities with OsCDPK27. The three TaCDPKs were all in subgroup III of the CDPK family (Figure 3).

2.3. TaCDPK27 Responds to NaCl Treatment

Quantitative real-time PCR (qRT-PCR) assays were conducted to investigate the expression response of TaCDPK27 to a time-series NaCl treatment in wheat seedlings. As shown in Figure 4, the expression of TaCDPK27 was significantly unregulated in leaves within 72 h of NaCl treatment. In the roots of NaCl-treated seedlings, this expression upregulation of TaCDPK27 within 72 h of NaCl treatment was negligible, and significantly decreased expression of TaCDPK27B was detected in the roots after 72 h of NaCl treatment.
Plant CDPKs have been shown to localize in different cellular compartments implying their functional diversification [33,34] Here, mCherry and TaCDPK27-mCherry were each expressed in wheat mesophyll protoplasts to investigate the localization of TaCDPK27 (Figure 5). Under normal conditions for the maintenance of transfected protoplasts, the fluorescence signals of mCherry spread in the whole cell including the nucleus, while those of TaCDPK27-mCherry only spread in the cytoplasm. Interestingly, a 150 mM NaCl treatment to the protoplasts resulted in translocation of a majority of TaCDPK27-mCherry signals to the periphery of the cell (Figure 5). These results suggest that wheat seedling leaf TaCDPK27 responds to NaCl treatment by upregulation of the transcription of TaCDPK27 and the translocation of TaCDPK27.

2.4. Silencing of TaCDPK27 Increases the Salt Sensitivity of Wheat Seedlings

We then sought to get clear information on the role of TaCDPK27 in wheat response to NaCl stress through gene silencing. TaCDPK27-silenced seedlings were prepared by inoculating with the method of the barley stripe mosaic virus (BSMV)-based virus-induced gene silencing (VIGS). To further confirm the roles of TaCDPK27 in the salt stress response of wheat seedlings, TaCDPK27-silenced wheat seedlings were acquired using BMSV-VIGS. After 6 days of BMSV inoculation, the third leaves of BSMV-VIGS-inoculated seedlings displayed chlorosis, confirming that the VIGS system functioned correctly. Then qRT-PCR was employed to determine the expression level of TaCDPK27. Compared with the control, the expression of TaCDPK27 was significantly inhibited in the leaves of TaCDPK27-silenced seedlings (Figure 6A).
To analyze the effect of TaCDPK27 silencing on wheat seedling tolerance to salt stress, TaCDPK27-silenced seedlings were treated with 150 mM NaCl for 6 days. Silencing of TaCDPK27 slightly inhibited increases in root and leaf length (Table 1). After exposure to NaCl treatment for 6 days, silencing of TaCDPK27 aggravated the NaCl stress-induced damage to wheat seedling growth (Figure 6B), and the root length of TaCDPK27-silenced seedlings was decreased by 28.34% (8.73 cm), compared with 19.63% (6.3 cm) for BSMV-GFP-inoculated-seedlings and 20.55% (7.5 cm) for the wild-type seedlings. Likewise, the leaf length of TaCDPK27-silenced seedlings was decreased by 17.97% (4.9 cm), compared with 16.76% (4.9 cm) for BSMV-GFP-inoculated-seedlings and 16.50% (5.13 cm) for wild-type seedlings under NaCl treatment (Table 1). Evans blue staining also showed that silencing TaCDPK27 aggravated NaCl stress-induced cell death in the leaves of wheat seedlings (Figure 6C). The above results suggested that silencing TaCDPK27 increased wheat seedling sensitivity to NaCl treatment.

2.5. Silencing of TaCDPK27 Promoted NaCl Stress-Triggered Programmed Cell Death (PCD) in Leaves of Wheat Seedlings

To investigate the potential role of TaCDPK27 in PCD, a TdT-mediated dUTP Nick-End Labeling (TUNEL) assay was used to detect the PCD level in leaves of wheat seedlings. The results showed that NaCl treatment induced PCD with increased TUNEL-positive nuclei in wheat leaves at the seedling stage. Silencing TaCDPK27 further increased NaCl stress-triggered TUNEL-positive nuclei (Figure 7). These results revealed that TaCDPK27 regulated the PCD triggered by NaCl treatment in wheat leaves at the seedling stage.

2.6. Silencing TaCDPK27 Aggravates the NaCl Stress-Induced Injury of Photosystem II (PSII)

Compared with the control, NaCl stress significantly decreased PSII photochemistry (Fv/Fm), quantum yield of PSII (Y(II)), quenching coefficient (qP), minimal fluorescence (F0), and electron transfer rate (ETR) and increased nonphotochemical quenching coefficient (NPQ) in wheat seedlings. After exposure to NaCl stress for 6 days, the Fv/Fm of TaCDPK27-silenced seedlings was decreased by 8.47%, compared with 6.47% for BSMV-GFP-inoculated seedlings and 4.78% for wild-type seedlings. After exposure to NaCl stress for 6 days, the Y(II) of TaCDPK27-silenced seedlings was decreased by 46.67%, compared with 35.80% for BSMV-GFP-inoculated seedlings and 23.93% for wild-type seedlings. After exposure to NaCl stress for 6 days, the qP of TaCDPK27-silenced seedlings was decreased by 38.87%, compared with 24.66% for BSMV-GFP-inoculated seedlings and 12.38% for wild-type seedlings. After exposure to NaCl stress for 6 days, the F0 of TaCDPK27-silenced seedlings was decreased by 43.86%, compared with 36.51% for BSMV-GFP-inoculated seedlings and 33.33% for wild-type seedlings. After exposure to NaCl stress for 6 days, the ETR of TaCDPK27-silenced seedlings was decreased by 46.03%, compared with 35.88% for BSMV-GFP-inoculated seedlings and 22.57% for wild-type seedlings. After exposure to NaCl stress for 6 days, the NPQ of TaCDPK27-silenced seedlings was increased by 110.24%, compared with 95.36% for BSMV-GFP-inoculated seedlings and 123.85% for wild-type seedlings (Table 2). These results showed that silencing of TaCDPK27 further decreased Fv/Fm, Y(II), qP, F0, and ETR and increased NPQ in wheat seedlings under NaCl treatment, confirming that knockdown of TaCDPK27 aggravated NaCl treatment induced PSII injury in wheat seedlings.

2.7. Silencing TaCDPK27 Reduces the Antioxidant Capacity of Wheat Roots and Leaves under NaCl Treatment

To study the influence of TaCDPK27 on the antioxidant capacity of wheat leaves under NaCl treatment, the ROS levels and the activities of some antioxidant enzymes were monitored. 3,3-diaminobenzidine (DAB) and nitro blue tetrazolium (NBT) staining methods were employed to determine the generation of O2−. and H2O2 in the wheat leaves, respectively. Under normal growth conditions, silencing of TaCDPK27 had no obvious effect on the accumulation of O2−. and had a little effect on the accumulation of H2O2 in the leaves of wheat seedlings. NaCl treatment increased excess O2−. and H2O2 in the leaves of wheat seedlings. Silencing of TaCDPK27 further promoted the generation of O2−. and H2O2 under NaCl treatment (Figure 8A). Quantitative detection of O2−. and H2O2 were consistent with the NBT and DAB staining results, respectively (Figure 8B). The activities of superoxide dismutase (SOD), peroxidase (POD), and catalase (CAT) in the leaves of wheat seedlings were markedly increased under NaCl treatment compared with those of the control (Figure 8C). The TaCDPK27-silenced seedlings had significantly lower SOD, POD, and CAT activities than γG and WT seedlings after exposure to NaCl treatment. These results suggested that silencing TaCDPK27 reduced the antioxidant capacity of wheat leaves under NaCl treatment.

3. Discussion

Salt stress has become one of the main factors threatens to plant growth and crop production [35]. Plants adapt to salt stress through the activation of many physiological and metabolic responses, due to the perception of stress signals and subsequent signal transduction [36,37]. As a secondary messenger, Ca2+ functions in the plant response to environmental stresses by coupling extracellular signals with intracellular physiological and biochemical responses with Ca2+ sensors or Ca2+-binding proteins [12,13]. CDPKs are widespread calcium receptors in protists, oomycetes, green algae, and plants that form a large multigene family and are separated into four types (I, II, III, and IV) [23,27,38]. Genome research has showed that 34 CDPKs in Arabidopsis [28], 31 CDPKs in rice [21], 20 CDPKs in bread wheat [19], 30 CDPKs in poplar [29], and 41 CDPKs in cotton [30] have been identified. They have biological control functions in plant responses to various environmental stresses [38]. In the present study, the Ca2+ signal in wheat roots and leaves was induced significantly under NaCl stress. A similar phenomenon was observed in Arabidopsis induced by Ma et al. (2019) [39]. The TaCDPK27 was also identified as a salt-responsive gene, which possessed conserved domains similar to those of CDPKs, including an N-terminal variable domain, an S-TKc, an autoinhibitory domain, and four Ca2+-binding EF-hand motifs. TaCDPK27 has the closest relationship with subgroup III members of the CDPK family of rice. Unlike AtCPK27, which is a membrane-localized protein kinase [40], TaCDPK27 was localized to the cytoplasm, and the localization could be changed to the membrane under NaCl stress, indicating that TaCDPK27 might be functional in multiple signal transduction pathways. Our results suggested that the TaCDPK27-mediated Ca2+ signal was involved in the regulation of wheat salt tolerance, which is consistent with research on licorice, Arabidopsis, rice, and maize [17].
Studies have explored evidence that CDPKs are important regulators of the plant defense response to multiple stress. CDRK2 reduced the salt sensitivity of Arabidopsis [41]. AtCDPK27 was required for Arabidopsis adaptation to salt stress by regulating ion and ROS homeostasis [40]. Overexpression of VaCDPK20 elevated the tolerance of Arabidopsis under freezing and drought treatment conditions [42]. ZmCDPK7 conferred maize tolerance to heat stress, which was induced by ROS accumulation [8]. TaCDPK27 is also involved in the wheat response to NaCl treatment at the seedling stage. Silencing of TaCDPK27 enhanced the sensitivity of wheat seedlings to NaCl treatment, whereas under normal growth conditions, it showed a slight effect on plant growth. Moreover, silencing of TaCDPK27 decreased SOD, POD, and CAT activities in the leaves of wheat seedlings treated with NaCl stress, while the silencing of TaCDPK27 led to increase of O2−. and H2O2 induced by NaCl treatment. Consequently, the deterioration of PSII became more serious. Our results align with those of the previous study that overexpression of OsCDPK12 induces delayed leaf senescence by reducing oxidative damage and enhancing the net photosynthesis rate (Pn) and chlorophyll content in rice [24]. These results indicated that silencing of TaCDPK27 aggravated NaCl stress-induced damage to the photosynthetic system by decreasing SOD, POD, and CAT activities to increase ROS generation in NaCl-treated wheat seedlings.
PCD can eliminate unwanted cells in the plant defense response [43]. However, the signaling pathways underlying the triggering of PCD remain unclear. Previous studies have proposed that excess ROS can induce PCD in plants [44]. The current results indicated that TaCDPK27 is involved in NaCl stress-induced PCD. Silencing of TaCDPK27 caused an increase in both O2− and H2O2 contents and a higher level of PCD induced by NaCl treatment. Our results indicated that TaCPK27 positively regulates ROS-scavenging in wheat seedlings, which benefits adaptation to NaCl stress. Connections among TaCDPK27, ROS homeostasis, and PCD have long been established. TaCDPK27 is mainly associated with the negative regulation of ROS overproduction and excess ROS are signaling molecules that trigger PCD in wheat seedlings during NaCl treatment. Our results suggest that TaCDPK27 might play a positive role in conferring salt tolerance to plants.

4. Materials and Methods

4.1. Wheat Seedling Growth and Stress Conditions

Seeds of the wheat variety Henong 6425 (Triticum aestivum L.) were obtained from Tianjin Academy of Agricultural Sciences (China). The wheat seedlings were grown under hydroponic culture as previously described [45]. Two-leaf stage seedlings were selected and exposed to 0 mM NaCl, 150 mM NaCl, 5 mM LaCl3 (Sigma Aldrich, Saint Louis, MO, USA), and 5 mM LaCl3+150 mM NaCl for 6 days. Seedlings that received 0 mM NaCl treatment were used as controls.

4.2. Cloning, Sequencing, and Phylogenetic Analysis of TaCDPK27

Total RNA in the wheat root or leaf samples was extracted with TRIzol reagent (TaKaRa, Tokyo, Japan). Then, reverse transcription kits (Promega, Madison, WI, USA) were employed to reverse transcribe RNA into first-strand cDNA. From the salt stress-induced differentially expressed genes (DEGs) of wheat roots and leaves identified via an RNA-Seq assay, a unigene (accession no. TraesCS5B02G109300) released from EnsemblPlants was chosen and cloned [46]. Based on its CDS, the specific primers were designed to amplify the full length of ORF with reverse transcription-polymerase chain reaction (RT-PCR) (Table 3). The PCR experiment was conducted using TransStart Fast Pfu DNA polymerase (TransGen, Beijing, China). The PCR products were cloned with pGEM®®-T Easy (Promega, USA) and sequenced by Sangon Biotech (Shanghai, China). The molecular weight and theoretical pI were calculated with ExPASy software (http://www.expasy.org/, accessed on 1 December 2020). The BLASTp program (http://www.ncbi.nlm.nih.gov/, accessed on 1 December 2020) was employed to perform homologous comparison. BioEdit software (version 7.0.5.3) was used to perform multiple alignment. Smart software (http://smart.embl-heidelberg.de/smart/set_mode.cgi, accessed on 1 December 2020) was employed to predict the conserved domains and motifs. A phylogenetic tree was acquired using MEGA-X software with the neighbor-joining (NJ) method.

4.3. Subcellular Localization of TaCDPK27

Specific primers with XbaI and BamHI restriction sites were used to amplify the ORF of TaCDPK27 without a termination codon from the first-strand cDNA or vector of pGEM®®-T Easy-TaCDPK27. The amplification products were digested with XbaI and BamHI, and were subcloned into the pAN583:mCherry vector at the N-terminus of the mCherry sequence using the pEASY®®-Basic Seamless Cloning and Assembly Kit (TransGen Biotech, China). Then, the TaCDPK27-mCherry fusion construct pAN583:TaCDPK27-mCherry was acquired. The pAN583:TaCDPK27-mCherry fusion construct and pAN583:mCherry (control) were transferred into wheat protoplasts, using the PEG-mediated transfection method as previously described [47]. The transformed protoplasts were cultured for 20 h at 25 °C. Then, the mCherry signals were examined with a confocal laser scanning microscope (Nikon Ti2 Eclipse A1, Nikon, Tokyo, Japan). The primers used are listed in Table 3.

4.4. BSMV-VIGS Assay

The BSMV-VIGS method was performed to acquire TaCDPK27-silenced wheat seedlings as previously described [48]. A cDNA fragment of 131 bp (+1612 bp to +1742 bp) was employed to acquire the TaCDPK27-silenced vector. After this fragment was inserted into the BSMVγ plasmid (BSMVγ:TaCDPK27), the plasmids BSMVα, BSMVγ:GFP and BSMVγ:TaCDPK27 were linearized with Mlu I (Takara, Dalian, China). BSMVβ was linearized with Spe I (Takara, Dalian, China). Then, a RiboMAX large-scale RNA Production-T7 kit (Promega, Madison, WI, USA) was used to transcribe these linearized plasmids in vitro. Ribom 7G Cap Analog (Promega, Madison, WI, USA) was employed to produce the 5′-capped BSMV RNA molecules for subsequent BSMV-VIGS inoculation experiments. These experiments (including vector construction, in vitro transcription, BSMV-VIGS inoculation, TaCDPK27-silenced seedling identification, and silencing efficiency assessment of TaCDPK27) were conducted as previously described [45]. Then, the BSMV-VIGS-inoculated seedlings with three fully expanded leaves were treated with 150 mM NaCl for 6 days. All experiments had at least three separate replications. The primes used are listed in Table 3.

4.5. Physiological Measurements and Histochemical Staining

After 150 mM NaCl stress for 6 days, the following experiments were conducted. The in situ generation of H2O2 and O2− in wheat leaves was examined using DAB and NBT staining, respectively. The staining procedures were carried out as previously described [45]. The quantitative determination of H2O2 and O2− was performed following a previous study [46]. Evans blue staining was carried out to visualize the degree of cell damage in the wheat leaves under NaCl treatment. The leaf samples were immersed in 0.25% Evans blue staining solution and stained for 24 h in darkness. Then, the tissues were rinsed with decolorization buffer (absolute ethanol and glycerol, 9:1, v/v) until they became colorless. Subsequently, the leaves were photographed with a stereoscopic microscope (Nikon C-fled2). The activities of SOD, POD, and CAT, and the TUNEL assay were performed and analyzed as previously described [45].
The representative chlorophyll fluorescence parameters were chosen to test the PSII activity in wheat seedlings, according to our previous study [45]. The test parameters included the Fv/Fm, Y(II), qP, F0, ETR, and NPQ.

4.6. qRT-PCR Assay

Total RNA of the root and leaf samples was extracted with TRIzol reagent (TaKaRa, Tokyo, Japan). The extraction method, reverse transcription of the first-strand cDNA, and qRT–PCR were conducted as previously described [45]. The sequences of the primers used for qRT–PCR are listed in Table 3.

4.7. Cytosolic Ca2+ Fluorescence Measurement

The Ca2+-specific fluorescent probe Fluo-3/AM (Sigma, USA) was used to determine the level of Ca2+ in roots of wheat seedlings [45,49]. The 2–3 mm roots were loaded with 20 μM Fluo-3/AM for 2 h at 25 °C in the dark. Then the roots were washed 3–5 times with PBS to remove the excess Fluo-3/AM. The Ca2+ level in the roots was examined with a confocal laser scanning microscope (Nikon Ti2 Eclipse A1). The excitation wavelengths were 488 nm, and the emission wavelengths were in the range of 510–550 nm.

4.8. Statistical Analysis

Every experiment was performed with at least three repetitions. The data are presented as the mean ± SD. All statistical analyses were performed based on Duncan’s multiple range tests with SPSS software. p < 0.05 indicated significant differences.

5. Conclusions

A salt-responsive gene of wheat, TaCDPK27, was identified. The ORF length of TaCDPK27 was 1875 bp, which encoded 624 amino acids with a predicted molecular weight and pI of 68.901 kDa and 5.6, respectively. TaCDPK27 belongs to subgroup III of the CDPK family of rice. The relative expression of TaCDPK27 was significantly upregulated in the roots and leaves of wheat seedlings under 150 mM NaCl treatment. TaCDPK27 mainly exists in the cytoplasm. Under NaCl treatment, some of this protein was transferred to the membrane. Silencing of TaCDPK27 in wheat seedlings significantly reduced their NaCl stress tolerance. The decrease in NaCl tolerance in TaCDPK27-silenced seedlings was due to excess ROS accumulation and increased levels of salt-induced PCD. TaCDPK27 can function as a positive regulator of the salt stress response in wheat.

Author Contributions

Methodology, Validation, Formal analysis, Writing—Original Draft, Funding Acquisition, J.-Y.Y.; Methodology, Validation, Software, J.-L.J.; Visualization, Software, W.-W.W.; Writing—Review and Editing, Supervision, H.-Z.W. All authors have read and agreed to the published version of the manuscript.

Funding

This research was funded by the National Science Foundation of China (grant number 31501234 and 31971829), the Youth Talent Support Program of Tianjin Normal University (grant number 043135202RC1702), and the Postgraduate Innovative Research Projects of Tianjin (2021YJSS212).

Institutional Review Board Statement

Not applicable.

Informed Consent Statement

Not applicable.

Data Availability Statement

Data are available from the authors on request.

Acknowledgments

We thank the referees for helpful comments and the other members of our laboratory for help with the research and for insightful remarks.

Conflicts of Interest

The authors declare that there is no conflict of interest.

References

  1. Manghwar, H.; Hussain, A. Mechanism of tobacco osmotin gene in plant responses to biotic and abiotic stress tolerance: A brief history. BIOCELL 2022, 46, 623–632. [Google Scholar] [CrossRef]
  2. Gong, Z.; Xiong, L.; Shi, H.; Yang, S.; Herrera-Estrella, L.R.; Xu, G.; Chao, D.Y.; Li, J.; Wang, P.Y.; Qin, F.; et al. Plant abiotic stress response and nutrient use efficiency. Sci. China Life Sci. 2020, 63, 635–674. [Google Scholar] [CrossRef] [PubMed]
  3. Ismail, A.; El-Sharkawy, I.; Sherif, S. Salt stress signals on demand: Cellular events in the right context. Int. J. Mol. Sci. 2020, 21, 3918. [Google Scholar] [CrossRef] [PubMed]
  4. Ayaz, A.; Huang, H.; Zheng, M.; Zaman, W.; Li, D.; Saqib, S.; Zhao, H.; Lü, S. Molecular cloning and functional analysis of GmLACS2-3 reveals its involvement in cutin and suberin biosynthesis along with abiotic stress tolerance. Int. J. Mol. Sci. 2021, 22, 9175. [Google Scholar] [CrossRef] [PubMed]
  5. Verma, V.; Ravindran, P.; Kumar, P.P. Plant hormone-mediated regulation of stress responses. BMC Plant. Biol. 2016, 16, 86. [Google Scholar] [CrossRef] [Green Version]
  6. Manghwar, H.; Hussain, A.; Ali, Q.; Liu, F. Brassinosteroids (BRs) role in plant development and coping with different stresses. Int. J. Mol. Sci. 2022, 23, 1012. [Google Scholar] [CrossRef]
  7. Meraj, T.A.; Fu, J.; Raza, M.A.; Zhu, C.; Shen, Q.; Xu, D.; Wang, Q. Transcriptional factors regulate plant stress responses through mediating secondary metabolism. Genes 2020, 11, 346. [Google Scholar] [CrossRef] [Green Version]
  8. Zhao, Y.; Du, H.; Wang, Y.; Wang, H.; Yang, S.; Li, C.; Chen, N.; Yang, H.; Zhang, Y.; Zhu, Y.; et al. The calcium-dependent protein kinase ZmCDPK7 functions in heat-stress tolerance in maize. J. Integr. Plant Biol. 2021, 63, 510–527. [Google Scholar] [CrossRef]
  9. Kolbert, Z.; Ördög, A. Involvement of nitric oxide (NO) in plant responses to metalloids. J. Hazard. Mater. 2021, 420, 126606. [Google Scholar] [CrossRef]
  10. Wani, S.H.; Kumar, V.; Khare, T.; Guddimalli, R.; Parveda, M.; Solymosi, K.; Suprasanna, P.; Kavi Kishor, P.B. Engineering salinity tolerance in plants: Progress and prospects. Planta 2020, 251, 76. [Google Scholar] [CrossRef]
  11. Ayaz, A.; Saqib, S.; Huang, H.; Zaman, W.; Lü, S.; Zhao, H. Genome-wide comparative analysis of long-chain acyl-CoA synthetases (LACSs) gene family: A focus on identification, evolution and expression profiling related to lipid synthesis. Plant. Physiol. Biochem. 2021, 161, 1–11. [Google Scholar] [CrossRef] [PubMed]
  12. Yang, Z.; Wang, C.; Xue, Y.; Liu, X.; Chen, S.; Song, C.; Yang, Y.; Guo, Y. Calcium-activated 14-3-3 proteins as a molecular switch in salt stress tolerance. Nat. Commun. 2019, 10, 1199. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  13. Tian, W.; Wang, C.; Gao, Q.; Li, L.; Luan, S. Calcium spikes, waves and oscillations in plant development and biotic interactions. Nat. Plants 2020, 6, 750–759. [Google Scholar] [CrossRef]
  14. Mahmood, T.; Khalid, S.; Abdullah, M.; Ahmed, Z.; Shah, M.K.N.; Ghafoor, A.; Du, X. Insights into drought stress signaling in plants and the molecular genetic basis of cotton drought tolerance. Cells 2019, 9, 105. [Google Scholar] [CrossRef] [Green Version]
  15. Wang, X.; Hao, L.; Zhu, B.; Jiang, Z. Plant calcium signaling in response to potassium deficiency. Int. J. Mol. Sci. 2018, 19, 3456. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  16. Atif, R.M.; Shahid, L.; Waqas, M.; Ali, B.; Rashid, M.A.R.; Azeem, F.; Nawaz, M.A.; Wani, S.H.; Chung, G. Insights on calcium-dependent protein kinases (cpks) signaling for abiotic stress tolerance in plants. Int. J. Mol. Sci. 2019, 20, 5298. [Google Scholar] [CrossRef] [Green Version]
  17. Tong, X.; Cao, A.; Wang, F.; Chen, X.; Xie, S.; Shen, H.; Jin, X.; Li, H. Calcium-dependent protein kinase genes in Glycyrrhiza Uralensis appear to be involved in promoting the biosynthesis of glycyrrhizic acid and flavonoids under salt stress. Molecules 2019, 24, 1837. [Google Scholar] [CrossRef] [Green Version]
  18. Cieśla, A.; Mituła, F.; Misztal, L.; Fedorowicz-Stronska, O.; Janicka, S.; Tajdel-Zielinska, M.; Marczak, M.; Janicki, M.; Ludwików, A.; Sadowski, J. A role for barley calcium-dependent protein kinase CPK2a in the response to drought. Front. Plant Sci. 2016, 7, 1550. [Google Scholar] [CrossRef] [Green Version]
  19. Li, G.Z.; Li, H.X.; Xu, M.J.; Wang, P.F.; Xiao, X.H.; Kang, G.Z. Functional characterization and regulatory mechanism of wheat CPK34 kinase in response to drought stress. BMC Genomics 2020, 21, 577. [Google Scholar] [CrossRef]
  20. Bundó, M.; Coca, M. Calcium-dependent protein kinase OsCPK10 mediates both drought tolerance and blast disease resistance in rice plants. J. Exp. Bot. 2017, 68, 2963–2975. [Google Scholar] [CrossRef] [Green Version]
  21. Chen, Y.; Zhou, X.; Chang, S.; Chu, Z.; Wang, H.; Han, S.; Wang, Y. Calcium-dependent protein kinase 21 phosphorylates 14-3-3 proteins in response to ABA signaling and salt stress in rice. Biochem. Biophys Res. Commun. 2017, 493, 1450–1456. [Google Scholar] [CrossRef] [PubMed]
  22. Borkiewicz, L.; Polkowska-Kowalczyk, L.; Cieśla, J.; Sowiński, P.; Jończyk, M.; Rymaszewski, W.; Szymańska, K.P.; Jaźwiec, R.; Muszyńska, G.; Szczegielniak, J. Expression of maize calcium-dependent protein kinase (ZmCPK11) improves salt tolerance in transgenic Arabidopsis plants by regulating sodium and potassium homeostasis and stabilizing photosystem II. Physiol. Plant 2020, 168, 38–57. [Google Scholar] [CrossRef] [PubMed]
  23. Dong, H.; Wu, C.; Luo, C.; Wei, M.; Qu, S.; Wang, S. Overexpression of MdCPK1a gene, a calcium dependent protein kinase in apple, increase tobacco cold tolerance via scavenging ROS accumulation. PLoS ONE 2020, 15, e0242139. [Google Scholar] [CrossRef] [PubMed]
  24. Wang, B.; Zhang, Y.; Bi, Z.; Liu, Q.; Xu, T.; Yu, N.; Cao, Y.; Zhu, A.; Wu, W.; Zhan, X.; et al. Impaired function of the calcium-dependent protein kinase, OsCPK12, leads to early senescence in rice (Oryza sativa L.). Front. Plant Sci. 2019, 10, 52. [Google Scholar] [CrossRef] [PubMed]
  25. Liu, Y.; Xu, C.; Zhu, Y.; Zhang, L.; Chen, T.; Zhou, F.; Chen, H.; Lin, Y. The calcium-dependent kinase OsCPK24 functions in cold stress responses in rice. J. Integr. Plant Biol. 2018, 60, 173–188. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  26. Monaghan, J.; Matschi, S.; Shorinola, O.; Rovenich, H.; Matei, A.; Segonzac, C.; Malinovsky, F.G.; Rathjen, J.P.; MacLean, D.; Romeis, T.; et al. The calcium-dependent protein kinase CPK28 buffers plant immunity and regulates BIK1 turnover. Cell Host Microbe 2014, 16, 605–615. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  27. Wei, X.; Shen, F.; Hong, Y.; Rong, W.; Du, L.; Liu, X.; Xu, H.; Ma, L.; Zhang, Z. The wheat calcium-dependent protein kinase TaCPK7-D positively regulates host resistance to sharp eyespot disease. Mol. Plant Pathol. 2016, 17, 1252–1264. [Google Scholar] [CrossRef]
  28. Gong, J.; Shi, T.; Li, Y.; Wang, H.; Li, F. Genome-wide identification and characterization of calcium metabolism related gene families in Arabidopsis thaliana and their regulation by Bacillus amyloliquefaciens under high calcium stress. Front. Plant Sci. 2021, 12, 707496. [Google Scholar] [CrossRef]
  29. Zuo, R.; Hu, R.; Chai, G.; Xu, M.; Qi, G.; Kong, Y.; Zhou, G. Genome-wide identification, classification, and expression analysis of CDPK and its closely related gene families in poplar (Populus trichocarpa). Mol. Biol. Rep. 2013, 40, 2645–2662. [Google Scholar] [CrossRef]
  30. Liu, W.; Li, W.; He, Q.; Daud, M.K.; Chen, J.; Zhu, S. Genome-wide survey and expression analysis of calcium-dependent protein kinase in Gossypium raimondii. PLoS ONE 2014, 9, e98189. [Google Scholar]
  31. Zou, B.; Ding, Y.; Liu, H.; Hua, J. Silencing of copine genes confers common wheat enhanced resistance to powdery mildew. Mol. Plant Pathol. 2018, 19, 1343–1352. [Google Scholar] [CrossRef] [PubMed]
  32. Chen, Y.; Song, W.; Xie, X.; Wang, Z.; Guan, P.; Peng, H.; Jiao, Y.; Ni, Z.; Sun, Q.; Guo, W. A collinearity-incorporating homology inference strategy for connecting emerging assemblies in the Triticeae Tribe as a Pilot Practice in the Plant Pangenomic Era. Mol. Plant 2020, 13, 1694–1708. [Google Scholar] [CrossRef] [PubMed]
  33. Wu, Y.; Zhang, L.; Zhou, J.; Zhang, X.; Feng, Z.; Wei, F.; Zhao, L.; Zhang, Y.; Feng, H.; Zhu, H. Calcium-dependent protein kinase GhCDPK28 was dentified and involved in verticillium wilt resistance in cotton. Front. Plant Sci. 2021, 12, 772649. [Google Scholar] [CrossRef]
  34. Meng, L.; Zhang, Q.; Yang, J.; Xie, G.; Liu, J.H. PtrCDPK10 of Poncirus trifoliata functions in dehydration and drought tolerance by reducing ROS accumulation via phosphorylating PtrAPX. Plant Sci. 2020, 291, 110320. [Google Scholar] [CrossRef]
  35. İbrahimova, U.; Kumari, P.; Yadav, S.; Rastogi, A.; Antala, M.; Suleymanova, Z.; Zivcak, M.; Tahjib-Ul-Arif, M.; Hussain, S.; Abdelhamid, M.; et al. Progress in understanding salt stress response in plants using biotechnological tools. J. Biotechnol. 2021, 329, 180–191. [Google Scholar] [CrossRef] [PubMed]
  36. Lamers, J.; van der Meer, T.; Testerink, C. How plants sense and respond to stressful environments. Plant Physiol. 2020, 182, 1624–1635. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  37. Van Zelm, E.; Zhang, Y.; Testerink, C. Salt tolerance mechanisms of plants. Annu. Rev. Plant Biol. 2020, 71, 403–433. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  38. Shi, S.; Li, S.; Asim, M.; Mao, J.; Xu, D.; Ullah, Z.; Liu, G.; Wang, Q.; Liu, H. The Arabidopsis calcium-dependent protein kinases (CDPKs) and their roles in plant growth regulation and abiotic stress responses. Int. J. Mol. Sci. 2018, 19, 1900. [Google Scholar] [CrossRef] [Green Version]
  39. Ma, L.; Ye, J.; Yang, Y.; Lin, H.; Yue, L.; Luo, J.; Long, Y.; Fu, H.; Liu, X.; Zhang, Y.; et al. The SOS2-SCaBP8 complex generates and fine-tunes an AtANN4-dependent calcium signature under salt stress. Dev. Cell 2019, 48, 697–709. [Google Scholar] [CrossRef] [Green Version]
  40. Zhao, R.; Sun, H.; Zhao, N.; Jing, X.; Shen, X.; Chen, S. The Arabidopsis Ca2+-dependent protein kinase CPK27 is required for plant response to salt-stress. Gene 2015, 563, 203–214. [Google Scholar] [CrossRef]
  41. Hunter, K.; Kimura, S.; Rokka, A.; Tran, H.C.; Toyota, M.; Kukkonen, J.P.; Wrzaczek, M. CRK2 enhances salt tolerance by regulating callose deposition in connection with PLDα1. Plant Physiol. 2019, 180, 2004–2021. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  42. Dubrovina, A.S.; Kiselev, K.V.; Khristenko, V.S.; Aleynova, O.A. VaCPK20, a calcium-dependent protein kinase gene of wild grapevine Vitis amurensis Rupr., mediates cold and drought stress tolerance. J. Plant Physiol. 2015, 185, 1–12. [Google Scholar] [CrossRef] [PubMed]
  43. Ebeed, H.T.; El-Helely, A.A. Programmed cell death in plants: Insights into developmental and stress-induced cell death. Curr. Protein Pept. Sci. 2021, 22, 873–889. [Google Scholar] [CrossRef] [PubMed]
  44. Zhou, S.; Hong, Q.; Li, Y.; Li, Q.; Wang, M. Autophagy contributes to regulate the ROS levels and PCD progress in TMV-infected tomatoes. Plant Sci. 2018, 269, 12–19. [Google Scholar] [CrossRef]
  45. Yue, J.Y.; Wang, Y.J.; Jiao, J.L.; Wang, H.Z. Silencing of ATG2 and ATG7 promotes programmed cell death in wheat via inhibition of autophagy under salt stress. Ecotoxicol. Environ. Saf. 2021, 225, 112761. [Google Scholar] [CrossRef]
  46. Yue, J.Y.; Wang, Y.J.; Jiao, J.L.; Wang, H.Z. Comparative transcriptomic and metabolic profiling provides insight into the mechanism by which the autophagy inhibitor 3-MA enhances salt stress sensitivity in wheat seedlings. BMC Plant Biol. 2021, 21, 577. [Google Scholar] [CrossRef]
  47. Li, K.; Liu, Y.; Yu, B.; Yang, W.; Yue, J.; Wang, H. Monitoring autophagy in wheat living cells by visualization of fluorescence protein-tagged ATG8. Plant Cell Tiss Organ. Cult. 2018, 134, 481–489. [Google Scholar] [CrossRef]
  48. Yue, J.; Sun, H.; Zhang, W.; Pei, D.; He, Y.; Wang, H.Z. Wheat homologs of yeast ATG6 function in autophagy and are implicated in powdery mildew immunity. BMC Plant Biol. 2015, 15, 95. [Google Scholar] [CrossRef] [Green Version]
  49. Chen, Y.; Cao, C.; Guo, Z.; Zhang, Q.; Li, S.; Zhang, X.; Gong, J.; Shen, Y. Herbivore exposure alters ion fluxes and improves salt tolerance in a desert shrub. Plant Cell Environ. 2020, 43, 400–419. [Google Scholar] [CrossRef]
Ijms 23 07341 g001 550
Figure 1. Confocal images of Fluo-3/AM fluorescence showing Ca2+ accumulation in roots of wheat seedlings within NaCl treatment with or without LaCl3 pretreatment.
Figure 1. Confocal images of Fluo-3/AM fluorescence showing Ca2+ accumulation in roots of wheat seedlings within NaCl treatment with or without LaCl3 pretreatment.
Ijms 23 07341 g001
Ijms 23 07341 g002 550
Figure 2. Conserved domain analysis of a calcium-dependent protein kinase gene, TaCDPK27, in wheat. (A) Domain structure of TaCDPK27. TaCDPK27 protein contained an N-terminal variable domain, a serine/threonine kinase-like domain (S-TKc), and four EF-hand motifs. (B) Nucleotide and amino acid sequences of TaCDPK27.
Figure 2. Conserved domain analysis of a calcium-dependent protein kinase gene, TaCDPK27, in wheat. (A) Domain structure of TaCDPK27. TaCDPK27 protein contained an N-terminal variable domain, a serine/threonine kinase-like domain (S-TKc), and four EF-hand motifs. (B) Nucleotide and amino acid sequences of TaCDPK27.
Ijms 23 07341 g002
Ijms 23 07341 g003 550
Figure 3. Sequence analysis of TaCDPK27. (A) Multi-sequence alignment of TaCDPK27 with other CDPK proteins from rice. Amino acid sequences from 29 function-known CDPKs share similar structures, containing DLK motif, a serine/threonine kinase-like domain (S-TKc), and four EF-hand motifs. Ta, Triticum aestivum L. (B) Phylogenetic analysis of TaCDPK27. I, Ⅱ, III and IV indicate the subgroups of CDPK family. TaCDPK27 and function-known CDPKs in rice are used to construct their phylogenetic tree using MEGA-X software.
Figure 3. Sequence analysis of TaCDPK27. (A) Multi-sequence alignment of TaCDPK27 with other CDPK proteins from rice. Amino acid sequences from 29 function-known CDPKs share similar structures, containing DLK motif, a serine/threonine kinase-like domain (S-TKc), and four EF-hand motifs. Ta, Triticum aestivum L. (B) Phylogenetic analysis of TaCDPK27. I, Ⅱ, III and IV indicate the subgroups of CDPK family. TaCDPK27 and function-known CDPKs in rice are used to construct their phylogenetic tree using MEGA-X software.
Ijms 23 07341 g003
Ijms 23 07341 g004 550
Figure 4. Transcript levels of TaCDPK27 in roots and leaves of wheat seedlings under NaCl treatment determined using qRT-PCR assay. Data were presented as mean ± SD from at least three independent experiments. Bars with different letters are significantly different at p < 0.05.
Figure 4. Transcript levels of TaCDPK27 in roots and leaves of wheat seedlings under NaCl treatment determined using qRT-PCR assay. Data were presented as mean ± SD from at least three independent experiments. Bars with different letters are significantly different at p < 0.05.
Ijms 23 07341 g004
Ijms 23 07341 g005 550
Figure 5. Subcellular localization of TaCDPK27. Wheat protoplasts were transformed with pAN583:mCherry or TaCDPK27-mCherry via the polyethylene glycol (PEG)-mediated method. TaCDPK27 is mainly localized to the cytoplasm in wheat protoplasts. Under salt stress conditions, some of TaCDPK27 was transferred to the membrane. Bar = 50 μm.
Figure 5. Subcellular localization of TaCDPK27. Wheat protoplasts were transformed with pAN583:mCherry or TaCDPK27-mCherry via the polyethylene glycol (PEG)-mediated method. TaCDPK27 is mainly localized to the cytoplasm in wheat protoplasts. Under salt stress conditions, some of TaCDPK27 was transferred to the membrane. Bar = 50 μm.
Ijms 23 07341 g005
Ijms 23 07341 g006 550
Figure 6. The effect of silencing TaCDPK27 on the cell death in leaves of wheat seedlings under NaCl stress. (A) Relative transcript levels of TaCDPK27 in leaves of BSMV-inoculated wheat seedlings. Standard deviations are shown (n > 3, ±SD, p < 0.05). CK was from wild-type wheat seedlings, γG was from BSMV-VIGS-GFP-inoculated wheat seedlings, TaCDPK27 was from BSMV-VIGS-TaCDPK27-inoculated wheat seedlings, and arabic numbers indicate individual TaCDPK27-silenced seedling. The data with different letters (a & b) in same column show significant difference (p < 0.05). (B) The effect of TaCDPK27 silencing on growth of wheat seedlings under NaCl treatment. (C) Evans blue staining results.
Figure 6. The effect of silencing TaCDPK27 on the cell death in leaves of wheat seedlings under NaCl stress. (A) Relative transcript levels of TaCDPK27 in leaves of BSMV-inoculated wheat seedlings. Standard deviations are shown (n > 3, ±SD, p < 0.05). CK was from wild-type wheat seedlings, γG was from BSMV-VIGS-GFP-inoculated wheat seedlings, TaCDPK27 was from BSMV-VIGS-TaCDPK27-inoculated wheat seedlings, and arabic numbers indicate individual TaCDPK27-silenced seedling. The data with different letters (a & b) in same column show significant difference (p < 0.05). (B) The effect of TaCDPK27 silencing on growth of wheat seedlings under NaCl treatment. (C) Evans blue staining results.
Ijms 23 07341 g006
Ijms 23 07341 g007 550
Figure 7. The effect of silencing TaCDPK27 on PCD level in leaves of wheat seedlings under NaCl treatment. CK was from wild-type wheat seedlings, γG was from BSMV-VIGS-GFP-inoculated wheat seedlings, and TaCDPK27 was from BSMV-VIGS-TaCDPK27-inoculated wheat seedlings. Bars with different letters are significantly different at p < 0.05.
Figure 7. The effect of silencing TaCDPK27 on PCD level in leaves of wheat seedlings under NaCl treatment. CK was from wild-type wheat seedlings, γG was from BSMV-VIGS-GFP-inoculated wheat seedlings, and TaCDPK27 was from BSMV-VIGS-TaCDPK27-inoculated wheat seedlings. Bars with different letters are significantly different at p < 0.05.
Ijms 23 07341 g007
Ijms 23 07341 g008 550
Figure 8. The effect of silencing of TaCDPK27 on the ROS accumulation in leaves of wheat seedlings under NaCl treatment. (A) NBT staining of the generation and accumulation of O2−. in leaves of wheat seedlings. DAB staining of the generation and accumulation of H2O2 in leaves of wheat seedlings. (B) The content of O2−. and H2O2 in leaves of wheat seedlings. (C) The activities of POD, SOD, and CAT in leaves of wheat seedlings. Standard deviations are shown (n > 3, ±SD, p < 0.05). CK was from wild-type wheat seedlings, γG was from BSMV-VIGS-GFP-inoculated wheat seedlings, TaCDPK27 was from BSMV-VIGS-TaCDPK27-inoculated wheat seedlings. The different letters in each treatment show the significant difference (p < 0.05). All the experiments presented here were performed at least three times, and similar results were obtained.
Figure 8. The effect of silencing of TaCDPK27 on the ROS accumulation in leaves of wheat seedlings under NaCl treatment. (A) NBT staining of the generation and accumulation of O2−. in leaves of wheat seedlings. DAB staining of the generation and accumulation of H2O2 in leaves of wheat seedlings. (B) The content of O2−. and H2O2 in leaves of wheat seedlings. (C) The activities of POD, SOD, and CAT in leaves of wheat seedlings. Standard deviations are shown (n > 3, ±SD, p < 0.05). CK was from wild-type wheat seedlings, γG was from BSMV-VIGS-GFP-inoculated wheat seedlings, TaCDPK27 was from BSMV-VIGS-TaCDPK27-inoculated wheat seedlings. The different letters in each treatment show the significant difference (p < 0.05). All the experiments presented here were performed at least three times, and similar results were obtained.
Ijms 23 07341 g008
Table
Table 1. The effect of silencing TaCDPK27 on growth of wheat seedlings under NaCl treatment.
Table 1. The effect of silencing TaCDPK27 on growth of wheat seedlings under NaCl treatment.
TreatmentsRoot LengthLeaf Length
CK36.50 ± 0.860 a31.10 ± 0.455 a
γG32.07 ± 0.262 b29.23 ± 0.249 b
TaCDPK2730.80 ± 0.170 c27.27 ± 0.287 c
NaCl29.00 ± 0.125 d25.97 ± 0.262 d
γG+NaCl25.77 ± 0.655 e24.33 ± 0.368 e
TaCDPK27+NaCl22.07 ± 0.478 f22.37 ± 0.340 f
Note: The data are shown as mean ± SD (n = 3) of three independent experiments. CK was from wild-type wheat seedlings, γG was from BSMV-VIGS-GFP-inoculated wheat seedlings, and TaCDPK27 was from BSMV-VIGS-TaCDPK27-inoculated wheat seedlings. The data with different letters in same column show significant difference (p < 0.05).
Table
Table 2. The effect of TaCDPK27 silencing on chlorophyll fluorescence parameters of wheat seedlings under NaCl treatment.
Table 2. The effect of TaCDPK27 silencing on chlorophyll fluorescence parameters of wheat seedlings under NaCl treatment.
TreatmentsFv/FmY(II)qPF0NPQETR
CK0.795 ± 0.002 a0.610 ± 0.002 a0.840 ± 0.003 a0.072 ± 0.000 a0.436 ± 0.101 f84.2 ± 0.309 a
γG0.788 ± 0.001 ab0.567 ± 0.001 b0.803 ± 0.002 b0.063 ± 0.004 b0.582 ± 0.016 e78.6 ± 1.717 b
TaCDPK270.779 ± 0.001 b0.525 ± 0.002 c0.759 ± 0.006 c0.057 ± 0.002 c0.762 ± 0.004 d70.6 ± 0.818 c
NaCl0.757 ± 0.001 c0.464 ± 0.001 d0.736 ± 0.003 d0.048 ± 0.001 d0.976 ± 0.003 c65.2 ± 3.626 d
γG+NaCl0.737 ± 0.002 d0.364 ± 0.014 e0.605 ± 0.002 e0.040 ± 0.002 e1.137 ± 0.107 b50.4 ± 1.879 e
TaCDPK27+NaCl0.713 ± 0.016 e0.280 ± 0.043 f0.464 ± 0.004 f0.032 ± 0.001 f1.602 ± 0.052 a38.1 ± 1.306 f
Note: The data are shown as mean ± SD (n = 3) of three independent experiments. CK was from wild type wheat seedlings, γG was from BSMV-VIGS-GFP-inoculated wheat seedlings, and TaCDPK27 was from BSMV-VIGS-TaCDPK27-inoculated wheat seedlings. The data with different letters in same column show significant difference (p < 0.05).
Table
Table 3. Primers used in this paper.
Table 3. Primers used in this paper.
TermGenePrimer Sequences (Forward/Reverse Primer)
ORF amplificationCalcium-dependent protein kinase 27 (TaCDPK27)F:ATGGGCAACGTCTGCGT
R:TTAGCTATTTGACTTTATGTTCAAGGCATCCCT
qRT-PCRTaCDPK27F:GCCGCCTTCCAATACTTT
R:TTATCCTGATCTACTTCGCCTA
Subcellular localizationTaCDPK27F: AAGTCCGGAGCTAGCTCTAGAATGGGCAACGTCTGCGT
R: GCCCTTGCTCACCATGGATCCGCTATTTGACTTTATGTTCAAG
BMSV-VIGSTaCDPK27F: CAAACATTTTTTTTTTTTTTTAGCTAGCGCCGCCTTCCAATACTTT
R:GATTCTTCTTCCGTTGCTAGCTTATCCTGATCTACTTCGCCTA
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations.

Share and Cite

MDPI and ACS Style

Yue, J.-Y.; Jiao, J.-L.; Wang, W.-W.; Wang, H.-Z. The Calcium-Dependent Protein Kinase TaCDPK27 Positively Regulates Salt Tolerance in Wheat. Int. J. Mol. Sci. 2022, 23, 7341. https://doi.org/10.3390/ijms23137341

AMA Style

Yue J-Y, Jiao J-L, Wang W-W, Wang H-Z. The Calcium-Dependent Protein Kinase TaCDPK27 Positively Regulates Salt Tolerance in Wheat. International Journal of Molecular Sciences. 2022; 23(13):7341. https://doi.org/10.3390/ijms23137341

Chicago/Turabian Style

Yue, Jie-Yu, Jin-Lan Jiao, Wen-Wen Wang, and Hua-Zhong Wang. 2022. "The Calcium-Dependent Protein Kinase TaCDPK27 Positively Regulates Salt Tolerance in Wheat" International Journal of Molecular Sciences 23, no. 13: 7341. https://doi.org/10.3390/ijms23137341

Note that from the first issue of 2016, this journal uses article numbers instead of page numbers. See further details here.

Article Metrics

Back to TopTop