Mitochondrial RNAs as Potential Biomarkers of Functional Impairment in Diabetic Kidney Disease
Abstract
:1. Introduction
2. Results
2.1. DKD Is Characterized by a Specific Serum RNA Molecule Signature
2.2. Transcriptome Data Are Associated with Pathways of DKD Pathogenesis
2.3. Selected Transcripts Have a Decreasing Expression Trend Related to eGFR Stages
2.4. Validated Transcripts Are Associated with Patients’ Clinical Data
2.5. ROC Curve Analysis
3. Discussion
4. Materials and Methods
4.1. Study Population
4.2. Sample Processing
4.3. RNA Extraction
4.4. Microarray Analysis
4.5. In Silico Analysis
4.6. Validation by qPCRs
4.7. Statistical Analysis
5. Conclusions
Supplementary Materials
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Afkarian, M.; Zelnick, L.R.; Hall, Y.N.; Heagerty, P.J.; Tuttle, K.; Weiss, N.S.; de Boer, I.H. Clinical Manifestations of Kidney Disease among US Adults with Diabetes, 1988–2014. JAMA 2016, 316, 602–610. [Google Scholar] [CrossRef] [PubMed]
- Tuttle, K.R.; Bakris, G.L.; Bilous, R.W.; Chiang, J.L.; de Boer, I.H.; Goldstein-Fuchs, J.; Hirsch, I.B.; Kalantar-Zadeh, K.; Narva, A.S.; Navaneethan, S.D.; et al. Diabetic Kidney Disease: A Report from an ADA Consensus Conference. Diabetes Care 2014, 37, 2864–2883. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Toth-Manikowski, S.; Atta, M.G. Diabetic Kidney Disease: Pathophysiology and Therapeutic Targets. J. Diabetes Res. 2015, 2015, 697010. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Forbes, J.M.; Coughlan, M.T.; Cooper, M.E. Oxidative Stress as a Major Culprit in Kidney Disease in Diabetes. Diabetes 2008, 57, 1446–1454. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Vallon, V.; Komers, R. Pathophysiology of the Diabetic Kidney. Compr. Physiol. 2011, 1, 1175–1232. [Google Scholar] [CrossRef]
- Østergaard, J.A.; Cooper, M.E.; Jandeleit-Dahm, K.A.M. Targeting Oxidative Stress and Anti-Oxidant Defence in Diabetic Kidney Disease. J. Nephrol. 2020, 33, 917–929. [Google Scholar] [CrossRef]
- Sutariya, B.; Jhonsa, D.; Saraf, M.N. TGF-β: The Connecting Link between Nephropathy and Fibrosis. Immunopharmacol. Immunotoxicol. 2016, 38, 39–49. [Google Scholar] [CrossRef]
- Campion, C.G.; Sanchez-Ferras, O.; Batchu, S.N. Potential Role of Serum and Urinary Biomarkers in Diagnosis and Prognosis of Diabetic Nephropathy. Can. J. Kidney Health Dis. 2017, 4, 2054358117705371. [Google Scholar] [CrossRef]
- American Diabetes Association Professional Practice Committee 11. Chronic Kidney Disease and Risk Management: Standards of Medical Care in Diabetes—2022. Diabetes Care 2022, 45, S175–S184. [Google Scholar] [CrossRef] [PubMed]
- Tankeu, A.T.; Kaze, F.F.; Noubiap, J.J.; Chelo, D.; Dehayem, M.Y.; Sobngwi, E. Exercise-Induced Albuminuria and Circadian Blood Pressure Abnormalities in Type 2 Diabetes. World J. Nephrol. 2017, 6, 209–216. [Google Scholar] [CrossRef] [PubMed]
- MacIsaac, R.J.; Ekinci, E.I.; Jerums, G. Progressive Diabetic Nephropathy. How Useful Is Microalbuminuria?: Contra. Kidney Int. 2014, 86, 50–57. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Botev, R.; Mallié, J.-P.; Wetzels, J.F.M.; Couchoud, C.; Schück, O. The Clinician and Estimation of Glomerular Filtration Rate by Creatinine-Based Formulas: Current Limitations and Quo Vadis. Clin. J. Am. Soc. Nephrol. 2011, 6, 937–950. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Barutta, F.; Bellini, S.; Canepa, S.; Durazzo, M.; Gruden, G. Novel Biomarkers of Diabetic Kidney Disease: Current Status and Potential Clinical Application. Acta Diabetol. 2021, 58, 819–830. [Google Scholar] [CrossRef]
- Nielsen, S.E.; Reinhard, H.; Zdunek, D.; Hess, G.; Gutiérrez, O.M.; Wolf, M.; Parving, H.-H.; Jacobsen, P.K.; Rossing, P. Tubular Markers Are Associated with Decline in Kidney Function in Proteinuric Type 2 Diabetic Patients. Diabetes Res. Clin. Pract. 2012, 97, 71–76. [Google Scholar] [CrossRef] [PubMed]
- Satirapoj, B. Tubulointerstitial Biomarkers for Diabetic Nephropathy. J. Diabetes Res. 2018, 2018, 2852398. [Google Scholar] [CrossRef] [PubMed]
- Araki, S.; Haneda, M.; Koya, D.; Isshiki, K.; Kume, S.; Sugimoto, T.; Kawai, H.; Nishio, Y.; Kashiwagi, A.; Uzu, T.; et al. Association between Urinary Type IV Collagen Level and Deterioration of Renal Function in Type 2 Diabetic Patients without Overt Proteinuria. Diabetes Care 2010, 33, 1805–1810. [Google Scholar] [CrossRef] [Green Version]
- Jung, C.-Y.; Yoo, T.-H. Pathophysiologic Mechanisms and Potential Biomarkers in Diabetic Kidney Disease. Diabetes Metab. J. 2022, 46, 181–197. [Google Scholar] [CrossRef]
- Di Mauro, S.; Scamporrino, A.; Filippello, A.; Di Pino, A.; Scicali, R.; Malaguarnera, R.; Purrello, F.; Piro, S. Clinical and Molecular Biomarkers for Diagnosis and Staging of NAFLD. Int. J. Mol. Sci. 2021, 22, 11905. [Google Scholar] [CrossRef] [PubMed]
- Hanson, R.L.; Craig, D.W.; Millis, M.P.; Yeatts, K.A.; Kobes, S.; Pearson, J.V.; Lee, A.M.; Knowler, W.C.; Nelson, R.G.; Wolford, J.K. Identification of PVT1 as a Candidate Gene for End-Stage Renal Disease in Type 2 Diabetes Using a Pooling-Based Genome-Wide Single Nucleotide Polymorphism Association Study. Diabetes 2007, 56, 975–983. [Google Scholar] [CrossRef] [Green Version]
- Puthanveetil, P.; Chen, S.; Feng, B.; Gautam, A.; Chakrabarti, S. Long Non-Coding RNA MALAT1 Regulates Hyperglycaemia Induced Inflammatory Process in the Endothelial Cells. J. Cell. Mol. Med. 2015, 19, 1418–1425. [Google Scholar] [CrossRef]
- Wang, M.; Yao, D.; Wang, S.; Yan, Q.; Lu, W. Long Non-Coding RNA ENSMUST00000147869 Protects Mesangial Cells from Proliferation and Fibrosis Induced by Diabetic Nephropathy. Endocrine 2016, 54, 81–92. [Google Scholar] [CrossRef] [PubMed]
- Simpson, K.; Wonnacott, A.; Fraser, D.J.; Bowen, T. MicroRNAs in Diabetic Nephropathy: From Biomarkers to Therapy. Curr. Diab. Rep. 2016, 16, 35. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Ragusa, M.; Bosco, P.; Tamburello, L.; Barbagallo, C.; Condorelli, A.G.; Tornitore, M.; Spada, R.S.; Barbagallo, D.; Scalia, M.; Elia, M.; et al. MiRNAs Plasma Profiles in Vascular Dementia: Biomolecular Data and Biomedical Implications. Front. Cell. Neurosci. 2016, 10, 51. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Feng, S.-T.; Yang, Y.; Yang, J.-F.; Gao, Y.-M.; Cao, J.-Y.; Li, Z.-L.; Tang, T.-T.; Lv, L.-L.; Wang, B.; Wen, Y.; et al. Urinary Sediment CCL5 Messenger RNA as a Potential Prognostic Biomarker of Diabetic Nephropathy. Clin. Kidney J. 2022, 15, 534–544. [Google Scholar] [CrossRef] [PubMed]
- Wang, G.; Lai, F.M.-M.; Lai, K.-B.; Chow, K.-M.; Li, K.-T.P.; Szeto, C.-C. Messenger RNA Expression of Podocyte-Associated Molecules in the Urinary Sediment of Patients with Diabetic Nephropathy. Nephron Clin. Pract. 2007, 106, c169–c179. [Google Scholar] [CrossRef] [PubMed]
- Zheng, M.; Lv, L.-L.; Ni, J.; Ni, H.-F.; Li, Q.; Ma, K.-L.; Liu, B.-C. Urinary Podocyte-Associated MRNA Profile in Various Stages of Diabetic Nephropathy. PLoS ONE 2011, 6, e20431. [Google Scholar] [CrossRef] [Green Version]
- Zhao, C.; Hu, J.; Wang, Z.; Cao, Z.-Y.; Wang, L. Serum LncRNA PANDAR May Act as a Novel Serum Biomarker of Diabetic Nephropathy in Patients with Type 2 Diabetes. Clin. Lab. 2020, 66, 1067–1072. [Google Scholar] [CrossRef]
- Gao, J.; Wang, W.; Wang, F.; Guo, C. LncRNA-NR_033515 Promotes Proliferation, Fibrogenesis and Epithelial-to-Mesenchymal Transition by Targeting MiR-743b-5p in Diabetic Nephropathy. Biomed. Pharmacother. 2018, 106, 543–552. [Google Scholar] [CrossRef]
- De Silva, D.; Tu, Y.-T.; Amunts, A.; Fontanesi, F.; Barrientos, A. Mitochondrial Ribosome Assembly in Health and Disease. Cell Cycle Georget. Tex 2015, 14, 2226–2250. [Google Scholar] [CrossRef] [Green Version]
- Yang, W.; Zhang, K.; Li, L.; Xu, Y.; Ma, K.; Xie, H.; Zhou, J.; Cai, L.; Gong, Y.; Gong, K. Downregulation of LncRNA ZNF582-AS1 Due to DNA Hypermethylation Promotes Clear Cell Renal Cell Carcinoma Growth and Metastasis by Regulating the N(6)-Methyladenosine Modification of MT-RNR1. J. Exp. Clin. Cancer Res. 2021, 40, 92. [Google Scholar] [CrossRef]
- Antoun, G.; McMurray, F.; Thrush, A.B.; Patten, D.A.; Peixoto, A.C.; Slack, R.S.; McPherson, R.; Dent, R.; Harper, M.-E. Impaired Mitochondrial Oxidative Phosphorylation and Supercomplex Assembly in Rectus Abdominis Muscle of Diabetic Obese Individuals. Diabetologia 2015, 58, 2861–2866. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Maranzana, E.; Barbero, G.; Falasca, A.I.; Lenaz, G.; Genova, M.L. Mitochondrial Respiratory Supercomplex Association Limits Production of Reactive Oxygen Species from Complex I. Antioxid. Redox Signal. 2013, 19, 1469–1480. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Sharma, K.; Karl, B.; Mathew, A.V.; Gangoiti, J.A.; Wassel, C.L.; Saito, R.; Pu, M.; Sharma, S.; You, Y.-H.; Wang, L.; et al. Metabolomics Reveals Signature of Mitochondrial Dysfunction in Diabetic Kidney Disease. J. Am. Soc. Nephrol. 2013, 24, 1901–1912. [Google Scholar] [CrossRef]
- Gordin, D.; Shah, H.; Shinjo, T.; St-Louis, R.; Qi, W.; Park, K.; Paniagua, S.M.; Pober, D.M.; Wu, I.-H.; Bahnam, V.; et al. Characterization of Glycolytic Enzymes and Pyruvate Kinase M2 in Type 1 and 2 Diabetic Nephropathy. Diabetes Care 2019, 42, 1263–1273. [Google Scholar] [CrossRef] [PubMed]
- Mise, K.; Galvan, D.L.; Danesh, F.R. Shaping Up Mitochondria in Diabetic Nephropathy. Kidney360 2020, 1, 982–992. [Google Scholar] [CrossRef]
- Al-Kafaji, G.; Aljadaan, A.; Kamal, A.; Bakhiet, M. Peripheral Blood Mitochondrial DNA Copy Number as a Novel Potential Biomarker for Diabetic Nephropathy in Type 2 Diabetes Patients. Exp. Ther. Med. 2018, 16, 1483–1492. [Google Scholar] [CrossRef] [Green Version]
- Wei, P.Z.; Kwan, B.C.-H.; Chow, K.M.; Cheng, P.M.-S.; Luk, C.C.-W.; Li, P.K.-T.; Szeto, C.C. Urinary Mitochondrial DNA Level Is an Indicator of Intra-Renal Mitochondrial Depletion and Renal Scarring in Diabetic Nephropathy. Nephrol. Dial. Transplant. 2018, 33, 784–788. [Google Scholar] [CrossRef] [Green Version]
- Scicali, R.; Di Pino, A.; Urbano, F.; Ferrara, V.; Marchisello, S.; Di Mauro, S.; Scamporrino, A.; Filippello, A.; Piro, S.; Rabuazzo, A.M.; et al. Analysis of S100A12 Plasma Levels in Hyperlipidemic Subjects with or without Familial Hypercholesterolemia. Acta Diabetol. 2019, 56, 899–906. [Google Scholar] [CrossRef]
- Di Mauro, S.; Salomone, F.; Scamporrino, A.; Filippello, A.; Morisco, F.; Guido, M.; Lembo, V.; Cossiga, V.; Pipitone, R.M.; Grimaudo, S.; et al. Coffee Restores Expression of LncRNAs Involved in Steatosis and Fibrosis in a Mouse Model of NAFLD. Nutrients 2021, 13, 2952. [Google Scholar] [CrossRef]
- Di Mauro, S.; Ragusa, M.; Urbano, F.; Filippello, A.; Di Pino, A.; Scamporrino, A.; Pulvirenti, A.; Ferro, A.; Rabuazzo, A.M.; Purrello, M.; et al. Intracellular and Extracellular MiRNome Deregulation in Cellular Models of NAFLD or NASH: Clinical Implications. Nutr. Metab. Cardiovasc. Dis. 2016, 26, 1129–1139. [Google Scholar] [CrossRef]
- Toro, M.D.; Reibaldi, M.; Avitabile, T.; Bucolo, C.; Salomone, S.; Rejdak, R.; Nowomiejska, K.; Tripodi, S.; Posarelli, C.; Ragusa, M.; et al. MicroRNAs in the Vitreous Humor of Patients with Retinal Detachment and a Different Grading of Proliferative Vitreoretinopathy: A Pilot Study. Transl. Vis. Sci. Technol. 2020, 9, 23. [Google Scholar] [CrossRef] [PubMed]
- Di Mauro, S.; Scamporrino, A.; Fruciano, M.; Filippello, A.; Fagone, E.; Gili, E.; Scionti, F.; Purrazzo, G.; Di Pino, A.; Scicali, R.; et al. Circulating Coding and Long Non-Coding RNAs as Potential Biomarkers of Idiopathic Pulmonary Fibrosis. Int. J. Mol. Sci. 2020, 21, 8812. [Google Scholar] [CrossRef] [PubMed]
- Di Mauro, S.; Scamporrino, A.; Petta, S.; Urbano, F.; Filippello, A.; Ragusa, M.; Di Martino, M.T.; Scionti, F.; Grimaudo, S.; Pipitone, R.M.; et al. Serum Coding and Non-Coding RNAs as Biomarkers of NAFLD and Fibrosis Severity. Liver Int. Off. J. Int. Assoc. Study Liver 2019, 39, 1742–1754. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Filippello, A.; Di Mauro, S.; Scamporrino, A.; Malaguarnera, R.; Torrisi, S.A.; Leggio, G.M.; Di Pino, A.; Scicali, R.; Purrello, F.; Piro, S. High Glucose Exposure Impairs L-Cell Differentiation in Intestinal Organoids: Molecular Mechanisms and Clinical Implications. Int. J. Mol. Sci. 2021, 22, 6660. [Google Scholar] [CrossRef]
- Filippello, A.; Urbano, F.; Di Mauro, S.; Scamporrino, A.; Di Pino, A.; Scicali, R.; Rabuazzo, A.M.; Purrello, F.; Piro, S. Chronic Exposure to Palmitate Impairs Insulin Signaling in an Intestinal L-Cell Line: A Possible Shift from GLP-1 to Glucagon Production. Int. J. Mol. Sci. 2018, 19, 3791. [Google Scholar] [CrossRef] [Green Version]
Clinical Parameters | G1 | G2 | G3 | p-Value |
---|---|---|---|---|
Age | 67.30 ± 4.79 | 68.00 ± 5.10 | 70.60 ± 4.97 | 0.0825 |
Gender (% M) | 78.26 | 80.77 | 75.00 | 0.8953 |
BMI (kg/m2) | 27.25 (25.92–33.49) | 29.17 (27.90–32.46) | 29.76 (24.98–34.69) | 0.6300 |
WC (cm) | 104.10 ± 14.15 | 108.60 ± 12.97 | 107.50 ± 9.43 | 0.4900 |
AST (UI/L) | 24.00 (22–29) | 25.00 (21–34.50) | 24.00 (21.50–30) | 0.8400 |
ALT (UI/L) | 31.00 ± (21–38) | 25.50 ± (19–45) | 18.50 ± (13–29.50) | 0.0600 |
COL. TOT (mg/dL) | 158.00 (122–180) | 181.50 (143.5–207) | 171.50 (141.3–209.5) | 0.1700 |
HDL (mg/dL) | 47.96 ± 9.38 | 45.65 ± 12.78 | 47.25 ± 11.20 | 0.7700 |
LDL (mg/dL) | 75.40 (51.60–100.60) | 96.70 (78.25–126.70) | 77.40 (68.25–139.30) | 0.0900 |
Triglycerides (mg/dL) | 146.00 (83–202) | 126.00 (88.75–244) | 133.50 (108–156) | 0.9200 |
Uric acid (mg/dL) | 5.17 ± 1.63 | 6.25 ± 1.51 | 6.59 ± 1.25 | 0.0100 |
BUN (mg/dL) | 18.22 (21.50–26.64) | 21.96 (23.71–28.97) | 33.41 (38.43–48.13) | <0.0001 |
HBA1c (%) | 7.70 ± 1.34 | 7.70 ± 1.64 | 8.00 ± 1.35 | 0.9400 |
Creatinine (mg/dL) | 0.73 (0.66–0.81) | 0.96 (0.85–1.05) | 1.40 (1.08–1.48) | <0.0001 |
Albuminuria (mcg/mL) | 25.00 (12–33) | 24.50 (6.75–124.8) | 17.00 (10.50–37.75) | 0.7900 |
ALB/CREAT | 26.00 (14–45) | 32.00 (8.5–72.5) | 28.50 (13.25–89) | 0.7900 |
WBC (μL−1) | 7900 (5700–8900) | 6200 (5200–8125) | 7550 (5800–8875) | 0.1400 |
HCT (%) | 44.40 (42.20–46) | 42.60 (39.93–45.13) | 40.05 (37.60–41.70) | 0.0100 |
Systolic BP (mmHg) | 120.7 ± 11.20 | 125 ± 10.54 | 129.8 ± 11 | 0.0277 |
Dyastolic BP (mmHG) | 75 ± 7.43 | 79.36 ± 6.90 | 80.65 ± 6.30 | 0.0210 |
Hyperthesis subjects (% H) | 58.3 | 68 | 95 | 0.0208 |
Transcripts | FC G3 vs. G1 | FC G3 vs. G2 | p-Value G3 vs. G1 | p-Value G3 vs. G2 |
---|---|---|---|---|
MT-ATP8 | −2.6 | −3.3 | 0.0070 | 0.0003 |
MT-ATP6 | −2.4 | −3.4 | 0.0300 | <0.0001 |
MT-COX3 | −2.8 | −4.1 | 0.0040 | <0.0001 |
MT-ND1 | −2.6 | −3.7 | 0.0080 | <0.0001 |
Seysnoy | - | −1.8 | 0.1367 | 0.0200 |
Skerdo | −1.6 | −1.8 | 0.0400 | 0.0100 |
Transcripts | Creatinine (mg/dL) | eGFR ckd-epi (mL/m × 1.73 m2) | WBC (μL−1) | BUN (mg/dL) |
---|---|---|---|---|
MT-ATP8 | 0.0023 | 0.0031 | 0.0602 | 0.0010 |
MT-ATP6 | 0.0112 | 0.0156 | 0.0889 | 0.0082 |
MT-COX3 | 0.0135 | 0.0155 | 0.1394 | 0.0050 |
MT-ND1 | 0.0101 | 0.0158 | 0.1168 | 0.0046 |
skerdo | 0.0078 | 0.0063 | 0.0170 | 0.0252 |
seysnoy | 0.0354 | 0.0303 | 0.0174 | 0.04403 |
Transcripts | AUC | CI | p-Value | Sensitivity | Specificity |
---|---|---|---|---|---|
MT-ATP8 | 0.816 | 0.687–0.945 | 2.0 × 10−6 | 90% | 72% |
MT-ATP6 | 0.846 | 0.728–0.964 | 7.8 × 10−5 | 90% | 76% |
MT-COX3 | 0.836 | 0.710–0.962 | 1.2 × 10−4 | 90% | 76% |
MT-ND1 | 0.842 | 0.718–0.966 | 9.4 × 10−5 | 90% | 76% |
seysnoy | 0.714 | 0.580–0.892 | 1.0 × 10−2 | 75% | 76% |
Skerdo | 0.736 | 0.580–0.892 | 3.0 × 10−3 | 80% | 72% |
Transcripts | Primer Sequences |
---|---|
MT-ATP8 | F 5′ ACAGTGAAATGCCCCAACTAAAT 3′ R 5′ AGGGAGGTAGGTGGTAGTTTGTG 3′ |
MT-ATP6 | F 5′ ACCTTCCCTCTACACTTATCATCTT3′ R 5′ CGTGCAGGTAGAGGCTTACT 3′ |
MT-COX3 | F 5′ TTCACCATTTCCGACGGCAT 3′ R 5 GGCGGATGAAGCAGATAGTGA’ 3′ |
MT-ND1 | F 5′ CGGGCTACTACAACCCTTCG 3′ R 5 AGATGTGGCGGGTTTTAGGG 3′ |
seysnoy | F 5′ TACCCCACTATGCTTAGCCCT 3′ R 5′ AGCTGTGGCTCGTAGTGTTC 3′ |
skerdo | F 5′ GGGTTGGTCAATTTCGTGCC 3′ R 5′ ACACTCTTTACGCCGGTTTCT 3′ |
ACTB2 | F 5′ GAGCACAGAGCCTCGCCTTT 3′ R 5′GAGCGCGGCGATATCATCA 3′ |
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations. |
© 2022 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Di Mauro, S.; Scamporrino, A.; Filippello, A.; Di Marco, M.; Di Martino, M.T.; Scionti, F.; Di Pino, A.; Scicali, R.; Malaguarnera, R.; Purrello, F.; et al. Mitochondrial RNAs as Potential Biomarkers of Functional Impairment in Diabetic Kidney Disease. Int. J. Mol. Sci. 2022, 23, 8198. https://doi.org/10.3390/ijms23158198
Di Mauro S, Scamporrino A, Filippello A, Di Marco M, Di Martino MT, Scionti F, Di Pino A, Scicali R, Malaguarnera R, Purrello F, et al. Mitochondrial RNAs as Potential Biomarkers of Functional Impairment in Diabetic Kidney Disease. International Journal of Molecular Sciences. 2022; 23(15):8198. https://doi.org/10.3390/ijms23158198
Chicago/Turabian StyleDi Mauro, Stefania, Alessandra Scamporrino, Agnese Filippello, Maurizio Di Marco, Maria Teresa Di Martino, Francesca Scionti, Antonino Di Pino, Roberto Scicali, Roberta Malaguarnera, Francesco Purrello, and et al. 2022. "Mitochondrial RNAs as Potential Biomarkers of Functional Impairment in Diabetic Kidney Disease" International Journal of Molecular Sciences 23, no. 15: 8198. https://doi.org/10.3390/ijms23158198