Effects of the Lipid Profile, Type 2 Diabetes and Medication on the Metabolic Syndrome—Associated Gut Microbiome
Abstract
:1. Introduction
2. Results
2.1. Clinical Characteristics of the Enrolled Subjects
2.2. Diversity Patterns in MetSyn Patients
3. Discussion
4. Materials and Methods
4.1. Patients
4.2. DNA Isolation
4.3. Culture-Independent Analysis of Stool Samples
4.3.1. 16S rRNA Amplification and Sequencing
4.3.2. Bioinformatics
4.3.3. Statistical Analysis of Sequencing Data
4.3.4. qPCR
4.4. SCFAs Quantification
Statistical Analysis
Supplementary Materials
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Fahed, G.; Aoun, L.; Zerdan, M.B.; Allam, S.; Zerdan, M.B.; Bouferraa, Y.; Assi, H.I. Metabolic Syndrome: Updates on Pathophysiology and Management in 2021. Int. J. Mol. Sci. 2022, 23, 786. [Google Scholar] [CrossRef] [PubMed]
- Bozkurt, B.; Aguilar, D.; Deswal, A.; Dunbar, S.B.; Francis, G.S.; Horwich, T.; Jessup, M.; Kosiborod, M.; Pritchett, A.M.; Ramasubbu, K.; et al. Contributory Risk and Management of Comorbidities of Hypertension, Obesity, Diabetes Mellitus, Hyperlipidemia, and Metabolic Syndrome in Chronic Heart Failure: A Scientific Statement from the American Heart Association. Circulation 2016, 134, e535–e578. [Google Scholar] [CrossRef] [PubMed]
- Oda, E. Historical perspectives of the metabolic syndrome. Clin. Dermatol. 2018, 36, 3–8. [Google Scholar] [CrossRef] [PubMed]
- Wang, P.-X.; Deng, X.-R.; Zhang, C.-H.; Yuan, H.-J. Gut microbiota and metabolic syndrome. Chin. Med. J. 2020, 133, 808–816. [Google Scholar] [CrossRef] [PubMed]
- Gildner, T.E. Links between metabolic syndrome and the microbiome. Evol. Med. Public Health 2020, 2020, 45–46. [Google Scholar] [CrossRef] [PubMed]
- Mazidi, M.; Rezaie, P.; Kengne, A.P.; Mobarhan, M.G.; Ferns, G.A. Gut microbiome and metabolic syndrome. Diabetes Metab. Syndr. Clin. Res. Rev. 2016, 10, S150–S157. [Google Scholar] [CrossRef]
- Deschasaux, M.; Bouter, K.; Prodan, A.; Levin, E.; Groen, A.; Herrema, H.; Tremaroli, V.; Snijder, M.; Nicolaou, M.; Zwinderman, A.; et al. Differences in gut microbiota composition in metabolic syndrome and type 2 diabetes subjects in a multi-ethnic population: The HELIUS study. Proc. Nutr. Soc. 2020, 79, E183. [Google Scholar] [CrossRef]
- Qin, Q.; Yan, S.; Yang, Y.; Chen, J.; Li, T.; Gao, X.; Yan, H.; Wang, Y.; Wang, J.; Wang, S.; et al. A Metagenome-Wide Association Study of the Gut Microbiome and Metabolic Syndrome. Front. Microbiol. 2021, 12, 682721. [Google Scholar] [CrossRef]
- Vrieze, A.; Van Nood, E.; Holleman, F.; Salojärvi, J.; Kootte, R.S.; Bartelsman, J.F.; Dallinga-Thie, G.M.; Ackermans, M.T.; Serlie, M.J.; Oozeer, R.; et al. Transfer of Intestinal Microbiota From Lean Donors Increases Insulin Sensitivity in Individuals With Metabolic Syndrome. Gastroenterology 2012, 143, 913–916.e7, Erratum in Gastroenterology 2013, 144, 250. [Google Scholar] [CrossRef]
- Pichler, M.J.; Yamada, C.; Shuoker, B.; Alvarez-Silva, C.; Gotoh, A.; Leth, M.L.; Schoof, E.; Katoh, T.; Sakanaka, M.; Katayama, T.; et al. Butyrate producing colonic Clostridiales metabolise human milk oligosaccharides and cross feed on mucin via conserved pathways. Nat. Commun. 2020, 11, 3285. [Google Scholar] [CrossRef]
- Van Hul, M.; Le Roy, T.; Prifti, E.; Dao, M.C.; Paquot, A.; Zucker, J.-D.; Delzenne, N.M.; Muccioli, G.G.; Clément, K.; Cani, P.D. From correlation to causality: The case of Subdoligranulum. Gut Microbes 2020, 12, 1849998. [Google Scholar] [CrossRef] [PubMed]
- Ottman, N.; Davids, M.; Suarez-Diez, M.; Boeren, S.; Schaap, P.J.; dos Santos, V.A.P.M.; Smidt, H.; Belzer, C.; de Vos, W.M. Genome-Scale Model and Omics Analysis of Metabolic Capacities of Akkermansia muciniphila Reveal a Preferential Mucin-Degrading Lifestyle. Appl. Environ. Microbiol. 2017, 83, e01014-17. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Nguyen, L.N.; Lopes, L.C.L.; Cordero, R.J.B.; Nosanchuk, J.D. Sodium butyrate inhibits pathogenic yeast growth and enhances the functions of macrophages. J. Antimicrob. Chemother. 2011, 66, 2573–2580. [Google Scholar] [CrossRef]
- Lazar, V.; Ditu, L.-M.; Pircalabioru, G.G.; Gheorghe, I.; Curutiu, C.; Holban, A.M.; Picu, A.; Petcu, L.; Chifiriuc, M.C. Aspects of Gut Microbiota and Immune System Interactions in Infectious Diseases, Immunopathology, and Cancer. Front. Immunol. 2018, 9, 1830. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Michels, N.; Zouiouich, S.; Vanderbauwhede, B.; Vanacker, J.; Ruiz, B.I.I.; Huybrechts, I. Human microbiome and metabolic health: An overview of systematic reviews. Obes. Rev. 2022, 23, e13409. [Google Scholar] [CrossRef] [PubMed]
- Ott, S.J.; Musfeldt, M.; Wenderoth, D.F.; Hampe, J.; Brant, O.; Fölsch, U.R.; Timmis, K.N.; Schreiber, S. Reduction in diversity of the colonic mucosa associated bacterial microflora in patients with active inflammatory bowel disease. Gut 2004, 53, 685–693. [Google Scholar] [CrossRef] [Green Version]
- Michail, S.; Durbin, M.; Turner, D.; Griffiths, A.M.; Mack, D.R.; Hyams, J.; Leleiko, N.; Kenche, H.; Stolfi, A.; Wine, E. Alterations in the gut microbiome of children with severe ulcerative colitis. Inflamm. Bowel Dis. 2012, 18, 1799–1808. [Google Scholar] [CrossRef]
- Le Chatelier, E.; Nielsen, T.; Qin, J.; Prifti, E.; Hildebrand, F.; Falony, G.; Almeida, M.; Arumugam, M.; Batto, J.-M.; Kennedy, S.; et al. Richness of human gut microbiome correlates with metabolic markers. Nature 2013, 500, 541–546. [Google Scholar] [CrossRef]
- Nakaya, K.; Ikewaki, K. Microbiota and HDL metabolism. Curr. Opin. Lipidol. 2018, 29, 18–23. [Google Scholar] [CrossRef]
- Vojinovic, D.; Radjabzadeh, D.; Kurilshikov, A.; Amin, N.; Wijmenga, C.; Franke, L.; Ikram, M.A.; Uitterlinden, A.G.; Zhernakova, A.; Fu, J.; et al. Relationship between Gut Microbiota and Circulating Metabolites in Population-Based Cohorts. Nat. Commun. 2019, 10, 5813. [Google Scholar] [CrossRef] [Green Version]
- Jones, M.L.; Martoni, C.J.; Prakash, S. Cholesterol lowering and inhibition of sterol absorption by Lactobacillus reuteri NCIMB 30242: A randomized controlled trial. Eur. J. Clin. Nutr. 2012, 66, 1234–1241. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Fu, J.; Bonder, M.J.; Cenit, M.C.; Tigchelaar, E.F.; Maatman, A.; Dekens, J.A.M.; Brandsma, E.; Marczynska, J.; Imhann, F.; Weersma, R.K.; et al. The Gut Microbiome Contributes to a Substantial Proportion of the Variation in Blood Lipids. Circ. Res. 2015, 117, 817–824. [Google Scholar] [CrossRef] [PubMed]
- Holmstrøm, K.; Collins, M.D.; Møller, T.; Falsen, E.; Lawson, P.A. Subdoligranulum variabile gen. nov., sp. nov. from human feces. Anaerobe 2004, 10, 197–203. [Google Scholar] [CrossRef]
- Kaakoush, N.O.; Day, A.S.; Huinao, K.D.; Leach, S.T.; Lemberg, D.A.; Dowd, S.E.; Mitchell, H.M. Microbial Dysbiosis in Pediatric Patients with Crohn’s Disease. J. Clin. Microbiol. 2012, 50, 3258–3266. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Sokol, H.; Pigneur, B.; Watterlot, L.; Lakhdari, O.; Bermúdez-Humaran, L.G.; Gratadoux, J.-J.; Blugeon, S.; Bridonneau, C.; Furet, J.-P.; Corthier, G.; et al. Faecalibacterium prausnitzii is an anti-inflammatory commensal bacterium identified by gut microbiota analysis of Crohn disease patients. Proc. Natl. Acad. Sci. USA 2008, 105, 16731–16736. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Duncan, S.H.; Barcenilla, A.; Stewart, C.S.; Pryde, S.E.; Flint, H.J. Acetate Utilization and Butyryl Coenzyme A (CoA):Acetate-CoA Transferase in Butyrate-Producing Bacteria from the Human Large Intestine. Appl. Environ. Microbiol. 2002, 68, 5186–5190. [Google Scholar] [CrossRef] [Green Version]
- Derrien, M.; Belzer, C.; de Vos, W.M. Akkermansia muciniphila and its role in regulating host functions. Microb. Pathog. 2017, 106, 171–181. [Google Scholar] [CrossRef] [Green Version]
- Belzer, C.; De Vos, W.M. Microbes inside—From diversity to function: The case of Akkermansia. ISME J. 2012, 6, 1449–1458. [Google Scholar] [CrossRef]
- Zhou, Q.; Pang, G.; Zhang, Z.; Yuan, H.; Chen, C.; Zhang, N.; Yang, Z.; Sun, L. Association Between Gut Akkermansia and Metabolic Syndrome is Dose-Dependent and Affected by Microbial Interactions: A Cross-Sectional Study. Diabetes Metab. Syndr. Obes. Targets Ther. 2021, 14, 2177–2188. [Google Scholar] [CrossRef]
- Hippe, B.; Remely, M.; Aumueller, E.; Pointner, A.; Magnet, U.; Haslberger, A. Faecalibacterium prausnitzii phylotypes in type two diabetic, obese, and lean control subjects. Benef. Microbes 2016, 7, 511–517. [Google Scholar] [CrossRef]
- Ganesan, K.; Chung, S.K.; Vanamala, J.; Xu, B. Causal Relationship between Diet-Induced Gut Microbiota Changes and Diabetes: A Novel Strategy to Transplant Faecalibacterium prausnitzii in Preventing Diabetes. Int. J. Mol. Sci. 2018, 19, 3720. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Bar, N.; Korem, T.; Weissbrod, O.; Zeevi, D.; Rothschild, D.; Leviatan, S.; Kosower, N.; Lotan-Pompan, M.; Weinberger, A.; Le Roy, C.I.; et al. A reference map of potential determinants for the human serum metabolome. Nature 2020, 588, 135–140. [Google Scholar] [CrossRef] [PubMed]
- Bhute, S.; Suryavanshi, M.V.; Joshi, S.M.; Yajnik, C.S.; Shouche, Y.S.; Ghaskadbi, S.S. Gut Microbial Diversity Assessment of Indian Type-2-Diabetics Reveals Alterations in Eubacteria, Archaea, and Eukaryotes. Front. Microbiol. 2017, 8, 214. [Google Scholar] [CrossRef]
- Karlsson, F.H.; Tremaroli, V.; Nookaew, I.; Bergström, G.; Behre, C.J.; Fagerberg, B.; Nielsen, J.; Bäckhed, F. Gut metagenome in European women with normal, impaired and diabetic glucose control. Nature 2013, 498, 99–103. [Google Scholar] [CrossRef] [PubMed]
- Yassour, M.; Lim, M.Y.; Yun, H.S.; Tickle, T.L.; Sung, J.; Song, Y.-M.; Lee, K.; Franzosa, E.A.; Morgan, X.C.; Gevers, D.; et al. Sub-clinical detection of gut microbial biomarkers of obesity and type 2 diabetes. Genome Med. 2016, 8, 17. [Google Scholar] [CrossRef] [Green Version]
- Li, J.; Zhao, F.; Wang, Y.; Chen, J.; Tao, J.; Tian, G.; Wu, S.; Liu, W.; Cui, Q.; Geng, B.; et al. Gut microbiota dysbiosis contributes to the development of hypertension. Microbiome 2017, 5, 14. [Google Scholar] [CrossRef] [Green Version]
- Depommier, C.; Everard, A.; Druart, C.; Plovier, H.; Van Hul, M.; Vieira-Silva, S.; Falony, G.; Raes, J.; Maiter, D.; Delzenne, N.M.; et al. Supplementation with Akkermansia muciniphila in overweight and obese human volunteers: A proof-of-concept exploratory study. Nat. Med. 2019, 25, 1096–1103. [Google Scholar] [CrossRef]
- Jain, U.; Heul, A.M.V.; Xiong, S.; Gregory, M.H.; Demers, E.G.; Kern, J.T.; Lai, C.-W.; Muegge, B.D.; Barisas, D.A.G.; Leal-Ekman, J.S.; et al. Debaryomyces is enriched in Crohn’s disease intestinal tissue and impairs healing in mice. Science 2021, 371, 1154–1159. [Google Scholar] [CrossRef]
- Blandino, G.; Inturri, R.; Lazzara, F.; Di Rosa, M.; Malaguarnera, L. Impact of gut microbiota on diabetes mellitus. Diabetes Metab. 2016, 42, 303–315. [Google Scholar] [CrossRef]
- Gao, J.; Yan, K.-T.; Wang, J.-X.; Dou, J.; Wang, J.; Ren, M.; Ma, J.; Zhang, X.; Liu, Y. Gut microbial taxa as potential predictive biomarkers for acute coronary syndrome and post-STEMI cardiovascular events. Sci. Rep. 2020, 10, 2639. [Google Scholar] [CrossRef]
- Tomizawa, H.; Park, J.; Matsumoto, N.; Hosomi, K.; Kawashima, H.; Mizuguchi, K.; Kunisawa, J.; Honda, C. Relationship between Human Gut Microbiota and Nutrition Intake in Hypertensive Discordant Monozygotic Twins. J. Hypertens. 2021, 10, 1–9. [Google Scholar]
- Le Roy, T.; de Hase, E.M.; Van Hul, M.; Paquot, A.; Pelicaen, R.; Régnier, M.; Depommier, C.; Druart, C.; Everard, A.; Maiter, D.; et al. Dysosmobacter welbionis is a newly isolated human commensal bacterium preventing diet-induced obesity and metabolic disorders in mice. Gut 2021, 71, 534–543. [Google Scholar] [CrossRef] [PubMed]
- Lippert, K.; Kedenko, L.; Antonielli, L.; Gemeier, C.; Leitner, M.; Kautzky-Willer, A.; Paulweber, B.; Hackl, E. Gut microbiota dysbiosis associated with glucose metabolism disorders and the metabolic syndrome in older adults. Benef. Microbes 2017, 8, 545–556. [Google Scholar] [CrossRef] [PubMed]
- Tang, R.; Jiang, Y.; Tan, A.; Ye, J.; Xian, X.; Xie, Y.; Wang, Q.; Yao, Z.; Mo, Z. 16S rRNA gene sequencing reveals altered composition of gut microbiota in individuals with kidney stones. Urolithiasis 2018, 46, 503–514. [Google Scholar] [CrossRef] [PubMed]
- Sheridan, P.; Martin, J.C.; Lawley, T.D.; Browne, H.; Harris, H.M.B.; Bernalier-Donadille, A.; Duncan, S.; O’Toole, P.W.; Scott, K.P.; Flint, H.J. Polysaccharide utilization loci and nutritional specialization in a dominant group of butyrate-producing human colonic Firmicutes. Microb. Genom. 2016, 2, e000043. [Google Scholar] [CrossRef] [PubMed]
- Qin, J.; Li, Y.; Cai, Z.; Li, S.; Zhu, J.; Zhang, F.; Liang, S.; Zhang, W.; Guan, Y.; Shen, D.; et al. A metagenome-wide association study of gut microbiota in type 2 diabetes. Nature 2012, 490, 55–60. [Google Scholar] [CrossRef]
- Chakravarthy, S.K.; Jayasudha, R.; Prashanthi, G.S.; Ali, M.H.; Sharma, S.; Tyagi, M.; Shivaji, S. Dysbiosis in the Gut Bacterial Microbiome of Patients with Uveitis, an Inflammatory Disease of the Eye. Indian J. Microbiol. 2018, 58, 457–469. [Google Scholar] [CrossRef]
- Khattab, M.S.; El Tawab, A.M.A.; Fouad, M.T. Isolation and Characterization of Anaerobic Bacteria from Frozen Rumen Liquid and its Potential Characterizations. Int. J. Dairy Sci. 2016, 12, 47–51. [Google Scholar] [CrossRef] [Green Version]
- Odamaki, T.; Kato, K.; Sugahara, H.; Hashikura, N.; Takahashi, S.; Xiao, J.-Z.; Abe, F.; Osawa, R. Age-related changes in gut microbiota composition from newborn to centenarian: A cross-sectional study. BMC Microbiol. 2016, 16, 90. [Google Scholar] [CrossRef] [Green Version]
- Nakayama, J.; Watanabe, K.; Jiang, J.; Matsuda, K.; Chao, S.-H.; Haryono, P.; La-Ongkham, O.; Sarwoko, M.-A.; Sujaya, I.N.; Zhao, L.; et al. Diversity in gut bacterial community of school-age children in Asia. Sci. Rep. 2015, 5, 8397. [Google Scholar] [CrossRef] [Green Version]
- Mao, B.; Gu, J.; Li, D.; Cui, S.; Zhao, J.; Zhang, H.; Chen, W. Effects of Different Doses of Fructooligosaccharides (FOS) on the Composition of Mice Fecal Microbiota, Especially the Bifidobacterium Composition. Nutrients 2018, 10, 1105. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Craven, M.; Egan, C.E.; Dowd, S.; McDonough, S.P.; Dogan, B.; Denkers, E.Y.; Bowman, D.; Scherl, E.J.; Simpson, K.W. Inflammation Drives Dysbiosis and Bacterial Invasion in Murine Models of Ileal Crohn’s Disease. PLoS ONE 2012, 7, e41594. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Chen, W.; Liu, F.; Ling, Z.; Tong, X.; Xiang, C. Human Intestinal Lumen and Mucosa-Associated Microbiota in Patients with Colorectal Cancer. PLoS ONE 2012, 7, e39743. [Google Scholar] [CrossRef]
- Turnbaugh, P.J.; Bäckhed, F.; Fulton, L.; Gordon, J.I. Diet-Induced Obesity Is Linked to Marked but Reversible Alterations in the Mouse Distal Gut Microbiome. Cell Host Microbe 2008, 3, 213–223. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Zhang, H.; DiBaise, J.K.; Zuccolo, A.; Kudrna, D.; Braidotti, M.; Yu, Y.; Parameswaran, P.; Crowell, M.D.; Wing, R.; Rittmann, B.E.; et al. Human Gut Microbiota in Obesity and after Gastric Bypass. Proc. Natl. Acad. Sci. USA 2009, 106, 2365–2370. [Google Scholar] [CrossRef] [Green Version]
- Zhang, X.; Shen, D.; Fang, Z.; Jie, Z.; Qiu, X.; Zhang, C.; Chen, Y.; Ji, L. Human Gut Microbiota Changes Reveal the Progression of Glucose Intolerance. PLoS ONE 2013, 8, e71108. [Google Scholar] [CrossRef]
- Yamaguchi, Y.; Adachi, K.; Sugiyama, T.; Shimozato, A.; Ebi, M.; Ogasawara, N.; Funaki, Y.; Goto, C.; Sasaki, M.; Kasugai, K. Association of Intestinal Microbiota with Metabolic Markers and Dietary Habits in Patients with Type 2 Diabetes. Digestion 2016, 94, 66–72. [Google Scholar] [CrossRef] [PubMed]
- Singh, R.; Zogg, H.; Wei, L.; Bartlett, A.; Ghoshal, U.C.; Rajender, S.; Ro, S. Gut Microbial Dysbiosis in the Pathogenesis of Gastrointestinal Dysmotility and Metabolic Disorders. J. Neurogastroenterol. Motil. 2021, 27, 19–34. [Google Scholar] [CrossRef]
- Munukka, E.; Wiklund, P.; Pekkala, S.; Völgyi, E.; Xu, L.; Cheng, S.; Lyytikäinen, A.; Marjomäki, V.; Alen, M.; Vaahtovuo, J.; et al. Women With and Without Metabolic Disorder Differ in Their Gut Microbiota Composition. Obesity 2012, 20, 1082–1087. [Google Scholar] [CrossRef]
- Wu, H.; Esteve, E.; Tremaroli, V.; Khan, M.T.; Caesar, R.; Mannerås-Holm, L.; Ståhlman, M.; Olsson, L.M.; Serino, M.; Planas-Fèlix, M.; et al. Metformin alters the gut microbiome of individuals with treatment-naive type 2 diabetes, contributing to the therapeutic effects of the drug. Nat. Med. 2017, 23, 850–858. [Google Scholar] [CrossRef]
- Murphy, R.; Tsai, P.; Jüllig, M.; Liu, A.; Plank, L.; Booth, M. Differential Changes in Gut Microbiota After Gastric Bypass and Sleeve Gastrectomy Bariatric Surgery Vary According to Diabetes Remission. Obes. Surg. 2016, 27, 917–925. [Google Scholar] [CrossRef] [PubMed]
- Sun, L.; Xie, C.; Wang, G.; Wu, Y.; Wu, Q.; Wang, X.; Liu, J.; Deng, Y.; Xia, J.; Chen, B.; et al. Gut microbiota and intestinal FXR mediate the clinical benefits of metformin. Nat. Med. 2018, 24, 1919–1929. [Google Scholar] [CrossRef] [PubMed]
- Cano, P.; Santacruz, A.; Moya, Á.; Sanz, Y.; Olds, W. Bacteroides uniformis CECT 7771 Ameliorates Metabolic and Immunological Dysfunction in Mice with High-Fat-Diet Induced Obesity. PLoS ONE 2012, 7, e41079. [Google Scholar] [CrossRef] [Green Version]
- Yang, J.-Y.; Lee, Y.-S.; Kim, Y.; Lee, S.-H.; Ryu, S.; Fukuda, S.; Hase, K.; Yang, C.-S.; Lim, H.S.; Kim, M.-S.; et al. Gut commensal Bacteroides acidifaciens prevents obesity and improves insulin sensitivity in mice. Mucosal. Immunol. 2016, 10, 104–116. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Davies, M.J.; D’Alessio, D.A.; Fradkin, J.; Kernan, W.N.; Mathieu, C.; Mingrone, G.; Rossing, P.; Tsapas, A.; Wexler, D.J.; Buse, J.B. Management of Hyperglycemia in Type 2 Diabetes, 2018. A Consensus Report by the American Diabetes Association (ADA) and the European Association for the Study of Diabetes (EASD). Diabetes Care 2018, 41, 2669–2701. [Google Scholar] [CrossRef] [Green Version]
- De la Cuesta-Zuluaga, J.; Mueller, N.T.; Corrales-Agudelo, V.; Velásquez-Mejía, E.P.; Carmona, J.A.; Abad, J.M.; Escobar, J.S. Metformin Is Associated with Higher Relative Abundance of Mucin-Degrading Akkermansia muciniphilaand Several Short-Chain Fatty Acid–Producing Microbiota in the Gut. Diabetes Care 2017, 40, 54–62. [Google Scholar] [CrossRef] [Green Version]
- Vallianou, N.G.; Stratigou, T.; Tsagarakis, S. Metformin and gut microbiota: Their interactions and their impact on diabetes. Hormones 2019, 18, 141–144. [Google Scholar] [CrossRef]
- Mueller, N.T.; Differding, M.K.; Zhang, M.; Maruthur, N.M.; Juraschek, S.P.; Miller, E.R., III; Appel, L.J.; Yeh, H.-C. Metformin Affects Gut Microbiome Composition and Function and Circulating Short-Chain Fatty Acids: A Randomized Trial. Diabetes Care 2021, 44, 1462–1471. [Google Scholar] [CrossRef]
- Forslund, K.; Hildebrand, F.; Nielsen, T.; Falony, G.; Le Chatelier, E.; Sunagawa, S.; Prifti, E.; Vieira-Silva, S.; Gudmundsdottir, V.; Krogh Pedersen, H.; et al. Disentangling the effects of type 2 diabetes and metformin on the human gut microbiota. Nature 2015, 528, 262–266. [Google Scholar] [CrossRef]
- Lee, H.; Ko, G. Effect of Metformin on Metabolic Improvement and Gut Microbiota. Appl. Environ. Microbiol. 2014, 80, 5935–5943. [Google Scholar] [CrossRef] [Green Version]
- Graf, J. The Family Rikenellaceae. In The Prokaryotes; Springer: Berlin/Heidelberg, Germany, 2014; pp. 857–859. [Google Scholar] [CrossRef]
- Lin, H.; Meng, L.; Sun, Z.; Sun, S.; Huang, X.; Lin, N.; Zhang, J.; Lu, W.; Yang, Q.; Chi, J.; et al. Yellow Wine Polyphenolic Compound Protects Against Doxorubicin-Induced Cardiotoxicity by Modulating the Composition and Metabolic Function of the Gut Microbiota. Circ. Heart Fail. 2021, 14, e008220. [Google Scholar] [CrossRef] [PubMed]
- Okeke, F.; Roland, B.C.; Mullin, G.E. The Role of the gut Microbiome in the Pathogenesis and Treatment of Obesity. Glob. Adv. Health Med. 2014, 3, 44–57. [Google Scholar] [CrossRef] [Green Version]
- Sun, L.; Jia, H.; Li, J.; Yu, M.; Yang, Y.; Tian, D.; Zhang, H.; Zou, Z. Cecal Gut Microbiota and Metabolites Might Contribute to the Severity of Acute Myocardial Ischemia by Impacting the Intestinal Permeability, Oxidative Stress, and Energy Metabolism. Front. Microbiol. 2019, 10, 1745. [Google Scholar] [CrossRef] [Green Version]
- Clemente, J.C.; Pehrsson, E.C.; Blaser, M.J.; Sandhu, K.; Gao, Z.; Wang, B.; Magris, M.; Hidalgo, G.; Contreras, M.; Noya-Alarcón, Ó.; et al. The microbiome of uncontacted Amerindians. Sci. Adv. 2015, 1, e1500183. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Kovatcheva-Datchary, P.; Nilsson, A.; Akrami, R.; Lee, Y.S.; De Vadder, F.; Arora, T.; Hallen, A.; Martens, E.; Björck, I.; Bäckhed, F. Dietary Fiber-Induced Improvement in Glucose Metabolism Is Associated with Increased Abundance of Prevotella. Cell Metab. 2015, 22, 971–982. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Pedersen, H.K.; Gudmundsdottir, V.; Nielsen, H.B.; Hyotylainen, T.; Nielsen, T.; Jensen, B.A.H.; Forslund, K.; Hildebrand, F.; Prifti, E.; Falony, G.; et al. Human gut microbes impact host serum metabolome and insulin sensitivity. Nature 2016, 535, 376–381. [Google Scholar] [CrossRef] [PubMed]
- Leite, A.Z.; Rodrigues, N.D.; Gonzaga, M.I.; Paiolo, J.C.; de Souza, C.A.; Stefanutto, N.A.; Omori, W.P.; Pinheiro, D.G.; Brisotti, J.L.; Matheucci, E., Jr.; et al. Detection of Increased Plasma Interleukin-6 Levels and Prevalence of Prevotella copri and Bacteroides vulgatus in the Feces of Type 2 Diabetes Patients. Front. Immunol. 2017, 8, 1107. [Google Scholar] [CrossRef]
- Fugmann, M.; Breier, M.; Rottenkolber, M.; Banning, F.; Ferrari, U.; Sacco, V.; Grallert, H.; Parhofer, K.G.; Seissler, J.; Clavel, T.; et al. The stool microbiota of insulin resistant women with recent gestational diabetes, a high risk group for type 2 diabetes. Sci. Rep. 2015, 5, 13212. [Google Scholar] [CrossRef]
- Díaz-Perdigones, C.M.; Muñoz-Garach, A.; Álvarez-Bermúdez, M.D.; Moreno-Indias, I.; Tinahones, F.J. Gut microbiota of patients with type 2 diabetes and gastrointestinal intolerance to metformin differs in composition and functionality from tolerant patients. Biomed. Pharmacother. 2021, 145, 112448. [Google Scholar] [CrossRef]
- Zuo, T.; Wu, X.; Wen, W.; Lan, P. Gut Microbiome Alterations in COVID-19. Genom. Proteom. Bioinform. 2021, 19, 679–688. [Google Scholar] [CrossRef]
- Alberti, K.G.M.M.; Zimmet, P.; Shaw, J. Metabolic syndrome—A new world-wide definition. A Consensus Statement from the International Diabetes Federation. Diabet. Med. 2006, 23, 469–480. [Google Scholar] [CrossRef] [PubMed]
- D’Amore, R.; Ijaz, U.Z.; Schirmer, M.; Kenny, J.G.; Gregory, R.; Darby, A.; Shakya, M.; Podar, M.; Quince, C.; Hall, N. A comprehensive benchmarking study of protocols and sequencing platforms for 16S rRNA community profiling. BMC Genom. 2016, 17, 55. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Rognes, T.; Flouri, T.; Nichols, B.; Quince, C.; Mahé, F. VSEARCH: A versatile open source tool for metagenomics. PeerJ 2016, 4, e2584. [Google Scholar] [CrossRef] [PubMed]
- Joshi, N.A.; Fass, J.N. Sickle: A Sliding-Window, Adaptive, Quality-Based Trimming Tool for FastQ Files. Version 1.33. 2011. Available online: https://github.com/najoshi/sickle (accessed on 18 August 2021).
- Nikolenko, S.I.; Korobeynikov, A.I.; Alekseyev, M.A. BayesHammer: Bayesian clustering for error correction in single-cell sequencing. BMC Genom. 2013, 14, S7. [Google Scholar] [CrossRef] [Green Version]
- Masella, A.P.; Bartram, A.K.; Truszkowski, J.M.; Brown, D.G.; Neufeld, J.D. PANDAseq: Paired-end assembler for illumina sequences. BMC Bioinform. 2012, 13, 31. [Google Scholar] [CrossRef] [Green Version]
- Bolyen, E.; Rideout, J.R.; Dillon, M.R.; Bokulich, N.A.; Abnet, C.C.; Al-Ghalith, G.A.; Alexander, H.; Alm, E.J.; Arumugam, M.; Asnicar, F.; et al. Reproducible, Interactive, Scalable and Extensible Microbiome Data Science using QIIME 2. Nat. Biotechnol. 2019, 37, 852–857. [Google Scholar] [CrossRef] [PubMed]
- Quast, C.; Pruesse, E.; Yilmaz, P.; Gerken, J.; Schweer, T.; Yarza, P.; Peplies, J.; Glöckner, F.O. The SILVA Ribosomal RNA Gene Database Project: Improved Data Processing and Web-Based Tools. Nucleic Acids Res. 2013, 41, D590–D596. [Google Scholar] [CrossRef]
- Katoh, K.; Standley, D.M. MAFFT Multiple Sequence Alignment Software Version 7: Improvements in Performance and Usability. Mol. Biol. Evol. 2013, 30, 772–780. [Google Scholar] [CrossRef] [Green Version]
- Price, M.N.; Dehal, P.S.; Arkin, A.P. FastTree 2—Approximately Maximum-Likelihood Trees for Large Alignments. PLoS ONE 2010, 5, e9490. [Google Scholar] [CrossRef]
- McMurdie, P.J.; Holmes, S. phyloseq: An R package for reproducible interactive analysis and graphics of microbiome census data. PLoS ONE 2013, 8, e61217. [Google Scholar] [CrossRef] [Green Version]
- Ijaz, U.Z.; Sivaloganathan, L.; McKenna, A.; Richmond, A.; Kelly, C.; Linton, M.; Stratakos, A.C.; Lavery, U.; Elmi, A.; Wren, B.W.; et al. Comprehensive Longitudinal Microbiome Analysis of the Chicken Cecum Reveals a Shift From Competitive to Environmental Drivers and a Window of Opportunity for Campylobacter. Front. Microbiol. 2018, 9, 2452. [Google Scholar] [CrossRef] [PubMed]
- McKenna, A.; Ijaz, U.Z.; Kelly, C.; Linton, M.; Sloan, W.T.; Green, B.D.; Lavery, U.; Dorrell, N.; Wren, B.W.; Richmond, A.; et al. Impact of industrial production system parameters on chicken microbiomes: Mechanisms to improve performance and reduce Campylobacter. Microbiome 2020, 8, 128. [Google Scholar] [CrossRef] [PubMed]
- Oksanen, J.; Blanchet, F.G.; Kindt, R.; Legendre, P.; Minchin, P.R.; O’Hara, R.B.; Wagner, H. Vegan: Community Ecology Package. R Package Version 2.2-1. 2015. Available online: https://www.researchgate.net/publication/279917043_vegan_Community_Ecology_Package_R_Package_Version_22-1 (accessed on 1 June 2022).
- Legendre, P.; De Cáceres, M. Beta diversity as the variance of community data: Dissimilarity coefficients and partitioning. Ecol. Lett. 2013, 16, 951–963. [Google Scholar] [CrossRef] [PubMed]
- Dray, S.; Blanchet, G.; Borcard, D.; Clappe, S.; Guenard, G.; Jombart, T.; LAroque, G.; Legendre, P.; Madi, N.; Wagner, H.H. Adespatial: Multivariate Multiscale Spatial Analysis, 0.0–9 ed. 2018. Available online: https://CRAN.R-project.org/package=adespatial (accessed on 18 May 2022).
- Kembel, S.W.; Cowan, P.D.; Helmus, M.R.; Cornwell, W.K.; Morlon, H.; Ackerly, D.D.; Blomberg, S.P.; Webb, C.O. Picante: R tools for integrating phylogenies and ecology. Bioinformatics 2010, 26, 1463–1464. [Google Scholar] [CrossRef] [Green Version]
- Shetty, S.A.; Hugenholtz, F.; Lahti, L.; Smidt, H.; De Vos, W.M. Intestinal microbiome landscaping: Insight in community assemblage and implications for microbial modulation strategies. FEMS Microbiol. Rev. 2017, 41, 182–199. [Google Scholar] [CrossRef]
- Clarke, K.; Ainsworth, M. A method of linking multivariate community structure to environmental variables. Mar. Ecol. Prog. Ser. 1993, 92, 205–219. [Google Scholar] [CrossRef]
- Taylor, M. sinkr: A Collection of Functions Featured on the Blog ‘Me Nugget’ [Online]. 2014. Available online: https://github.com/menugget/sinkr (accessed on 20 August 2021).
- Love, M.I.; Huber, W.; Anders, S. Moderated estimation of fold change and dispersion for RNA-seq data with DESeq2. Genome Biol. 2014, 15, 550. [Google Scholar] [CrossRef] [Green Version]
- Kassambara, A. Machine Learning Essentials: Practical Guide in R; CreateSpace Independent Publishing Platform: Scotts Valley, CA, USA, 2018. [Google Scholar]
- Lumley, T.; Miller, A. Leaps: Regression Subset Selection. R Package Version 2.9. 2009. Available online: http://CRAN.R-project.org/package=leaps (accessed on 1 June 2022).
- Kuhn, M. Building predictive models in R using the caret package. J. Stat. Softw. 2008, 28, 1–26. [Google Scholar] [CrossRef] [Green Version]
- Lüdecke, D. sjPlot: Data Visualization for Statistics in Social Science. R Package Version 2. 2018. Available online: https://strengejacke.github.io/sjPlot/index.html (accessed on 1 June 2022).
- Pircalabioru, G.G.; Ilie, I.; Oprea, L.; Picu, A.; Petcu, L.M.; Burlibasa, L.; Chifiriuc, M.-C.; Musat, M. Microbiome, Mycobiome and Related Metabolites Alterations in Patients with Metabolic Syndrome—A Pilot Study. Metabolites 2022, 12, 218. [Google Scholar] [CrossRef]
- Pircalabioru, G.; Aviello, G.; Kubica, M.; Zhdanov, A.; Paclet, M.-H.; Brennan, L.; Hertzberger, R.; Papkovsky, D.; Bourke, B.; Knaus, U.G. Defensive Mutualism Rescues NADPH Oxidase Inactivation in Gut Infection. Cell Host Microbe 2016, 19, 651–663. [Google Scholar] [CrossRef]
Healthy Control (n = 30) | MetSyn (n = 40) | p Value | |
---|---|---|---|
Gender | 18 females, 12 males | 34 females, 6 males | |
Age | 46 ± 13.98 | 52 ± 12.62 | 0.0645 |
BMI | 24.7 ± 1.363448 | 32.4 ± 4.947618 | p < 0.0001 |
HbAc (%) | 5.4 ± 0.404021 | 6.6 ± 1.402163 | p < 0.0001 |
TG mg/dL | 89 ± 22.63105 | 124 ± 55.69321 | 0.0018 |
HDL mg/dL | 64 ± 3.58 | 48.5 ± 8.290765 | p < 0.0001 |
LDL mg/dL | 98 ± 21.62 | 113.5 ± 36.78805 | 0.0438 |
Df | Sums of Sqs | MeanSqs | F.Model | R2 | Pr (>F) | |
---|---|---|---|---|---|---|
TG | 1 | 0.2346 | 0.23461 | 0.68000 | 0.01065 | 0.854 |
LDL | 1 | 0.3009 | 0.30090 | 0.87214 | 0.01366 | 0.626 |
HDL | 1 | 0.6592 | 0.65924 | 1.91078 | 0.02994 | 0.012 * |
Total cholest. | 1 | 0.4702 | 0.47015 | 1.36272 | 0.02135 | 0.140 |
BMI | 1 | 0.3451 | 0.34508 | 1.00019 | 0.01567 | 0.434 |
Residuals | 58 | 20.0107 | 0.34501 | 0.90872 | ||
Total | 63 | 22.0207 | 1.00000 |
Group Comparison | Subset No | Subset | Correlation of Subset with Full Table (R) | PERMANOVA Subsets (Groups) |
---|---|---|---|---|
MetSyn, Healthy | S1 | Clostridiales + Bacteroides + Ruminococcaceae + Christensenellaceae + Bifidobacterium + Lachnospiraceae + Proteobacteria | 0.00952 | R2 = 0.822 (p > 0.05) |
S2 | Clostridiales + Bacteroides + Ruminococcaceae + Christensenellaceae + Bifidobacterium + Lachnospiraceae + Proteobacteria | 0.00965 | R2 = 0.854 (p > 0.05) | |
S3 | Clostridiales + Bacteroides + Ruminococcaceae + Christensenellaceae + Bifidobacterium + Lachnospiraceae + Proteobacteria | 0.00909 | R2 = 0.874 (p > 0.05) |
OTU | baseMean | log2FoldChange | p-Value | padj | Upregulated |
---|---|---|---|---|---|
OTU_110 (Rikenellaceae RC9 gut group) | 3.17082871 | -2.35288 | 5.82 × 10−5 | 0.004222 | Metformin |
OTU_10 (Prevotella 9) | 6.73972305 | 2.597327 | 3.64 × 10−5 | 0.004222 | Control |
OTU_43 (Bacteroides) | 4.23676835 | 2.348046 | 0.0001 | 0.004725 | Control |
OTU_19 (Bacteroides) | 3.34116511 | −2.4488 | 0.00013 | 0.004725 | Metformin |
OTU_5 (Prevotellaceae) | 6.38379068 | 2.389298 | 0.000202 | 0.005853 | Control |
OTU_11 (Clostridiales) | 5.08918313 | 2.407934 | 0.000484 | 0.011694 | Control |
Taxonomic Target | Sequence |
---|---|
Butyricicoccus spp. | ACCTGAAGAATAAGCTCC |
GATAACGCTTGCTCCCTACGT | |
Akkermansia muciniphila | GCG TAG GCT GTT TCG TAA GTC GTG TGT GAA AG |
GAG TGT TCC CGA TAT CTA CGC ATT TCA | |
rRNA16S | ACT CCT ACG GGA GGC AGC AGT |
ATT ACC GCG GCT GCT GGC | |
F. prausnitzii | CCCTTCAGTGCCGCAGT |
GTCGCAGGATGTCAAGAC | |
ARNr 18S | ATTGGAGGGCAAGTCTGGTG |
CCGATCCCTAGTCGGCATAG | |
Saccharomyces spp. | AGGAGTGCGGTTCTTTG |
TACTTACCGAGGCAAGCTACA | |
Candida spp. | TTTATCAACTTGTCACACCAGA |
ATCCCGCCTTACCACTACCG | |
Debaryomyces spp. | TAACGGGAACAATGGAGGGC |
CAACACCCGATCCCTAGTCG | |
Aspergillus spp. | GTGGAGTGATTTGTCTGCTTAATTG |
TCTAAGGGCATCACAGACCTGTT |
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations. |
© 2022 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Gradisteanu Pircalabioru, G.; Liaw, J.; Gundogdu, O.; Corcionivoschi, N.; Ilie, I.; Oprea, L.; Musat, M.; Chifiriuc, M.-C. Effects of the Lipid Profile, Type 2 Diabetes and Medication on the Metabolic Syndrome—Associated Gut Microbiome. Int. J. Mol. Sci. 2022, 23, 7509. https://doi.org/10.3390/ijms23147509
Gradisteanu Pircalabioru G, Liaw J, Gundogdu O, Corcionivoschi N, Ilie I, Oprea L, Musat M, Chifiriuc M-C. Effects of the Lipid Profile, Type 2 Diabetes and Medication on the Metabolic Syndrome—Associated Gut Microbiome. International Journal of Molecular Sciences. 2022; 23(14):7509. https://doi.org/10.3390/ijms23147509
Chicago/Turabian StyleGradisteanu Pircalabioru, Gratiela, Janie Liaw, Ozan Gundogdu, Nicolae Corcionivoschi, Iuliana Ilie, Luciana Oprea, Madalina Musat, and Mariana-Carmen Chifiriuc. 2022. "Effects of the Lipid Profile, Type 2 Diabetes and Medication on the Metabolic Syndrome—Associated Gut Microbiome" International Journal of Molecular Sciences 23, no. 14: 7509. https://doi.org/10.3390/ijms23147509
APA StyleGradisteanu Pircalabioru, G., Liaw, J., Gundogdu, O., Corcionivoschi, N., Ilie, I., Oprea, L., Musat, M., & Chifiriuc, M.-C. (2022). Effects of the Lipid Profile, Type 2 Diabetes and Medication on the Metabolic Syndrome—Associated Gut Microbiome. International Journal of Molecular Sciences, 23(14), 7509. https://doi.org/10.3390/ijms23147509