ASC Regulates Subcutaneous Adipose Tissue Lipogenesis and Lipolysis via p53/AMPKα Axis
Abstract
:1. Introduction
2. Results
2.1. ASC Expression Was Correlated with Obesity and Energy Metabolism
2.2. ASC Deficiency Regulated Metabolism In Vivo by Promoting Lipogenesis and Inhibiting Lipolysis in SAT
2.3. Ablation of ASC Promoted Lipogenesis and Suppressed Lipolysis In Vitro
2.4. Ablation of ASC Promoted Lipogenesis and Inhibited Lipolysis by Regulating p53/AMPKα Axis in SAT
3. Discussion
4. Materials and Methods
4.1. Animals
4.2. Glucose Tolerance and Insulin Tolerance Tests
4.3. Biochemical Determination
4.4. H&E Staining and Cell Size Quantitation
4.5. Isolation of SVF
4.6. Cell Culture
4.7. siRNA and Transfection
4.8. Oil Red O Staining
4.9. Flow Cytometry Analysis
4.10. Quantitative Real-Time PCR
4.11. Western Blot Analysis
4.12. Statistical Analysis
5. Conclusions
Supplementary Materials
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Conflicts of Interest
References
- Piche, M.E.; Tchernof, A.; Despres, J.P. Obesity Phenotypes, Diabetes, and Cardiovascular Diseases. Circ. Res. 2020, 126, 1477–1500. [Google Scholar] [CrossRef] [PubMed]
- Goossens, G.H. The Metabolic Phenotype in Obesity: Fat Mass, Body Fat Distribution, and Adipose Tissue Function. Obes. Facts 2017, 10, 207–215. [Google Scholar] [CrossRef] [PubMed]
- Ghaben, A.L.; Scherer, P.E. Adipogenesis and metabolic health. Nat. Rev. Mol. Cell Biol. 2019, 20, 242–258. [Google Scholar] [CrossRef] [PubMed]
- Chouchani, E.T.; Kajimura, S. Metabolic adaptation and maladaptation in adipose tissue. Nat. Metab. 2019, 1, 189–200. [Google Scholar] [CrossRef]
- Wallace, M.; Metallo, C.M. Tracing insights into de novo lipogenesis in liver and adipose tissues. Semin. Cell Dev. Biol. 2020, 108, 65–71. [Google Scholar] [CrossRef]
- Stern, J.H.; Rutkowski, J.M.; Scherer, P.E. Adiponectin, Leptin, and Fatty Acids in the Maintenance of Metabolic Homeostasis through Adipose Tissue Crosstalk. Cell. Metab. 2016, 23, 770–784. [Google Scholar] [CrossRef]
- Fusco, R.; Siracusa, R.; Genovese, T.; Cuzzocrea, S.; Di Paola, R. Focus on the Role of NLRP3 Inflammasome in Diseases. Int. J. Mol. Sci. 2020, 21, 4223. [Google Scholar] [CrossRef]
- Toldo, S.; Abbate, A. The NLRP3 inflammasome in acute myocardial infarction. Nat. Rev. Cardiol. 2018, 15, 203–214. [Google Scholar] [CrossRef]
- Salminen, A.; Kauppinen, A.; Hiltunen, M.; Kaarniranta, K. Epigenetic regulation of ASC/TMS1 expression: Potential role in apoptosis and inflammasome function. Cell Mol. Life Sci. 2014, 71, 1855–1864. [Google Scholar] [CrossRef]
- Yin, Z.; Deng, T.; Peterson, L.E.; Yu, R.; Lin, J.; Hamilton, D.J.; Reardon, P.R.; Sherman, V.; Winnier, G.E.; Zhan, M.; et al. Transcriptome analysis of human adipocytes implicates the NOD-like receptor pathway in obesity-induced adipose inflammation. Mol. Cell Endocrinol. 2014, 394, 80–87. [Google Scholar] [CrossRef] [Green Version]
- Li, X.; Zhang, Y.; Xia, M.; Gulbins, E.; Boini, K.M.; Li, P.L. Activation of Nlrp3 inflammasomes enhances macrophage lipid-deposition and migration: Implication of a novel role of inflammasome in atherogenesis. PLoS ONE 2014, 9, e87552. [Google Scholar] [CrossRef]
- Traba, J.; Sack, M.N. The role of caloric load and mitochondrial homeostasis in the regulation of the NLRP3 inflammasome. Cell Mol. Life Sci. 2017, 74, 1777–1791. [Google Scholar] [CrossRef] [PubMed]
- Traba, J.; Kwarteng-Siaw, M.; Okoli, T.C.; Li, J.; Huffstutler, R.D.; Bray, A.; Waclawiw, M.A.; Han, K.; Pelletier, M.; Sauve, A.A.; et al. Fasting and refeeding differentially regulate NLRP3 inflammasome activation in human subjects. J. Clin. Investig. 2015, 125, 4592–4600. [Google Scholar] [CrossRef] [PubMed]
- Furuhashi, M.; Hotamisligil, G.S. Fatty acid-binding proteins: Role in metabolic diseases and potential as drug targets. Nat. Rev. Drug Discov. 2008, 7, 489–503. [Google Scholar] [CrossRef]
- Duncan, R.E.; Ahmadian, M.; Jaworski, K.; Sarkadi-Nagy, E.; Sul, H.S. Regulation of lipolysis in adipocytes. Annu. Rev. Nutr. 2007, 27, 79–101. [Google Scholar] [CrossRef]
- Yin, Y.; Zhou, Z.; Liu, W.; Chang, Q.; Sun, G.; Dai, Y. Vascular endothelial cells senescence is associated with NOD-like receptor family pyrin domain-containing 3 (NLRP3) inflammasome activation via reactive oxygen species (ROS)/thioredoxin-interacting protein (TXNIP) pathway. Int. J. Biochem. Cell Biol. 2017, 84, 22–34. [Google Scholar] [CrossRef]
- Drexler, S.K.; Bonsignore, L.; Masin, M.; Tardivel, A.; Jackstadt, R.; Hermeking, H.; Schneider, P.; Gross, O.; Tschopp, J.; Yazdi, A.S. Tissue-specific opposing functions of the inflammasome adaptor ASC in the regulation of epithelial skin carcinogenesis. Proc. Natl. Acad. Sci. USA 2012, 109, 18384–18389. [Google Scholar] [CrossRef]
- Xu, M.; Yang, L.; Zhu, Y.; Liao, M.; Chu, L.; Li, X.; Lin, L.; Zheng, G. Collaborative effects of chlorogenic acid and caffeine on lipid metabolism via the AMPKalpha-LXRalpha/SREBP-1c pathway in high-fat diet-induced obese mice. Food Funct. 2019, 10, 7489–7497. [Google Scholar] [CrossRef]
- Herzig, S.; Shaw, R.J. AMPK: Guardian of metabolism and mitochondrial homeostasis. Nat. Rev. Mol. Cell Biol. 2018, 19, 121–135. [Google Scholar] [CrossRef]
- Budanov, A.V.; Karin, M. p53 target genes sestrin1 and sestrin2 connect genotoxic stress and mTOR signaling. Cell 2008, 134, 451–460. [Google Scholar] [CrossRef] [Green Version]
- Sullivan, J.E.; Brocklehurst, K.J.; Marley, A.E.; Carey, F.; Carling, D.; Beri, R.K. Inhibition of lipolysis and lipogenesis in isolated rat adipocytes with AICAR, a cell-permeable activator of AMP-activated protein kinase. FEBS Lett. 1994, 353, 33–36. [Google Scholar] [CrossRef]
- Napolitano, R.; De Matteis, S.; Carloni, S.; Bruno, S.; Abbati, G.; Capelli, L.; Ghetti, M.; Bochicchio, M.T.; Liverani, C.; Mercatali, L.; et al. Kevetrin induces apoptosis in TP53 wildtype and mutant acute myeloid leukemia cells. Oncol. Rep. 2020, 44, 1561–1573. [Google Scholar] [CrossRef] [PubMed]
- Masumoto, J.; Taniguchi, S.; Ayukawa, K.; Sarvotham, H.; Kishino, T.; Niikawa, N.; Hidaka, E.; Katsuyama, T.; Higuchi, T.; Sagara, J. ASC, a novel 22-kDa protein, aggregates during apoptosis of human promyelocytic leukemia HL-60 cells. J. Biol. Chem. 1999, 274, 33835–33838. [Google Scholar] [CrossRef]
- Wen, H.; Gris, D.; Lei, Y.; Jha, S.; Zhang, L.; Huang, M.T.; Brickey, W.J.; Ting, J.P. Fatty acid-induced NLRP3-ASC inflammasome activation interferes with insulin signaling. Nat. Immunol. 2011, 12, 408–415. [Google Scholar] [CrossRef]
- Stienstra, R.; van Diepen, J.A.; Tack, C.J.; Zaki, M.H.; van de Veerdonk, F.L.; Perera, D.; Neale, G.A.; Hooiveld, G.J.; Hijmans, A.; Vroegrijk, I.; et al. Inflammasome is a central player in the induction of obesity and insulin resistance. Proc. Natl. Acad. Sci. USA 2011, 108, 15324–15329. [Google Scholar] [CrossRef] [PubMed]
- Youm, Y.H.; Adijiang, A.; Vandanmagsar, B.; Burk, D.; Ravussin, A.; Dixit, V.D. Elimination of the NLRP3-ASC inflammasome protects against chronic obesity-induced pancreatic damage. Endocrinology 2011, 152, 4039–4045. [Google Scholar] [CrossRef]
- Furuoka, M.; Ozaki, K.; Sadatomi, D.; Mamiya, S.; Yonezawa, T.; Tanimura, S.; Takeda, K. TNF-alpha Induces Caspase-1 Activation Independently of Simultaneously Induced NLRP3 in 3T3-L1 Cells. J. Cell Physiol. 2016, 231, 2761–2767. [Google Scholar] [CrossRef]
- Jocken, J.W.; Blaak, E.E. Catecholamine-induced lipolysis in adipose tissue and skeletal muscle in obesity. Physiol. Behav. 2008, 94, 219–230. [Google Scholar] [CrossRef]
- Kitamura, T.; Kitamura, Y.; Kuroda, S.; Hino, Y.; Ando, M.; Kotani, K.; Konishi, H.; Matsuzaki, H.; Kikkawa, U.; Ogawa, W.; et al. Insulin-induced phosphorylation and activation of cyclic nucleotide phosphodiesterase 3B by the serine-threonine kinase Akt. Mol. Cell Biol. 1999, 19, 6286–6296. [Google Scholar] [CrossRef] [PubMed]
- Hardie, D.G.; Ross, F.A.; Hawley, S.A. AMP-activated protein kinase: A target for drugs both ancient and modern. Chem. Biol. 2012, 19, 1222–1236. [Google Scholar] [CrossRef] [Green Version]
- Carling, D. AMPK signalling in health and disease. Curr. Opin. Cell Biol. 2017, 45, 31–37. [Google Scholar] [CrossRef] [PubMed]
- Villena, J.A.; Viollet, B.; Andreelli, F.; Kahn, A.; Vaulont, S.; Sul, H.S. Induced adiposity and adipocyte hypertrophy in mice lacking the AMP-activated protein kinase-alpha2 subunit. Diabetes 2004, 53, 2242–2249. [Google Scholar] [CrossRef] [PubMed]
- Franck, D.; Tracy, L.; Armata, H.L.; Delaney, C.L.; Jung, D.Y.; Ko, H.J.; Ong, H.; Kim, J.K.; Scrable, H.; Sluss, H.K. Glucose Tolerance in Mice is Linked to the Dose of the p53 Transactivation Domain. Endocr. Res. 2013, 38, 139–150. [Google Scholar] [CrossRef] [PubMed]
- O’Leary, T.J.; Standish, S.M.; Bloomer, R.S. Severe periodontal destruction following impression procedures. J. Periodontol. 1973, 44, 43–48. [Google Scholar] [CrossRef]
- Huang, C.L.; Xiao, L.L.; Xu, M.; Li, J.; Li, S.F.; Zhu, C.S.; Lin, Y.L.; He, R.; Li, X. Chemerin deficiency regulates adipogenesis is depot different through TIMP1. Genes Dis. 2021, 8, 698–708. [Google Scholar] [CrossRef] [PubMed]
- Ohtsuka, T.; Ryu, H.; Minamishima, Y.A.; Macip, S.; Sagara, J.; Nakayama, K.I.; Aaronson, S.A.; Lee, S.W. ASC is a Bax adaptor and regulates the p53-Bax mitochondrial apoptosis pathway. Nat. Cell Biol. 2004, 6, 121–128. [Google Scholar] [CrossRef] [PubMed]
- Li, S.F.; Guo, L.; Qian, S.W.; Liu, Y.; Zhang, Y.Y.; Zhang, Z.C.; Zhao, Y.; Shou, J.Y.; Tang, Q.Q.; Li, X. G9a is transactivated by C/EBPbeta to facilitate mitotic clonal expansion during 3T3-L1 preadipocyte differentiation. Am. J. Physiol. Endocrinol. Metab. 2013, 304, E990–E998. [Google Scholar] [CrossRef]
- Li, W.; Zeng, H.; Xu, M.; Huang, C.; Tao, L.; Li, J.; Zhang, T.; Chen, H.; Xia, J.; Li, C.; et al. Oleanolic Acid Improves Obesity-Related Inflammation and Insulin Resistance by Regulating Macrophages Activation. Front. Pharmacol. 2021, 12, 697483. [Google Scholar] [CrossRef]
Primers | Sequence (5′-3′) | |
---|---|---|
Asc | Forward | CTTGTCAGGGGATGAACTCAAAA |
Reverse | GCCATACGACTCCAGATAGTAGC | |
Fabp4 | Forward | GCGTAAATGGGGATTTGGTC |
Reverse | CTCCTGTCGTCTGCGGTGATT | |
Fasn | Forward | AGGTGGTGATAGCCGGTATGT |
Reverse | TGGGTAATCCATAGAGCCCAG | |
18s | Forward | CGCCGCTAGAGGTGAAATTCT |
Reverse | CATTCTTGGCAAATGCTTTCG | |
Acc | Forward | CACCAGTTTTGCATTGAGAAC |
Reverse | TACGCTGTTGAGTTCATAGGC | |
Srebp1c | Forward | GGAGCCATGGATTGCACATT |
Reverse | CAGGAAGGCTTCCAGAGAGG | |
Scd1 | Forward | CTCTACACCTGCCTCTTCGG |
Reverse | GCCGTGCCTTGTAAGTTCTG | |
Cd36 | Forward | TGGTCAAGCCAGCTAGAAA |
Reverse | TCCCAAGTAAGGCCATCTC | |
Lxrα | Forward | GCCTACAGAACTTCGTCCACA |
Reverse | AAGAATCCCTTGCAGCCCTC | |
Mcd | Forward | GGGGCTGTGATGTGGCGTAT |
Reverse | GGGCTACCAGGCTGAGGAT | |
Dgat1 | Forward | GTTTCCGTCCAGGGTGGTAGT |
Reverse | TGGCACCTCAGATCCCAGTAG |
Antibody | Company | Cat Number | Dilution |
---|---|---|---|
α-Tubulin | Cell Signaling Technology | 2125S | 1:1000 |
ASC | Cell Signaling Technology | 67824 | 1:2000 |
FASN | Proteintech | 66591-1-1g | 1:1000 |
ACC | Proteintech | 21923-1-AP | 1:1000 |
FABP4 | Affinity | DF6035 | 1:1000 |
p-HSL | Novus | NBP3-05459 | 1:1000 |
HSL | Cell Signaling Technology | 4107S | 1:1000 |
ATGL | Cell Signaling Technology | 2439S | 1:1000 |
p53 | Santa Cruz Technology | SC-126 | 1:1000 |
p-p53 | Abmart | T40061 | 1:1000 |
AMPKα | Santa Cruz Technology | SC-74464 | 1:1000 |
p-AMPKα | Cell Signaling Technology | 2535S | 1:1000 |
p-p65 | Cell Signaling Technology | 3033S | 1:1000 |
p65 | Cell Signaling Technology | 8242S | 1:1000 |
IL-1β | Santa Cruz Technology | SC-12742 | 1:1000 |
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations. |
© 2022 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Chen, H.; Pei, Q.; Tao, L.; Xia, J.; Lu, G.; Zong, Y.; Xie, W.; Li, W.; Huang, C.; Zeng, T.; et al. ASC Regulates Subcutaneous Adipose Tissue Lipogenesis and Lipolysis via p53/AMPKα Axis. Int. J. Mol. Sci. 2022, 23, 10042. https://doi.org/10.3390/ijms231710042
Chen H, Pei Q, Tao L, Xia J, Lu G, Zong Y, Xie W, Li W, Huang C, Zeng T, et al. ASC Regulates Subcutaneous Adipose Tissue Lipogenesis and Lipolysis via p53/AMPKα Axis. International Journal of Molecular Sciences. 2022; 23(17):10042. https://doi.org/10.3390/ijms231710042
Chicago/Turabian StyleChen, Hong, Qilin Pei, Linfen Tao, Jing Xia, Guocai Lu, Ying Zong, Wenhua Xie, Wanqing Li, Chenglong Huang, Ting Zeng, and et al. 2022. "ASC Regulates Subcutaneous Adipose Tissue Lipogenesis and Lipolysis via p53/AMPKα Axis" International Journal of Molecular Sciences 23, no. 17: 10042. https://doi.org/10.3390/ijms231710042