KDM4C Contributes to Trophoblast-like Stem Cell Conversion from Porcine-Induced Pluripotent Stem Cells (piPSCs) via Regulating CDX2
Abstract
:1. Introduction
2. Results
2.1. Characterization of the Histone Modifications in the E-piPSCs
2.2. Characterization of the Histone Demethylase KDM4C
2.3. CDX2 Is the Key Target of KDM4C
3. Discussion
4. Materials and Methods
4.1. piPSC Culture
4.2. RNA Extraction and Quantitative Real-Time Polymerase Chain Reaction (qRT-PCR) Analysis
4.3. Alkaline Phosphatase (AP) Staining
4.4. Immunofluorescence
4.5. Western Blot Analysis
4.6. Vector Construction and Virus Infection
4.7. KDM4C Inhibitor Treatment
4.8. Immunoprecipitates–MS Analysis
4.9. Statistical Analyses
5. Conclusions
Supplementary Materials
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Haider, S.; Meinhardt, G.; Saleh, L.; Kunihs, V.; Gamperl, M.; Kaindl, U.; Ellinger, A.; Burkard, T.R.; Fiala, C.; Pollheimer, J.; et al. Self-Renewing Trophoblast Organoids Recapitulate the Developmental Program of the Early Human Placenta. Stem Cell Rep. 2018, 11, 537–551. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Malhotra, S.S.; Gupta, S.K. Relevance of the NR4A sub-family of nuclear orphan receptors in trophoblastic BeWo cell differentiation. Cell Mol. Biol. Lett. 2017, 22, 15. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Dong, C.; Beltcheva, M.; Gontarz, P.; Zhang, B.; Popli, P.; Fischer, L.A.; Khan, S.A.; Park, K.M.; Yoon, E.J.; Xing, X.; et al. Derivation of trophoblast stem cells from naïve human pluripotent stem cells. eLife 2020, 9, e52504. [Google Scholar] [CrossRef] [PubMed]
- Io, S.; Kabata, M.; Iemura, Y.; Semi, K.; Morone, N.; Minagawa, A.; Wang, B.; Okamoto, I.; Nakamura, T.; Kojima, Y.; et al. Capturing human trophoblast development with naive pluripotent stem cells in vitro. Cell Stem Cell 2021, 28, 1023–1039.e13. [Google Scholar] [CrossRef]
- Yu, S.; Zhang, R.; Shen, Q.; Zhu, Z.; Zhang, J.; Wu, X.; Zhao, W.; Li, N.; Yang, F.; Wei, H.; et al. ESRRB facilitates the conversion of trophoblast-like stem cells from induced pluripotent stem cells by directly regulating CDX2. Front. Cell Dev. Biol. 2021, 9, 712224. [Google Scholar] [CrossRef]
- Eeftens, J.M.; Kapoor, M.; Michieletto, D.; Brangwynne, C.P. Polycomb condensates can promote epigenetic marks but are not required for sustained chromatin compaction. Nat. Commun. 2021, 12, 5888. [Google Scholar] [CrossRef]
- Venkatesh, S.; Workman, J.L. Histone exchange, chromatin structure and the regulation of transcription. Nat. Rev. Mol. Cell Biol. 2015, 16, 178–189. [Google Scholar] [CrossRef]
- Kouzarides, T. SnapShot: Histone-modifying enzymes. Cell 2007, 128, 802. [Google Scholar] [CrossRef] [Green Version]
- Greer, E.L.; Shi, Y. Histone methylation: A dynamic mark in health, disease and inheritance. Nat. Rev. Genet. 2012, 13, 343–357. [Google Scholar] [CrossRef] [Green Version]
- Pedersen, M.T.; Kooistra, S.M.; Radzisheuskaya, A.; Laugesen, A.; Johansen, J.V.; Hayward, D.G.; Nilsson, J.; Agger, K.; Helin, K. Continual removal of H3K9 promoter methylation by Jmjd2 demethylases is vital for ESC self-renewal and early development. EMBO J. 2016, 35, 1550–1564. [Google Scholar] [CrossRef] [Green Version]
- Li, B.; Jackson, J.; Simon, M.D.; Fleharty, B.; Gogol, M.; Seidel, C.; Workman, J.L.; Shilatifard, A. Histone H3 lysine 36 dimethylation (H3K36me2) is sufficient to recruit the Rpd3s histone deacetylase complex and to repress spurious transcription. J. Biol. Chem. 2009, 284, 7970–7976. [Google Scholar] [CrossRef] [Green Version]
- Chen, Y.; Fang, R.; Yue, C.; Chang, G.; Li, P.; Guo, Q.; Wang, J.; Zhou, A.; Zhang, S.; Fuller, G.N.; et al. Wnt-induced stabilization of KDM4C is required for Wnt/β-Catenin target gene expression and glioblastoma tumorigenesis. Cancer Res. 2020, 80, 1049–1063. [Google Scholar] [CrossRef]
- Wang, J.; Li, Y.; Wang, P.; Han, G.; Zhang, T.; Chang, J.; Yin, R.; Shan, Y.; Wen, J.; Xie, X.; et al. Leukemogenic chromatin alterations promote AML leukemia stem cells via a KDM4C-ALKBH5-AXL signaling axis. Cell Stem Cell 2020, 27, 81–97.e8. [Google Scholar] [CrossRef]
- Wu, L.; Wary, K.K.; Revskoy, S.; Gao, X.; Tsang, K.; Komarova, Y.A.; Rehman, J.; Malik, A.B. Histone demethylases KDM4A and KDM4C regulate differentiation of embryonic stem cells to endothelial cells. Stem Cell Rep. 2015, 5, 10–21. [Google Scholar] [CrossRef] [Green Version]
- Pedersen, M.T.; Agger, K.; Laugesen, A.; Johansen, J.V.; Cloos, P.A.; Christensen, J.; Helin, K. The demethylase JMJD2C localizes to H3K4me3-positive transcription start sites and is dispensable for embryonic development. Mol. Cell Biol. 2014, 34, 1031–1045. [Google Scholar] [CrossRef] [Green Version]
- Das, P.P.; Shao, Z.; Beyaz, S.; Apostolou, E.; Pinello, L.; de los Angeles, A.; O’Brien, K.; Atsma, J.M.; Fujiwara, Y.; Nguyen, M.; et al. Distinct and combinatorial functions of Jmjd2b/Kdm4b and Jmjd2c/Kdm4c in mouse embryonic stem cell identity. Mol. Cell 2014, 53, 32–48. [Google Scholar] [CrossRef] [Green Version]
- Jie, X.; Fong, W.P.; Zhou, R.; Zhao, Y.; Zhao, Y.; Meng, R.; Zhang, S.; Dong, X.; Zhang, T.; Yang, K.; et al. USP9X-mediated KDM4C deubiquitination promotes lung cancer radioresistance by epigenetically inducing TGF-β2 transcription. Cell Death Differ. 2021, 28, 2095–2111. [Google Scholar] [CrossRef]
- Liang, G.; He, J.; Zhang, Y. Kdm2b promotes induced pluripotent stem cell generation by facilitating gene activation early in reprogramming. Nat. Cell Biol. 2012, 14, 457–466. [Google Scholar] [CrossRef]
- Kibe, K.; Shirane, K.; Ohishi, H.; Uemura, S.; Toh, H.; Sasaki, H. The DNMT3A PWWP domain is essential for the normal DNA methylation landscape in mouse somatic cells and oocytes. PLoS Genet. 2021, 17, e1009570. [Google Scholar] [CrossRef]
- Fang, Y.; Tang, Y.; Zhang, Y.; Pan, Y.; Jia, J.; Sun, Z.; Zeng, W.; Chen, J.; Yuan, Y.; Fang, D. The H3K36me2 methyltransferase NSD1 modulates H3K27ac at active enhancers to safeguard gene expression. Nucleic Acids Res. 2021, 49, 6281–6295. [Google Scholar] [CrossRef]
- Yu, J.R.; LeRoy, G.; Bready, D.; Frenster, J.D.; Saldaña-Meyer, R.; Jin, Y.; Descostes, N.; Stafford, J.M.; Placantonakis, D.G.; Reinberg, D. The H3K36me2 writer-reader dependency in H3K27M-DIPG. Sci. Adv. 2021, 7, eabg7444. [Google Scholar] [CrossRef]
- Zhang, C.; Wang, Z.; Ji, Q.; Li, Q. Histone demethylase JMJD2C: Epigenetic regulators in tumors. Oncotarget 2017, 8, 91723–91733. [Google Scholar] [CrossRef] [Green Version]
- Lee, D.H.; Kim, G.W.; Yoo, J.; Lee, S.W.; Jeon, Y.H.; Kim, S.Y.; Kang, H.G.; Kim, D.H.; Chun, K.H.; Choi, J.; et al. Histone demethylase KDM4C controls tumorigenesis of glioblastoma by epigenetically regulating p53 and c-Myc. Cell Death Dis. 2021, 12, 89. [Google Scholar] [CrossRef]
- Wei, Y.; Du, X.; Yang, D.; Ma, F.; Yu, X.; Zhang, M.; Li, N.; Peng, S.; Liao, M.; Li, G.; et al. Dmrt1 regulates the immune response by repressing the TLR4 signaling pathway in goat male germline stem cells. Zool. Res. 2021, 42, 14–27. [Google Scholar] [CrossRef] [PubMed]
- Livak, K.J.; Schmittgen, T.D. Analysis of relative gene expression data using real-time quantitative PCR and the 2−ΔΔCT Method. Methods 2001, 25, 402–408. [Google Scholar] [CrossRef] [PubMed]
- Wu, X.L.; Zhu, Z.S.; Xiao, X.; Zhou, Z.; Yu, S.; Shen, Q.Y.; Zhang, J.Q.; Yue, W.; Zhang, R.; He, X.; et al. LIN28A inhibits DUSP family phosphatases and activates MAPK signaling pathway to maintain pluripotency in porcine induced pluripotent stem cells. Zool. Res. 2021, 42, 377–388. [Google Scholar] [CrossRef] [PubMed]
- Zhu, Z.; Wu, X.; Li, Q.; Zhang, J.; Yu, S.; Shen, Q.; Zhou, Z.; Pan, Q.; Yue, W.; Qin, D.; et al. Histone demethylase complexes KDM3A and KDM3B cooperate with OCT4/SOX2 to define a pluripotency gene regulatory network. FASEB J. 2021, 35, e21664. [Google Scholar] [CrossRef] [PubMed]
Primer Name | Forward Sequence | Reverse Sequence |
---|---|---|
endo-ESRRB | GACGGGCAAGTTGCTGCTGACG | CGGTCCATCCATTTGTCTGTCC |
endo-SOX2 | ATGTCCCAGCACTACCAGAGCG | CTTACTCTCCTCCCATTTCCCTCT |
CDX2 | TGTGCGAGTGGATGCGGAAG | CTCCGAATGGTGATGTAGCGACTG |
KRT8 | TCAGATTTCCGACACCTCCG | AATCTCCGTCTTCGTGCGAC |
TEAD4 | CGCCTCAGCCTTCCACAATA | CGGCTGGACAGTGTAGGTTT |
SMYD2 | GCCAGGAAAGAAGGATTGTCCA | CCGTCAGCCTTACAGTCTCT |
SETD2 | CAGTTCATCGTCCAGTGCCT | AGGTCCTCCGGGTTCTTACA |
NSD2 | GGGATCTGGTGTGGTCCAA | GATACTGGCGGGCACTCTTT |
KDM2A | AAGCCAGGTCAGGACAATCG | ACTGAGGTCGAGTCGAGACA |
KDM2B | AGTGCTCCATCTGCAACGAA | CCACGCTTTTGCTTGTAGGC |
KDM4A | CCTGGAAGAGGACTGCTGTTTATG | GGGACTTCTTTCTGCGATGTTG |
KDM4B | CCTGCGGTGGATTGATTACGG | GTGAGGTCTTTGCCCTGCTTC |
KDM4C | ATTCCAGCACCGATTCAGCA | GCTGCCTGAACTCCTTCACT |
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations. |
© 2022 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Yu, S.; Shen, Q.; Zhang, R.; Wu, X.; Zhang, J.; Zhao, W.; Wu, X.; Li, N.; Peng, S.; Zhang, S.; et al. KDM4C Contributes to Trophoblast-like Stem Cell Conversion from Porcine-Induced Pluripotent Stem Cells (piPSCs) via Regulating CDX2. Int. J. Mol. Sci. 2022, 23, 7586. https://doi.org/10.3390/ijms23147586
Yu S, Shen Q, Zhang R, Wu X, Zhang J, Zhao W, Wu X, Li N, Peng S, Zhang S, et al. KDM4C Contributes to Trophoblast-like Stem Cell Conversion from Porcine-Induced Pluripotent Stem Cells (piPSCs) via Regulating CDX2. International Journal of Molecular Sciences. 2022; 23(14):7586. https://doi.org/10.3390/ijms23147586
Chicago/Turabian StyleYu, Shuai, Qiaoyan Shen, Rui Zhang, Xiaolong Wu, Juqing Zhang, Wenxu Zhao, Xiaojie Wu, Na Li, Sha Peng, Shiqiang Zhang, and et al. 2022. "KDM4C Contributes to Trophoblast-like Stem Cell Conversion from Porcine-Induced Pluripotent Stem Cells (piPSCs) via Regulating CDX2" International Journal of Molecular Sciences 23, no. 14: 7586. https://doi.org/10.3390/ijms23147586