Hair Growth Regulation by Fibroblast Growth Factor 12 (FGF12)
Abstract
:1. Introduction
2. Results
2.1. Expression of FGF12 during the Hair Growth Cycle
2.2. FGF12 Is a Necessary Factor in the Hair Growth Cycle
2.3. FGF12 Knockdown in ORS Cells Inhibited the Proliferation and the Migration Rate
2.4. FGF12 Overexpression Promoted the Migration Property of ORS Cells
2.5. FGF12 Upregulation in ORS Cells Promoted the Hair Growth in C3H/HeN Mouse
2.6. Upregulation of Growth Factors in ORS Cells by Ad-Mediated FGF12 Overexpression
3. Discussion
4. Materials and Methods
4.1. Cell Culture
4.2. Small Interfering RNA (siRNA) Transfection
4.3. Adenovirus Infection
4.4. Immunofluorescence Staining
4.5. Telogen-to-Anagen Transition Assay in C3H/HeJ mice
4.6. Hematoxylin and Eosin (H&E) Staining
4.7. Hair Follicle Organ Culture
4.8. Western Blot
4.9. Real-Time Quantitative Reverse Transcription-Polymerase Chain Reaction (qRT-PCR)
4.10. Proliferation Assay
4.11. Scratch Migration Assay
4.12. Transwell Migration Assay
4.13. Human Growth Factor Array Analysis
4.14. Growth Factor Cocktail Treatment
4.15. Statistical Analysis
Supplementary Materials
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Conflicts of Interest
Abbreviations
FGF | Fibroblast growth factor |
HORS | Human outer root sheath |
H&E | Hematoxylin and eosin |
HDP | Human dermal papilla |
MOI | Multiplicity of infection |
Ad | Adenovirus |
GF | Growth factor |
PDGF-CC | Platelet-derived growth factor-CC |
HB-EGF | Heparin-binding epidermal growth factor-like growth factor |
MDK | Midkine |
VSM | Vascular smooth muscle |
IB2 | Islet-Brain-2 |
References
- Müller-Röver, S.; Foitzik, K.; Paus, R.; Handjiski, B.; van der Veen, C.; Eichmüller, S.; McKay, I.A.; Stenn, K.S. A Comprehensive Guide for the Accurate Classification of Murine Hair Follicles in Distinct Hair Cycle Stages. J. Investig. Dermatol. 2001, 117, 3–15. [Google Scholar] [CrossRef] [PubMed]
- Blanpain, C.; Fuchs, E. Epidermal Stem Cells of the Skin. Annu. Rev. Cell Dev. Biol. 2006, 22, 339–373. [Google Scholar] [CrossRef] [PubMed]
- Greco, V.; Chen, T.; Rendl, M.; Schober, M.; Pasolli, H.A.; Stokes, N.; dela Cruz-Racelism, J.; Fuchs, E. A two-step mechanism for stem cell activation during hair regeneration. Cell Stem Cell 2009, 4, 155–169. [Google Scholar] [CrossRef] [PubMed]
- Crounse, R.G.; Stengle, J.M. Influence of the dermal papilla on survival of isolated human scalp hair roots in an heterologous host. J. Investig. Dermatol. 1959, 32, 477–479. [Google Scholar] [CrossRef]
- Straile, W.E.; Chase, H.B.; Arsenault, C. Growth and differentiation of hair follicles between periods of activity and quiescence. J. Exp. Zool. 1961, 148, 205–221. [Google Scholar] [CrossRef]
- Li, Z.; Li, J.; Gu, J.; Begum, S.; Wang, Y.; Sun, B.; Lee, M.; Sung, C. Chrysanthemum zawadskii extract induce hair growth by stimulating the proliferation and differentiation of hair matrix. Int. J. Mol. Med. 2014, 34, 130–136. [Google Scholar] [CrossRef]
- Lindner, G.; Botchkarev, V.A.; Botchkareva, N.V.; Ling, G.; Van Der Veen, C.; Paus, R. Analysis of apoptosis during hair follicle regression (catagen). Am. J. Pathol. 1997, 151, 1601–1617. [Google Scholar]
- Yang, C.-C.; Cotsarelis, G. Review of hair follicle dermal cells. J. Dermatol. Sci. 2010, 57, 2–11. [Google Scholar] [CrossRef]
- Park, A.M.; Khan, S.; Rawnsley, J. Hair Biology: Growth and Pigmentation. Facial. Plast. Surg. Clin. N. Am. 2018, 26, 415–424. [Google Scholar] [CrossRef]
- Penzo-Méndez, A.I.; Stanger, B.Z. Organ-Size Regulation in Mammals. Cold Spring Harb. Perspect. Biol. 2015, 7, a019240. [Google Scholar] [CrossRef]
- Eswarakumar, V.; Lax, I.; Schlessinger, J. Cellular signaling by fibroblast growth factor receptors. Cytokine Growth Factor Rev. 2005, 16, 139–149. [Google Scholar] [CrossRef] [PubMed]
- Prudovsky, I. Cellular Mechanisms of FGF-Stimulated Tissue Repair. Cells 2021, 10, 1830. [Google Scholar] [CrossRef] [PubMed]
- Kimelman, D.; Kirschner, M. Synergistic induction of mesoderm by FGF and TGF-beta and the identification of an mRNA coding for FGF in the early Xenopus embryo. Cell 1987, 51, 869–877. [Google Scholar] [CrossRef]
- Itoh, N. The Fgf Families in Humans, Mice, and Zebrafish: Their Evolutional Processes and Roles in Development, Metabolism, and Disease. Biol. Pharm. Bull. 2007, 30, 1819–1825. [Google Scholar] [CrossRef] [PubMed]
- Turner, N.; Grose, R. Fibroblast growth factor signalling: From development to cancer. Nat. Cancer 2010, 10, 116–129. [Google Scholar] [CrossRef]
- Moya, M.L.; Cheng, M.-H.; Huang, J.-J.; Francis-Sedlak, M.E.; Kao, S.-W.; Opara, E.C.; Brey, E.M. The effect of FGF-1 loaded alginate microbeads on neovascularization and adipogenesis in a vascular pedicle model of adipose tissue engineering. Biomaterials 2010, 31, 2816–2826. [Google Scholar] [CrossRef]
- Hankemeier, S.; Keus, M.; Zeichen, J.; Jagodzinski, M.; Barkhausen, T.; Bosch, U.; Krettek, C.; van Griensven, M. Modulation of Proliferation and Differentiation of Human Bone Marrow Stromal Cells by Fibroblast Growth Factor 2: Potential Implications for Tissue Engineering of Tendons and Ligaments. Tissue Eng. 2005, 11, 41–49. [Google Scholar] [CrossRef]
- Martin, I.; Suetterlin, R.; Baschong, W.; Heberer, M.; Vunjak-Novakovic, G.; Freed, L. Enhanced cartilage tissue engineering by sequential exposure of chondrocytes to FGF-2 during 2D expansion and BMP-2 during 3D cultivation. J. Cell. Biochem. 2001, 83, 121–128. [Google Scholar] [CrossRef]
- Delgado-Rivera, R.; Harris, S.L.; Ahmed, I.; Babu, A.N.; Patel, R.P.; Ayres, V.; Flowers, D.; Meiners, S. Increased FGF-2 secretion and ability to support neurite outgrowth by astrocytes cultured on polyamide nanofibrillar matrices. Matrix Biol. 2009, 28, 137–147. [Google Scholar] [CrossRef]
- Rophael, J.A.; Craft, R.O.; Palmer, J.A.; Hussey, A.J.; Thomas, G.P.; Morrison, W.A.; Penington, A.J.; Mitchell, G.M. Angiogenic Growth Factor Synergism in a Murine Tissue Engineering Model of Angiogenesis and Adipogenesis. Am. J. Pathol. 2007, 171, 2048–2057. [Google Scholar] [CrossRef]
- Du Cros, D.L.; Isaacs, K.; Moore, G.P. Distribution of acidic and basic fibroblast growth factors in ovine skin during follicle morphogenesis. J. Cell Sci. 1993, 105 Pt 3, 667–674. [Google Scholar] [CrossRef] [PubMed]
- Lin, W.H.; Xiang, L.J.; Shi, H.X.; Zhang, J.; Jiang, L.P.; Cai, P.T.; Lin, Z.L.; Lin, B.B.; Huang, Y.; Xiao, J.; et al. Fibroblast Growth Factors Stimulate Hair Growth through β-Catenin and Shh Expression in C57BL/6 Mice. BioMed Res. Int. 2015, 2015, 730139. [Google Scholar] [PubMed]
- Nakayama, F.; Hagiwara, A.; Kimura, M.; Akashi, M.; Imamura, T. Evaluation of radiation-induced hair follicle apoptosis in mice and the preventive effects of fibroblast growth factor-1. Exp. Dermatol. 2009, 18, 889–892. [Google Scholar] [CrossRef] [PubMed]
- Ozeki, M.; Tabata, Y. In vivo promoted growth of mice hair follicles by the controlled release of growth factors. Biomaterials 2003, 24, 2387–2394. [Google Scholar] [CrossRef]
- Kiso, M.; Hamazaki, T.S.; Itoh, M.; Kikuchi, S.; Nakagawa, H.; Okochi, H. Synergistic effect of PDGF and FGF2 for cell proliferation and hair inductive activity in murine vibrissal dermal papilla in vitro. J. Dermatol. Sci. 2015, 79, 110–118. [Google Scholar] [CrossRef] [PubMed]
- Choi, K.-C.; Hwang, K.-A.; Hwang, Y.-L.; Lee, M.-H.; Kim, N.-R.; Roh, S.-S.; Lee, Y.; Kim, C.D.; Lee, J.-H. Adenosine stimulates growth of dermal papilla and lengthens the anagen phase by increasing the cysteine level via fibroblast growth factors 2 and 7 in an organ culture of mouse vibrissae hair follicles. Int. J. Mol. Med. 2011, 29, 195–201. [Google Scholar] [CrossRef]
- Ota, Y.; Saitoha, Y.; Suzukia, S.; Ozawab, K.; Kawanob, M.; Imamurab, T. Fibroblast Growth Factor 5 Inhibits Hair Growth by Blocking Dermal Papilla Cell Activation. Biochem. Biophys. Res. Commun. 2002, 290, 169–176. [Google Scholar] [CrossRef]
- Hébert, J.M.; Rosenquist, T.; Götz, J.; Martin, G.R. FGF5 as a regulator of the hair growth cycle: Evidence from targeted and spontaneous mutations. Cell 1994, 78, 1017–1025. [Google Scholar] [CrossRef]
- Higgins, C.A.; Petukhova, L.; Harel, S.; Ho, Y.Y.; Drill, E.; Shapiro, L.; Wajid, M.; Christiano, A.M. FGF5 is a crucial regulator of hair length in humans. Proc. Natl. Acad. Sci. USA 2014, 111, 10648–10653. [Google Scholar] [CrossRef]
- Guo, L.; Yu, Q.; Fuchs, E. Targeting expression of keratinocyte growth factor to keratinocytes elicits striking changes in epithelial differentiation in transgenic mice. EMBO J. 1993, 12, 973–986. [Google Scholar] [CrossRef]
- Wang, Z.; Chen, Y.; Chen, M.; Zhang, Y. Overexpression of Fgf8 in the epidermis inhibits hair follicle development. Exp. Dermatol. 2020, 30, 494–502. [Google Scholar] [CrossRef] [PubMed]
- Gay, D.; Kwon, O.; Zhang, Z.; Spata, M.; Plikus, M.V.; Holler, P.D.; Ito, M.; Yang, Z.; Treffeisen, E.; Cotsarelis, G.; et al. Fgf9 from dermal γδ T cells induces hair follicle neogenesis after wounding. Nat. Med. 2013, 19, 916–923. [Google Scholar] [CrossRef] [PubMed]
- Suzuki, K.; Yamanishi, K.; Mori, O.; Kamikawa, M.; Andersen, B.; Kato, S.; Toyoda, T.; Yamada, G. Defective terminal differentiation and hypoplasia of the epidermis in mice lacking the Fgf10 gene. FEBS Lett. 2000, 481, 53–56. [Google Scholar] [CrossRef]
- Ohuchi, H.; Tao, H.; Ohata, K.; Itoh, N.; Kato, S.; Noji, S.; Ono, K. Fibroblast growth factor 10 is required for proper development of the mouse whiskers. Biochem. Biophys. Res. Commun. 2003, 302, 562–567. [Google Scholar] [CrossRef]
- Kawano, M.; Suzuki, S.; Suzuki, M.; Oki, J.; Imamura, T. Bulge- and Basal Layer-Specific Expression of Fibroblast Growth Factor-13 (FHF-2) in Mouse Skin. J. Investig. Dermatol. 2004, 122, 1084–1090. [Google Scholar] [CrossRef]
- DeStefano, G.M.; Fantauzzo, K.A.; Petukhova, L.; Kurban, M.; Tadin-Strapps, M.; Levy, B.; Warburton, D.; Cirulli, E.T.; Han, Y.; Sun, X.; et al. Position effect on FGF13 associated with X-linked congenital generalized hypertrichosis. Proc. Natl. Acad. Sci. USA 2013, 110, 7790–7795. [Google Scholar] [CrossRef] [PubMed]
- Kimura-Ueki, M.; Oda, Y.; Oki, J.; Komi-Kuramochi, A.; Honda, E.; Asada, M.; Suzuki, M.; Imamura, T. Hair Cycle Resting Phase Is Regulated by Cyclic Epithelial FGF18 Signaling. J. Investig. Dermatol. 2012, 132, 1338–1345. [Google Scholar] [CrossRef] [PubMed]
- Leishman, E.; Howard, J.M.; Garcia, G.E.; Miao, Q.; Ku, A.T.; Dekker, J.D.; Tucker, H.; Nguyen, H. Foxp1 maintains hair follicle stem cell quiescence through regulation of Fgf18. Development 2013, 140, 3809–3818. [Google Scholar] [CrossRef]
- Huh, S.-H.; Närhi, K.; Lindfors, P.H.; Häärä, O.; Yang, L.; Ornitz, D.M.; Mikkola, M.L. Fgf20 governs formation of primary and secondary dermal condensations in developing hair follicles. Genes Dev. 2013, 27, 450–458. [Google Scholar] [CrossRef]
- Wells, K.L.; Hadad, Y.; Ben-Avraham, D.; Hillel, J.; Cahaner, A.; Headon, D.J. Genome-wide SNP scan of pooled DNA reveals nonsense mutation in FGF20 in the scaleless line of featherless chickens. BMC Genom. 2012, 13, 257. [Google Scholar] [CrossRef]
- Liu, X.; Zhang, P.; Zhang, X.; Li, X.; Bai, Y.; Ao, Y.; Hexig, B.; Guo, X.; Liu, D. Fgf21 knockout mice generated using CRISPR/Cas9 reveal genetic alterations that may affect hair growth. Gene 2019, 733, 144242. [Google Scholar] [CrossRef] [PubMed]
- Olsen, S.K.; Garbi, M.; Zampieri, N.; Eliseenkova, A.V.; Ornitz, D.M.; Goldfarb, M.; Mohammadi, M. Fibroblast Growth Factor (FGF) Homologous Factors Share Structural but Not Functional Homology with FGFs. J. Biol. Chem. 2003, 278, 34226–34236. [Google Scholar] [CrossRef] [PubMed]
- Smallwood, P.M.; Munoz-Sanjuan, I.; Tong, P.; Macke, J.P.; Hendry, S.H.; Gilbert, D.J.; Copeland, N.G.; Jenkins, N.A.; Nathans, J. Fibroblast growth factor (FGF) homologous factors: New members of the FGF family implicated in nervous system development. Proc. Natl. Acad. Sci. USA 1996, 93, 9850–9857. [Google Scholar] [CrossRef]
- du Cros, D.L. Fibroblast growth factor and epidermal growth factor in hair development. J. Investig. Dermatol. 1993, 101 (Suppl. 1), 106s–113s. [Google Scholar] [CrossRef]
- Siekierska, A.; Isrie, M.; Liu, Y.; Scheldeman, C.; Vanthillo, N.; Lagae, L.; de Witte, P.A.; Van Esch, H.; Goldfarb, M.; Buyse, G.M. Gain-of-function FHF1 mutation causes early-onset epileptic encephalopathy with cerebellar atrophy. Neurology 2016, 86, 2162–2170. [Google Scholar] [CrossRef]
- Yeo, Y.; Yi, E.S.; Kim, J.-M.; Jo, E.-K.; Seo, S.; Kim, R.-I.; Kim, K.L.; Sung, J.-H.; Park, S.G.; Suh, W. FGF12 (Fibroblast Growth Factor 12) Inhibits Vascular Smooth Muscle Cell Remodeling in Pulmonary Arterial Hypertension. Hypertension 2020, 76, 1778–1786. [Google Scholar] [CrossRef] [PubMed]
- Kawano, M.; Komi-Kuramochi, A.; Asada, M.; Suzuki, M.; Oki, J.; Jiang, J.; Imamura, T. Comprehensive Analysis of FGF and FGFR Expression in Skin: FGF18 Is Highly Expressed in Hair Follicles and Capable of Inducing Anagen from Telogen Stage Hair Follicles. J. Investig. Dermatol. 2005, 124, 877–885. [Google Scholar] [CrossRef]
- Gonzalez, A.M.; Buscaglia, M.; Ong, M.; Baird, A. Distribution of basic fibroblast growth factor in the 18-day rat fetus: Localization in the basement membranes of diverse tissues. J. Cell Biol. 1990, 110, 753–765. [Google Scholar] [CrossRef]
- Rosenquist, T.A.; Martin, G.R. Fibroblast growth factor signalling in the hair growth cycle: Expression of the fibroblast growth factor receptor and ligand genes in the murine hair follicle. Dev. Dyn. 1996, 205, 379–386. [Google Scholar] [CrossRef]
- Osada, A.; Iwabuchi, T.; Kishimoto, J.; Hamazaki, T.S.; Okochi, H. Long-Term Culture of Mouse Vibrissal Dermal Papilla Cells and De Novo Hair Follicle Induction. Tissue Eng. 2007, 13, 975–982. [Google Scholar] [CrossRef]
- Suzuki, S.; Kato, T.; Takimoto, H.; Masui, S.; Oshima, H.; Ozawa, K.; Suzuki, S.; Imamura, T. Localization of rat FGF-5 protein in skin macrophage-like cells and FGF-5S protein in hair follicle: Possible involvement of two Fgf-5 gene products in hair growth cycle regulation. J. Investig. Dermatol. 1998, 111, 963–972. [Google Scholar] [CrossRef] [PubMed]
- Choi, N.; Shin, S.; Song, S.U.; Sung, J.-H. Minoxidil Promotes Hair Growth through Stimulation of Growth Factor Release from Adipose-Derived Stem Cells. Int. J. Mol. Sci. 2018, 19, 691. [Google Scholar] [CrossRef] [PubMed]
- Kadomatsu, K.; Huang, R.P.; Suganuma, T.; Murata, F.; Muramatsu, T. A retinoic acid responsive gene MK found in the teratocarcinoma system is expressed in spatially and temporally controlled manner during mouse embryogenesis. J. Cell Biol. 1990, 110, 607–616. [Google Scholar] [CrossRef] [PubMed]
- Choi, N.; Kim, W.-S.; Oh, S.H.; Sung, J.-H. HB-EGF Improves the Hair Regenerative Potential of Adipose-Derived Stem Cells via ROS Generation and Hck Phosphorylation. Int. J. Mol. Sci. 2019, 21, 122. [Google Scholar] [CrossRef]
- Iwashita, N.; Muramatsu, H.; Toriyama, K.; Torii, S. Expression of midkine in normal and burn sites of rat skin. Burns 1999, 25, 119–124. [Google Scholar] [CrossRef]
- Rendl, M.; Lewis, L.; Fuchs, E. Molecular Dissection of Mesenchymal–Epithelial Interactions in the Hair Follicle. PLoS Biol. 2005, 3, e331. [Google Scholar] [CrossRef]
- Rezza, A.; Sennett, R.; Tanguy, M.; Clavel, C.; Rendl, M. PDGF signalling in the dermis and in dermal condensates is dispensable for hair follicle induction and formation. Exp. Dermatol. 2015, 24, 468–470. [Google Scholar] [CrossRef]
- Tomita, Y.; Akiyama, M.; Shimizu, H. PDGF isoforms induce and maintain anagen phase of murine hair follicles. J. Dermatol. Sci. 2006, 43, 105–115. [Google Scholar] [CrossRef]
- Nakayama, F.; Müller, K.; Hagiwara, A.; Ridi, R.; Akashi, M.; Meineke, V. Involvement of Intracellular Expression of FGF12 in Radiation-Induced Apoptosis in Mast Cells. J. Radiat. Res. 2008, 49, 491–501. [Google Scholar] [CrossRef]
- Roberts, P.J.; Der, C.J. Targeting the Raf-MEK-ERK mitogen-activated protein kinase cascade for the treatment of cancer. Oncogene 2007, 26, 3291–3310. [Google Scholar] [CrossRef]
- Kolch, W. Meaningful relationships: The regulation of the Ras/Raf/MEK/ERK pathway by protein interactions. Biochem. J. 2000, 351 Pt 2, 289–305. [Google Scholar] [CrossRef] [PubMed]
- Song, S.-Y.; Chung, H.-M.; Sung, J.-H. The pivotal role of VEGF in adipose-derived-stem-cell-mediated regeneration. Expert Opin. Biol. Ther. 2010, 10, 1529–1537. [Google Scholar] [CrossRef]
- Choi, N.; Sung, J.-H. Udenafil Induces the Hair Growth Effect of Adipose-Derived Stem Cells. Biomol. Ther. 2019, 27, 404–413. [Google Scholar] [CrossRef] [PubMed]
- Song, S.-H.; Kim, K.; Jo, E.-K.; Kim, Y.-W.; Kwon, J.-S.; Bae, S.S.; Sung, J.-H.; Park, S.G.; Kim, J.T.; Suh, W. Fibroblast Growth Factor 12 Is a Novel Regulator of Vascular Smooth Muscle Cell Plasticity and Fate. Arter. Thromb. Vasc. Biol. 2016, 36, 1928–1936. [Google Scholar] [CrossRef] [PubMed]
- Livak, K.J.; Schmittgen, T.D. Analysis of relative gene expression data using real-time quantitative PCR and the 2−ΔΔCT Method. Methods 2001, 25, 402–408. [Google Scholar] [CrossRef] [PubMed]
Gene | Effect | Function | References |
---|---|---|---|
FGF1 | + | Involved in HF differentiation, prevents radiation-induced apoptosis in HF | [21,22,23] |
FGF2 | + | Involved in the proliferation of HF cells, elongation of the anagen phase | [24,25,26] |
FGF5 | − | Catagen induction, blocks DPC activation during anagen | [27,28,29] |
FGF7 | + | Elongation of the anagen phase, hair germ proliferation, stem cell activation | [3,30] |
FGF8 | − | Inhibits proliferation of epidermal cells | [31] |
FGF9 | + | Induces HF neogenesis after wounding | [32] |
FGF10 | + | HF formation and morphogenesis | [33,34] |
FGF13 | + | Regulates bulge/ORS cells, reduced expression in hypertrichosis | [35,36] |
FGF18 | − | Telogen induction, maintains stem cell quiescence | [37,38] |
FGF20 | + | Formation of dermal condensations, placode development | [39,40] |
FGF21 | + | Secondary HF development | [41] |
Gene | Forward (5′-3′) | Reverse (5′-3′) |
---|---|---|
GAPDH | GGAGCGAGATCCCTCCAAAAT | GGCTGTTGTCATACTTCTCATGG |
FGF12 | GGGACCAAGGACGAAAACAG | TTGCTGGCGGTACAGTGTG |
PDGFC | TGAACCAGGGTTCTGCATCCAC | TAAGCAGGTCCAGTGGCAAAGC |
MDK | CGCGGTCGCCAAAAAGAAAG | TACTTGCAGTCGGCTCCAAAC |
HB-EGF | TGTATCCACGGACCAGCTGCTA | TGCTCCTCCTTGTTTGGTGTGG |
IL1A | TGTATGTGACTGCCCAAGATGAAG | AGAGGAGGTTGGTCTCACTACC |
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations. |
© 2022 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Woo, J.; Suh, W.; Sung, J.-H. Hair Growth Regulation by Fibroblast Growth Factor 12 (FGF12). Int. J. Mol. Sci. 2022, 23, 9467. https://doi.org/10.3390/ijms23169467
Woo J, Suh W, Sung J-H. Hair Growth Regulation by Fibroblast Growth Factor 12 (FGF12). International Journal of Molecular Sciences. 2022; 23(16):9467. https://doi.org/10.3390/ijms23169467
Chicago/Turabian StyleWoo, Jiwon, Wonhee Suh, and Jong-Hyuk Sung. 2022. "Hair Growth Regulation by Fibroblast Growth Factor 12 (FGF12)" International Journal of Molecular Sciences 23, no. 16: 9467. https://doi.org/10.3390/ijms23169467