Physiological and Transcriptome Analyses Revealed the Mechanism by Which Deferoxamine Promotes Iron Absorption in Cinnamomum camphora
Abstract
:1. Introduction
2. Results
2.1. Deferoxamine Promoted the Iron Absorption of C. camphora
2.2. The Whole Transcriptional Response Spectrum of C. camphora to Deferrioxamine
2.3. Analysis of the GO and KEGG Enrichment Pathways of DFO-Induced Transcriptional Changes in C. camphora
2.4. DFO Regulates the Expression of Photosynthesis-Related Genes in C. camphora
2.5. Reduced Glutathione (GSH) Contributes to DFO Alleviating Iron Deficiency Etiolation of C. camphora
2.6. Transcription Factor Family Analysis of C. camphora Caused by DFO
2.7. RT–qPCR Verification of Transcriptome Data with and without DFO Camphor Roots
3. Discussion
4. Materials and Methods
4.1. Plant Material and Growth Conditions
4.2. SPAD Value
4.3. Determination of the Endogenous Iron Content
4.4. Assays for H+ ATPase and FCR Activities and the Glutathione Content in Plants
4.5. RNA-Sequencing (RNA-Seq) Analysis
4.6. Real-Time Quantitative PCR (RT–qPCR)
4.7. Data Analysis and Processing
5. Conclusions
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Conflicts of Interest
References
- Flores-Cortez, I.; Winkler, R.; Ramírez-Ordorica, A.; Elizarraraz-Anaya, M.I.C.; Carrillo-Rayas, M.T.; Valencia-Cantero, E.; Macías-Rodríguez, L. A Mass Spectrometry-Based Study Shows that Volatiles Emitted by Arthrobacter agilis UMCV2 Increase the Content of Brassinosteroids in Medicago truncatula in Response to Iron Deficiency Stress. Molecules 2019, 24, 3011. [Google Scholar]
- Sun, W.J.; Zhang, J.C.; Ji, X.L.; Feng, Z.Q.; Wang, X.; Huang, W.J.; You, C.X.; Wang, X.F.; Hao, Y.J. Low nitrate alleviates iron deficiency by regulating iron homeostasis in apple. Plant Cell Environ. 2021, 44, 1869–1884. [Google Scholar]
- Murad, E. Mossbauer spectroscopy of clays, soils and their mineral constituents. Clay Miner. 2010, 45, 413–430. [Google Scholar]
- Freitas, M.A.; Medeiros, F.H.V.; Carvalho, S.P.; Guilherme, L.R.G.; Teixeira, W.D.; Zhang, H.; Paré, P.W. Augmenting iron accumulation in cassava by the beneficial soil bacterium Bacillus subtilis (GBO3). Front. Plant Sci. 2015, 6, 596. [Google Scholar] [PubMed]
- Wei, Y.; Wu, X.; Zeng, R.; Cai, C.; Guo, Z. Spatial variations of aggregate-associated humic substance in heavy-textured soils along a climatic gradient. Soil Tillage Res. 2020, 197, 104497. [Google Scholar]
- Tsai, H.H.; Schmidt, W. Mobilization of Iron by Plant-Borne Coumarins. Trends Plant Sci. 2017, 22, 538–548. [Google Scholar] [PubMed]
- Ipek, M.; Aras, S.; Arikan, Ş.; Eşitken, A.; Pirlak, L.; Dönmez, M.F.; Turan, M. Root plant growth promoting rhizobacteria inoculations increase ferric chelate reductase (FC-R) activity and Fe nutrition in pear under calcareous soil conditions. Sci. Hortic. 2017, 219, 144–151. [Google Scholar]
- Castulo-Rubio, D.Y.; Alejandre-Ramírez, N.A.; del Carmen Orozco-Mosqueda, M.; Santoyo, G.; Macías-Rodríguez, L.I.; Valencia-Cantero, E. Volatile organic compounds produced by the rhizobacterium Arthrobacter agilis UMCV2 modulate Sorghum bicolor (Strategy II Plant) morphogenesis and SbFRO1 transcription in vitro. J. Plant Growth Regul. 2015, 34, 611–623. [Google Scholar]
- Aznar, A.; Chen, N.W.; Rigault, M.; Riache, N.; Joseph, D.; Desmaële, D.; Mouille, G.; Boutet, S.; Soubigou-Taconnat, L.; Renou, J.P.; et al. Scavenging iron: A novel mechanism of plant immunity activation by Microbial Siderophores. Plant Physiol. 2014, 164, 2167–2183. [Google Scholar]
- Zhou, C.; Zhu, L.; Ma, Z.; Wang, J. Improved iron acquisition of Astragalus sinicus under low iron-availability conditions by soil-borne bacteria Burkholderia cepacia. J. Plant Interact. 2018, 13, 9–20. [Google Scholar]
- Liu, D.; Yang, Q.; Ge, K.; Hu, X.; Qi, G.; Du, B.; Liu, K.; Ding, Y. Promotion of iron nutrition and growth on peanut by Paenibacillus illinoisensis and Bacillus sp. strains in calcareous soil. Braz. J. Microbiol. 2017, 48, 656–670. [Google Scholar] [CrossRef] [PubMed]
- Zhao, L.; Wang, F.; Zhang, Y.; Zhang, J. Involvement of Trichoderma asperellum strain T6 in regulating iron acquisition in plants. J. Basic Microbiol. 2014, 541, S115–S124. [Google Scholar] [CrossRef] [PubMed]
- Arif, K.; Archana, G.; Desai, A.J. Engineering heterologous iron siderophore complex utilization in rhizobia: Effect on growth of peanut and pigeon pea plants. Appl. Soil Ecol. 2012, 53, 65–73. [Google Scholar] [CrossRef]
- Sadrarhami, A.; Grove, J.H.; Zeinali, H. The microbial siderophore desferrioxamine B inhibits Fe and Zn uptake in three spring wheat genotypes grown in Fe-deficient nutrient solution. J. Plant Nutr. 2021, 44, 2299–2309. [Google Scholar] [CrossRef]
- Ghavami, N.; Alikhani, H.A.; Pourbabaei, A.A.; Besharati, H. Effects of two new siderophore-producing rhizobacteria on growth and iron content of maize and canola plants. J. Plant Nutr. 2017, 40, 736–746. [Google Scholar] [CrossRef]
- Nagata, T.; Oobo, T.; Aozasa, O. Efficacy of a bacterial siderophore, pyoverdine, to supply iron to Solanum lycopersicum plants. J. Biosci. Bioeng. 2013, 115, 686–690. [Google Scholar] [CrossRef]
- Ferreira, M.J.; Silva, H.; Cunha, A. Siderophore-producing rhizobacteria as a promising tool for empowering plants to cope with iron limitation in saline soils: A. review. Pedosphere 2019, 29, 409–420. [Google Scholar] [CrossRef]
- Ferreira, C.M.H.; Vilas-Boas, Â.; Sousa, C.A.; Soares, H.; Soares, E.V. Comparison of five bacterial strains producing siderophores with ability to chelate iron under alkaline conditions. AMB Express 2019, 9, 1–12. [Google Scholar] [CrossRef] [Green Version]
- Li, C.; Zhu, L.; Pan, D.; Li, S.; Xiao, H.; Zhang, Z.; Shen, X.; Wang, Y.; Long, M. Siderophore-mediated iron acquisition enhances resistance to oxidative and aromatic compound stress in Cupriavidus necator JMP134. Appl. Environ. Microbiol. 2019, 85, e01746-19. [Google Scholar] [CrossRef]
- Morcillo, R.; Vílchez, J.; Zhang, S.; Kaushal, R.; He, D.; Zi, H.; Liu, R.; Niehaus, K.; Handa, A.; Zhang, H. Plant transcriptome reprograming and bacterial extracellular metabolites underlying tomato drought resistance triggered by a beneficial soil bacteria. Metabolites 2021, 11, 369. [Google Scholar] [CrossRef]
- Chen, L.; Liu, H.; Ma, Q. The early transcriptional responses in rose induced by Bacillus velezensis CLA178 and Agrobacterium tumefaciens C58. J. Phytopathol. 2021, 169, 73–82. [Google Scholar] [CrossRef]
- Liu, H.; Wang, J.; Sun, H.; Han, X.; Peng, Y.; Liu, J.; Liu, K.; Ding, Y.; Wang, C.; Du, B. Transcriptome profiles reveal the growth-promoting mechanisms of Paenibacillus polymyxa YC0136 on Tobacco (Nicotiana tabacum L.). Front. Microbiol. 2020, 11, 584174. [Google Scholar]
- Orozco-Mosqueda, M.D.C.; Santoyo, G.; Farias-Rodriguez, R.; Macías-Rodríguez, L.; Valencia-Cantero, E. Identification and expression analysis of multiple FRO gene copies in Medicago truncatula. Genet. Mol. Res. 2012, 11, 4402–4410. [Google Scholar]
- Jeong, J.; Connolly, E.L. Iron uptake mechanisms in plants: Functions of the FRO family of ferric reductases. Plant Sci. 2009, 176, 709–714. [Google Scholar] [CrossRef]
- Jain, A.; Wilson, G.T.; Connolly, E.L. Connolly, The diverse roles of FRO family metalloreductases in iron and copper homeostasis. Front. Plant Sci. 2014, 5, 100. [Google Scholar]
- Rather, L.J.; Zhou, Q.; Li, Q. Re-use of Cinnamomum camphora natural dye generated wastewater for sustainable UV protective and antioxidant finishing of wool fabric: Effect of Fe(II) sulfate. Sustain. Chem. Pharm. 2021, 21, 100422. [Google Scholar]
- Tangjitjaroenkun, J.; Pluempanupat, W.; Tangchitcharoenkhul, R.; Yahayo, W.; Supabphol, R. Antibacterial, antioxidant, cytotoxic effects and GC-MS analysis of mangrove-derived Streptomyces achromogenes TCH4 extract. Arch. Biol. Sci. 2021, 73, 223–235. [Google Scholar] [CrossRef]
- Xia, K.; Luo, H.; Ma, R.; Zhang, R.; Zhu, W.; Fu, P. Aromatic polyketides and hydroxamate siderophores from a marine-algae-derived streptomyces species. J. Nat. Prod. 2021, 84, 1550–1555. [Google Scholar] [CrossRef]
- Fernández, V.; Ebert, G.; Winkelmann, G. The use of microbial siderophores for foliar iron application studies. Plant Soil 2005, 272, 245–252. [Google Scholar]
- Fernandez, V.; Winkelmann, G. The determination of ferric iron in plants by HPLC using the microbial iron chelator desferrioxamine E. Biometals 2005, 18, 53–62. [Google Scholar]
- Wiche, O.; Tischler, D.; Fauser, C.; Lodemann, J.; Heilmeier, H. Effects of citric acid and the siderophore desferrioxamine B (DFO-B) on the mobility of germanium and rare earth elements in soil and uptake in Phalaris arundinacea. Int. J. Phytoremediat. 2017, 19, 746–754. [Google Scholar] [CrossRef] [PubMed]
- Kong, W.-L.; Wu, X.-Q.; Zhao, Y.-J. Effects of Rahnella aquatilis JZ-GX1 on treat chlorosis induced by iron deficiency in Cinnamomum camphora. J. Plant Growth Regul. 2020, 39, 877–887. [Google Scholar] [CrossRef]
- Zhao, Y.; Li, H.; Sun, M.; Liang, Z.; Yu, F.; Li, F.; Liu, S. Effects of soil aeration and fertilization practices on alleviating iron deficiency chlorosis in “Huangguan” pears grafted onto quince A in calcareous soils. Horticulturae 2021, 7, 172. [Google Scholar] [CrossRef]
- Yang, D.; Li, J.; Cheng, Y.; Wan, F.; Jia, R.; Wang, Y. Compound repair effect of carbon dots and Fe2+ on iron deficiency in Cucumis melon L. Plant Physiol. Biochem. 2019, 142, 137–142. [Google Scholar] [CrossRef]
- Chen, H.-M.; Wang, Y.-M.; Yang, H.-L.; Zeng, Q.-Y.; Liu, Y.-J. NRAMP1 promotes iron uptake at the late stage of iron deficiency in poplars. Tree Physiol. 2019, 39, 1235–1250. [Google Scholar] [CrossRef]
- Alcañiz, S.; Jordá, J.D.; Cerdán, M. Effectiveness of iron ethylenediamine-N,N′-bis(hydroxyphenylacetic) acid (o,o-EDDHA/Fe3+) formulations with different ratios of meso and d,l-racemic isomers as iron fertilizers. J. Agric. Food Chem. 2017, 65, 253–259. [Google Scholar]
- Carrasco-Gil, S.; Rios, J.J.; Álvarez-Fernández, A.; Abadía, A.; García-Mina, J.M.; Abadia, J. Effects of individual and combined metal foliar fertilisers on iron- and manganese-deficient Solanum lycopersicum plants. Plant Soil 2016, 402, 27–45. [Google Scholar] [CrossRef]
- Shaddox, T.W.; Fu, H.; Gardner, D.S.; Goss, R.M.; Guertal, E.A.; Kreuser, W.C.; Miller, G.L.; Stewart, B.R.; Tang, K.; Unruh, J.B. Solubility of ten iron fertilizers in eleven north american soils. Agron. J. 2019, 111, 1498–1505. [Google Scholar] [CrossRef]
- Dehno, A.H.; Mohtadi, A. The effect of different iron concentrations on lead accumulation in hydroponically grown Matthiola flavida Boiss. Ecol. Res. 2018, 33, 757–765. [Google Scholar] [CrossRef]
- Dellagi, A.; Segond, D.; Rigault, M.; Fagard, M.; Simon, C.; Saindrenan, P.; Expert, D. Microbial siderophores exert a subtle role in arabidopsis during infection by manipulating the immune response and the iron status. Plant Physiol. 2009, 150, 1687–1696. [Google Scholar] [CrossRef]
- Lopez, J.A.V.; Nogawa, T.; Futamura, Y.; Shimizu, T.; Osada, H. Nocardamin glucuronide, a new member of the ferrioxamine siderophores isolated from the ascamycin-producing strain Streptomyces sp. 80H647. J. Antibiot. 2019, 72, 991–995. [Google Scholar]
- Pamula, A.S.P.; Lampert, D.J.; Atiyeh, H.K. Well-to-wake analysis of switchgrass to jet fuel via a novel co-fermentation of sugars and CO2. Sci. Total Environ. 2021, 782, 146770. [Google Scholar]
- Rödiger, A.; Agne, B.; Dobritzsch, D.; Helm, S.; Müller, F.; Pötzsch, N.; Baginsky, S. Chromoplast differentiation in bell pepper (Capsicum annuum) fruits. Plant J. 2021, 105, 1431–1442. [Google Scholar]
- Grabsztunowicz, M.; Mulo, P.; Baymann, F.; Mutoh, R.; Kurisu, G.; Sétif, P.; Beyer, P.; Krieger-Liszkay, A. Electron transport pathways in isolated chromoplasts from Narcissus pseudonarcissus L. Plant J. 2019, 99, 245–256. [Google Scholar]
- Chen, W.; Ko, Y. Exogenous hydrogen peroxide induces chilling tolerance in Phalaenopsis seedlings through glutathione-related antioxidant system. Sci. Hortic. 2021, 289, 110421. [Google Scholar]
- Ellouzi, H.; Oueslati, S.; Hessini, K.; Rabhi, M.; Abdelly, C. Seed-priming with H2O2 alleviates subsequent salt stress by preventing ROS production and amplifying antioxidant defense in cauliflower seeds and seedlings. Sci. Hortic. 2021, 288, 110360. [Google Scholar]
- Szymansky, C.-M.; Muscolo, A.; Yeo, M.; Colville, L.; Clatworthy, I.; Salge, T.; Seal, C.E. Elemental localisation and a reduced glutathione redox state protect seeds of the halophyte Suaeda maritima from salinity during over-wintering and germination. Environ. Exp. Bot. 2021, 190, 104569. [Google Scholar]
- Sorribes-Dauden, R.; Martínez-Pastor, M.T.; Puig, S. Expression of a truncated yeast Ccc1 vacuolar transporter increases the accumulation of endogenous iron. Genes 2021, 12, 1120. [Google Scholar]
- Cai, Y.; Li, Y.; Liang, G. FIT and bHLH Ib transcription factors modulate iron and copper crosstalk in Arabidopsis. Plant Cell Environ. 2021, 44, 1679–1691. [Google Scholar]
- Ling, H.-Q.; Bauer, P.; Bereczky, Z.; Keller, B.; Ganal, M. The tomato fer gene encoding a bHLH protein controls iron-uptake responses in roots. Proc. Natl. Acad. Sci. USA 2002, 99, 13938–13943. [Google Scholar]
- Bauer, P.; Ling, H.Q.; Guerinot, M.L. FIT, the FER-like iron deficiency induced transcription factor in Arabidopsis. Plant Physiol. Biochem. 2007, 45, 260–261. [Google Scholar] [CrossRef] [PubMed]
- Cao, L.D.; Gao, Y.; Yu, J.L.; Niu, S.Q.; Zeng, J.R.; Yao, Q.Q.; Wang, X.; Bu, Z.G.; Xu, T.; Liu, X.M.; et al. Streptomyces hygroscopicus OsiSh-2-induced mitigation of Fe deficiency in rice plants. Plant Physiol. Biochem. 2021, 158, 275–283. [Google Scholar] [CrossRef] [PubMed]
- Ahammed, G.J.; Wu, M.; Wang, Y.; Yan, Y.; Mao, Q.; Ren, J.; Ma, R.; Liu, A.; Chen, S. Melatonin alleviates iron stress by improving iron homeostasis, antioxidant defense and secondary metabolism in cucumber. Sci. Hortic. 2020, 265, 109205. [Google Scholar] [CrossRef]
- Li, Y.; Li, J.; Yu, Y.; Dai, X.; Gong, C.; Gu, D.; Xu, E.; Liu, Y.; Zou, Y.; Zhang, P.; et al. The tonoplast-localized transporter OsNRAMP2 is involved in iron homeostasis and affects seed germination in rice. J. Exp. Bot. 2021, 72, 4839–4852. [Google Scholar] [CrossRef]
- Connorton, J.M.; Jones, E.R.; Rodríguez-Ramiro, I.; Fairweather-Tait, S.; Uauy, C.; Balk, J. Wheat vacuolar iron transporter ta VIT2 transports Fe and Mn and is effective for biofortification. Plant Physiol. 2017, 174, 2434–2444. [Google Scholar] [CrossRef] [Green Version]
- Hu, Y.T.; Ming, F.; Chen, W.W.; Yan, J.Y.; Xu, Z.Y.; Li, G.X.; Xu, C.Y.; Yang, J.L.; Zheng, S.J. TcOPT3, a member of oligopeptide transporters from the hyperaccumulator thlaspi caerulescens, is a novel Fe/Zn/Cd/Cu transporter. PLoS ONE 2012, 7, e38535. [Google Scholar] [CrossRef]
- Tang, C.; Zhu, X.; Qiao, X.; Gao, H.; Li, Q.; Wang, P.; Wu, J.; Zhang, S. Characterization of the pectin methyl-esterase gene family and its function in controlling pollen tube growth in pear (Pyrus bretschneideri). Genomics 2020, 112, 2467–2477. [Google Scholar]
- Ye, Y.Q.; Jin, C.W.; Fan, S.K.; Mao, Q.Q.; Sun, C.L.; Yu, Y.; Lin, X.Y. Elevation of NO production increases Fe immobilization in the Fe-deficiency roots apoplast by decreasing pectin methylation of cell wall. Sci. Rep. 2015, 5, 10746. [Google Scholar] [CrossRef]
- Guo, X.P.; Bian, Y.W.; Wang, D.S.; Wu, Z.Y.; Wang, H.Z.; Lian, X.D.; Guo, P. Transcriptome analysis of nanocellulose-Fe chelate correcting iron-deficiency chlorosis of pear. J. Henan Agric. Sci. 2021, 50, 117–129. (In Chinese) [Google Scholar]
- Sezer, I.; Kiremit, M.S.; Öztürk, E.; Subrata, B.A.G.; Osman, H.M.; Akay, H.; Arslan, H. Role of melatonin in improving leaf mineral content and growth of sweet corn seedlings under different soil salinity levels. Sci. Hortic. 2021, 288, 110376. [Google Scholar] [CrossRef]
- Koseoglu, A.T.; Acikgoz, V. Determination of iron chlorosis with extractable iron analysis in peach leaves. J. Plant Nutr. 1995, 18, 153–161. [Google Scholar] [CrossRef]
- Ni, L.L.; Hou, S.Q.; Feng, S.D.; Wu, C.Y.; Lu, X.L.; Wei, J. Application of improved NH4F masking method in determination of ferrous iron in plant tissues. Plant Physiol. J. 2015, 51, 1347–1349. [Google Scholar]
- Zhang, H.; Sun, Y.; Xie, X.; Kim, M.S.; Dowd, S.E.; Paré, P.W. A soil bacterium regulates plant acquisition of iron via deficiency-inducible mechanisms. Plant J. 2009, 58, 568–577. [Google Scholar] [CrossRef]
- Arıkan, Ş.; Eşitken, A.; İpek, M.; Aras, S.; Şahin, M.; Pırlak, L.; Dönmez, M.F.; Turan, M. Effect of plant growth promoting rhizobacteria on Fe acquisition in peach (Prunus persica L.) under calcareous soil conditions. J. Plant Nutr. 2018, 41, 2141–2150. [Google Scholar] [CrossRef]
- Kong, W.L.; Wang, Y.H.; Wu, X.Q. Enhanced iron uptake in plants by volatile emissions of Rahnella aquatilis JZ-GX1. Front. Plant Sci. 2021, 12, 704000. [Google Scholar] [CrossRef]
- Kong, W.L.; Rui, L.; Ni, H.; Wu, X.Q. Antifungal effects of volatile organic compounds produced by Rahnella aquatilis JZ-GX1 Against Colletotrichum gloeosporioides in Liriodendron chinense x tulipifera. Front. Microbiol. 2020, 11, 1114. [Google Scholar] [CrossRef]
Gene Name | Gene Function | Primers |
---|---|---|
CcFRO6 | Ferric reduction oxidase 6 | AATGCCACAATGACAATA TAAGAAGACCAATCACAAG |
CcFRO8 | Ferric reduction oxidase 8 | CATCTCTATTGCTGAACTTA GCTTATACTGCCATACATT |
CcIRT2 | Fe2+ transport protein 2 | AAGATGGAGAAGATGACA ACTGAGTGAACTACAATTC |
CcVIT3 | Vacuolar iron transported 3 | GTTCGTCTCCGTCTACTC CTCTCTTTACCCTCTTCCTT |
CcVIT4 | Vacuolar iron transported 4 | TCTCCGTCTACTCACAAT CTTCCTCACCCTCTCTAC |
CcFER | Ferredoxin−NADP reductase | TCTCCGTCTACTCACAAT CTTCCTCACCCTCTCTAC |
CcOPT3 | Oligopeptide transported 3 | GGTCCTCTATTCTCAATC CGTGTCCATTAGAAGTAA |
CcNramp5 | Metal transporter 5 | AACATCTATTATCTTAGCA TATCTATGAAGGTGACTA |
CcAHA2 | V−type proton ATPase 2 | AGAAGAAGAAGAAGAAGACACT |
ATACATCTGCGTCGTTCAT | ||
CcPME | Pectinesterase | TTGTAGGAGATGGAAGAGA |
GACTGTTGCTGAGTTGAA | ||
CcPMEI | Pectinesterase inhibitor | CAGTTATGATGAGAAGGA |
ATTAGAGGAGGAGAAGAA | ||
CcEF1α | Endogenous control, Reference gene | TCCAAGGCACGGTATGAT CCTGAAGAGGGAGACGAA |
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations. |
© 2022 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Kong, W.-L.; Wen, T.-Y.; Wang, Y.-H.; Wu, X.-Q. Physiological and Transcriptome Analyses Revealed the Mechanism by Which Deferoxamine Promotes Iron Absorption in Cinnamomum camphora. Int. J. Mol. Sci. 2022, 23, 9854. https://doi.org/10.3390/ijms23179854
Kong W-L, Wen T-Y, Wang Y-H, Wu X-Q. Physiological and Transcriptome Analyses Revealed the Mechanism by Which Deferoxamine Promotes Iron Absorption in Cinnamomum camphora. International Journal of Molecular Sciences. 2022; 23(17):9854. https://doi.org/10.3390/ijms23179854
Chicago/Turabian StyleKong, Wei-Liang, Tong-Yue Wen, Ya-Hui Wang, and Xiao-Qin Wu. 2022. "Physiological and Transcriptome Analyses Revealed the Mechanism by Which Deferoxamine Promotes Iron Absorption in Cinnamomum camphora" International Journal of Molecular Sciences 23, no. 17: 9854. https://doi.org/10.3390/ijms23179854