microRNAs Control Antiviral Immune Response, Cell Death and Chemotaxis Pathways in Human Neuronal Precursor Cells (NPCs) during Zika Virus Infection
Abstract
:1. Introduction
2. Results
2.1. ZIKV Infects Human NPCs
2.2. ZIKV Modulates miRNAs Profile in Human NPCs
2.3. ZIKV Downregulates miRNAs Increasing Cell Death of Human NPCs
2.4. ZIKV Downregulates miRNAs to Recruit Immune Cells and Modulate the Immune Response
2.5. ZIKV Downregulates miRNAs to Increase Ubiquitination, and Antigen Presentation
3. Discussion
4. Material and Methods
4.1. Human NPCs Culture
4.2. Viral Culture and Amplification
4.3. Viral Titration
4.4. In Vitro Infection
4.5. RNA Extraction and cDNA Synthesis
4.6. Real-Time PCR Quantification
4.7. miRNAs Expression
4.8. miRNAs Computational Analysis
4.9. Mapping of RNA-Seq Libraries and Differential Gene Expression Analysis
4.10. Network Reconstruction
4.11. Immunofluorescence
4.12. Cytokine Quantification
4.13. Statistical Analysis
Supplementary Materials
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Acknowledgments
Conflicts of Interest
References
- Paixão, S.; Barreto, F.; da Glória Teixeira, M.; da Conceição, N.; Costa, M.R.L. History, Epidemiology, and Clinical Manifestations of Zika: A Systematic Review. Am. J. Public Health 2016, 106, 606–612. [Google Scholar] [CrossRef] [PubMed]
- Brasil, P.; Pereira, J.P.; Moreira, M.E.; Ribeiro Nogueira, R.M.; Damasceno, L.; Wakimoto, M.; Rabello, R.S.; Valderramos, S.G.; Halai, U.-A.; Salles, T.S.; et al. Zika Virus Infection in Pregnant Women in Rio de Janeiro. N. Engl. J. Med. 2016, 375, 2321–2334. [Google Scholar] [CrossRef] [PubMed]
- Campos, G.S.; Bandeira, A.C.; Sardi, S.I. Zika Virus Outbreak, Bahia, Brazil. Emerg. Infect. Dis. 2015, 21, 1885–1886. [Google Scholar] [CrossRef]
- Ventura, C.V.; Maia, M.; Dias, N.; Ventura, L.O.; Belfort, R. Zika: Neurological and Ocular Findings in Infant without Microcephaly. Lancet 2016, 387, 2502. [Google Scholar] [CrossRef]
- Polonio, C.M.; de Freitas, C.L.; Zanluqui, N.G.; Peron, J.P.S. Zika Virus Congenital Syndrome: Experimental Models and Clinical Aspects. J. Venom. Anim. Toxins Trop. Dis. 2017, 23, 41. [Google Scholar] [CrossRef]
- Mlakar, J.; Korva, M.; Tul, N.; Popović, M.; Poljšak-Prijatelj, M.; Mraz, J.; Kolenc, M.; Resman Rus, K.; Vesnaver Vipotnik, T.; Fabjan Vodušek, V.; et al. Zika Virus Associated with Microcephaly. N. Engl. J. Med. 2016, 374, 951–958. [Google Scholar] [CrossRef]
- Miner, J.J.; Cao, B.; Govero, J.; Smith, A.M.; Fernandez, E.; Cabrera, O.H.; Garber, C.; Noll, M.; Klein, R.S.; Noguchi, K.K.; et al. Zika Virus Infection during Pregnancy in Mice Causes Placental Damage and Fetal Demise. Cell 2016, 165, 1081–1091. [Google Scholar] [CrossRef]
- Li, C.; Xu, D.; Ye, Q.; Hong, S.; Jiang, Y.; Liu, X.; Zhang, N.; Shi, L.; Qin, C.-F.; Xu, Z. Zika Virus Disrupts Neural Progenitor Development and Leads to Microcephaly in Mice. Cell Stem Cell 2016, 19, 120–126. [Google Scholar] [CrossRef]
- Cugola, F.R.; Fernandes, I.R.; Russo, F.B.; Freitas, B.C.; Dias, J.L.M.; Guimarães, K.P.; Benazzato, C.; Almeida, N.; Pignatari, G.C.; Romero, S.; et al. The Brazilian Zika Virus Strain Causes Birth Defects in Experimental Models. Nature 2016, 534, 267–271. [Google Scholar] [CrossRef]
- Higa, L.M.; Trindade, P.; Delvecchio, R.; Tanuri, A.; Rehen, S.K. Zika Virus Impairs Growth in Human Neurospheres and Brain Organoids. Science 2016, 352, 816–818. [Google Scholar]
- Qian, X.; Nguyen, H.N.; Song, M.M.; Hadiono, C.; Ogden, S.C.; Hammack, C.; Yao, B.; Hamersky, G.R.; Jacob, F.; Zhong, C.; et al. Brain-Region-Specific Organoids Using Mini- Bioreactors for Modeling ZIKV Exposure Brain-Region-Specific Organoids Using Mini-Bioreactors for Modeling ZIKV Exposure. Cell 2016, 165, 1238–1254. [Google Scholar] [CrossRef] [Green Version]
- Coffey, L.L.; Keesler, R.I.; Pesavento, P.A.; Woolard, K.; Singapuri, A.; Watanabe, J.; Cruzen, C.; Christe, K.L.; Usachenko, J.; Yee, J.; et al. Intraamniotic Zika Virus Inoculation of Pregnant Rhesus Macaques Produces Fetal Neurologic Disease. Nat. Commun. 2018, 9, 2414. [Google Scholar] [CrossRef] [PubMed]
- Martinot, A.J.; Abbink, P.; Afacan, O.; Prohl, A.K.; Bronson, R.; Hecht, J.L.; Borducchi, E.N.; Larocca, R.A.; Peterson, R.L.; Rinaldi, W.; et al. Fetal Neuropathology in Zika Virus-Infected Pregnant Female Rhesus Monkeys. Cell 2018, 173, 1111–1122.e10. [Google Scholar] [CrossRef]
- Rasmussen, S.A.; Jamieson, D.J.; Honein, M.A.; Petersen, L.R. Zika Virus and Birth Defects—Reviewing the Evidence for Causality. N. Engl. J. Med. 2016, 374, 1981–1987. [Google Scholar] [CrossRef] [PubMed]
- França, G.V.A.; Schuler-Faccini, L.; Oliveira, W.K.; Henriques, C.M.P.; Carmo, E.H.; Pedi, V.D.; Nunes, M.L.; Castro, M.C.; Serruya, S.; Silveira, M.F.; et al. Congenital Zika Virus Syndrome in Brazil: A Case Series of the First 1501 Livebirths with Complete Investigation. Lancet 2016, 388, 891–897. [Google Scholar] [CrossRef]
- Axtell, M.J.; Westholm, J.O.; Lai, E.C. Vive La Différence: Biogenesis and Evolution of MicroRNAs in Plants and Animals. Genome Biol. 2011, 12, 221. [Google Scholar] [CrossRef]
- Idichi, T.; Seki, N.; Kurahara, H.; Fukuhisa, H.; Toda, H.; Shimonosono, M.; Yamada, Y.; Arai, T.; Kita, Y.; Kijima, Y.; et al. Involvement of Anti-Tumor MiR-124-3p and Its Targets in the Pathogenesis of Pancreatic Ductal Adenocarcinoma: Direct Regulation of ITGA3 and ITGB1 by MiR-124-3p. Oncotarget 2018, 9, 28849–28865. [Google Scholar] [CrossRef]
- Lei, H.; Li, H.; Tian, L.; Li, M.; Xin, Z.; Zhang, X.; Guan, R. Icariside II Ameliorates Endothelial Dysfunction by Regulating the MAPK Pathway via MiR-126/SPRED1 in Diabetic Human Cavernous Endothelial Cells. Drug Des. Devel. Ther. 2018, 12, 1743–1751. [Google Scholar] [CrossRef]
- Murugaiyan, G.; da Cunha, A.P.; Ajay, A.K.; Joller, N.; Garo, L.P.; Kumaradevan, S.; Yosef, N.; Vaidya, V.S.; Weiner, H.L. MicroRNA-21 Promotes Th17 Differentiation and Mediates Experimental Autoimmune Encephalomyelitis. J. Clin. Investig. 2015, 125, 1069–1080. [Google Scholar] [CrossRef]
- Diosa-Toro, M.; Echavarría-Consuegra, L.; Flipse, J.; Fernández, G.J.; Kluiver, J.; van den Berg, A.; Urcuqui-Inchima, S.; Smit, J.M. MicroRNA Profiling of Human Primary Macrophages Exposed to Dengue Virus Identifies MiRNA-3614-5p as Antiviral and Regulator of ADAR1 Expression. PLoS Negl. Trop. Dis. 2017, 11, e0005981. [Google Scholar] [CrossRef]
- Heiss, B.L.; Maximova, O.A.; Thach, D.C.; Speicher, J.M.; Pletnev, A.G. MicroRNA Targeting of Neurotropic Flavivirus: Effective Control of Virus Escape and Reversion to Neurovirulent Phenotype. J. Virol. 2012, 86, 5647–5659. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Friedman, R.C.; Farh, K.K.H.; Burge, C.B.; Bartel, D.P. Most Mammalian MRNAs Are Conserved Targets of MicroRNAs. Genome Res. 2009, 19, 92–105. [Google Scholar] [CrossRef]
- Lujambio, A.; Lowe, S.W. The Microcosmos of Cancer. Nature 2012, 482, 347–355. [Google Scholar] [CrossRef] [PubMed]
- Bernstein, E.; Kim, S.Y.; Carmell, M.A.; Murchison, E.P.; Alcorn, H.; Li, M.Z.; Mills, A.A.; Elledge, S.J.; Anderson, K.V.; Hannon, G.J. Dicer Is Essential for Mouse Development. Nat. Genet. 2003, 35, 215–217. [Google Scholar] [CrossRef] [PubMed]
- Delaloy, C.; Liu, L.; Lee, J.-A.; Su, H.; Shen, F.; Yang, G.-Y.; Young, W.L.; Ivey, K.N.; Gao, F.-B. MicroRNA-9 Coordinates Proliferation and Migration of Human Embryonic Stem Cell-Derived Neural Progenitors. Cell Stem Cell 2010, 6, 323–335. [Google Scholar] [CrossRef]
- Sharma, N.; Verma, R.; Kumawat, K.L.; Basu, A.; Singh, S.K. MiR-146a Suppresses Cellular Immune Response during Japanese Encephalitis Virus JaOArS982 Strain Infection in Human Microglial Cells. J. Neuroinflammation 2015, 12, 30. [Google Scholar] [CrossRef]
- Polonio, C.M.; Peron, J.P.S. ZIKV Infection and MiRNA Network in Pathogenesis and Immune Response. Viruses 2021, 13, 1992. [Google Scholar] [CrossRef]
- Chakraborty, S.; Basu, A. MiR-451a Regulates Neuronal Apoptosis by Modulating 14-3-3ζ-JNK Axis upon Flaviviral Infection. mSphere 2022, 7, e0020822. [Google Scholar] [CrossRef]
- Lima, M.C.; de Mendonça, L.R.; Rezende, A.M.; Carrera, R.M.; Aníbal-Silva, C.E.; Demers, M.; D’Aiuto, L.; Wood, J.; Chowdari, K.V.; Griffiths, M.; et al. The Transcriptional and Protein Profile From Human Infected Neuroprogenitor Cells Is Strongly Correlated to Zika Virus Microcephaly Cytokines Phenotype Evidencing a Persistent Inflammation in the CNS. Front. Immunol. 2019, 10, 1928. [Google Scholar] [CrossRef]
- Davis, B.K.; Roberts, R.A.; Huang, M.T.; Willingham, S.B.; Conti, B.J.; Brickey, W.J.; Barker, B.R.; Kwan, M.; Taxman, D.J.; Accavitti-Loper, M.-A.; et al. Cutting Edge: NLRC5-Dependent Activation of the Inflammasome. J. Immunol. 2011, 186, 1333–1337. [Google Scholar] [CrossRef]
- Deng, Y.; Fu, Y.; Sheng, L.; Hu, Y.; Su, L.; Luo, J.; Yan, C.; Chi, W. The Regulatory NOD-Like Receptor NLRC5 Promotes Ganglion Cell Death in Ischemic Retinopathy by Inducing Microglial Pyroptosis. Front. Cell Dev. Biol. 2021, 9, 669696. [Google Scholar] [CrossRef] [PubMed]
- Williams, M.R.; Azcutia, V.; Newton, G.; Alcaide, P.; Luscinskas, F.W. Emerging Mechanisms of Neutrophil Recruitment across Endothelium. Trends Immunol. 2011, 32, 461–469. [Google Scholar] [CrossRef] [PubMed]
- Demma, M.J.; Hohn, M.J.; Sun, A.; Mapelli, C.; Hall, B.; Walji, A.; O’Neil, J. Inhibition of Myc Transcriptional Activity by a Mini-Protein Based upon Mxd1. FEBS Lett. 2020, 594, 1467–1476. [Google Scholar] [CrossRef]
- Islam, M.S.; Khan, M.A.-A.-K.; Murad, M.W.; Karim, M.; Islam, A.B.M.M.K. In Silico Analysis Revealed Zika Virus MiRNAs Associated with Viral Pathogenesis through Alteration of Host Genes Involved in Immune Response and Neurological Functions. J. Med. Virol. 2019, 91, 1584–1594. [Google Scholar] [CrossRef]
- Bhagat, R.; Prajapati, B.; Narwal, S.; Agnihotri, N.; Adlakha, Y.K.; Sen, J.; Mani, S.; Seth, P. Zika Virus E Protein Alters the Properties of Human Fetal Neural Stem Cells by Modulating MicroRNA Circuitry. Cell Death Differ. 2018, 25, 1837–1854. [Google Scholar] [CrossRef] [PubMed]
- Zeng, J.; Dong, S.; Luo, Z.; Xie, X.; Fu, B.; Li, P.; Liu, C.; Yang, X.; Chen, Y.; Wang, X.; et al. The Zika Virus Capsid Disrupts Corticogenesis by Suppressing Dicer Activity and MiRNA Biogenesis. Cell Stem Cell 2020, 27, 618–632.e9. [Google Scholar] [CrossRef]
- Tabari, D.; Scholl, C.; Steffens, M.; Weickhardt, S.; Elgner, F.; Bender, D.; Herrlein, M.-L.; Sabino, C.; Semkova, V.; Peitz, M.; et al. Impact of Zika Virus Infection on Human Neural Stem Cell MicroRNA Signatures. Viruses 2020, 12, 1219. [Google Scholar] [CrossRef]
- Kiriakidou, M.; Tan, G.S.; Lamprinaki, S.; De Planell-Saguer, M.; Nelson, P.T.; Mourelatos, Z. An MRNA M7G Cap Binding-like Motif within Human Ago2 Represses Translation. Cell 2007, 129, 1141–1151. [Google Scholar] [CrossRef]
- Wakiyama, M.; Takimoto, K.; Ohara, O.; Yokoyama, S. Let-7 MicroRNA-Mediated MRNA Deadenylation and Translational Repression in a Mammalian Cell-Free System. Genes Dev. 2007, 21, 1857–1862. [Google Scholar] [CrossRef]
- Liu, J.; Rivas, F.V.; Wohlschlegel, J.; Yates, J.R.; Parker, R.; Hannon, G.J. A Role for the P-Body Component, GW182, in MicroRNA Function. Nat. Cell Biol. 2005, 7, 1261–1266. [Google Scholar] [CrossRef]
- Barroso-delJesus, A.; Romero-López, C.; Lucena-Aguilar, G.; Melen, G.J.; Sanchez, L.; Ligero, G.; Berzal-Herranz, A.; Menendez, P. Embryonic Stem Cell-Specific MiR302-367 Cluster: Human Gene Structure and Functional Characterization of Its Core Promoter. Mol. Cell. Biol. 2008, 28, 6609–6619. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Kuo, C.-H.; Deng, J.H.; Deng, Q.; Ying, S.-Y. A Novel Role of MiR-302/367 in Reprogramming. Biochem. Biophys. Res. Commun. 2012, 417, 11–16. [Google Scholar] [CrossRef] [PubMed]
- Li, H.-L.; Wei, J.-F.; Fan, L.-Y.; Wang, S.-H.; Zhu, L.; Li, T.-P.; Lin, G.; Sun, Y.; Sun, Z.-J.; Ding, J.; et al. MiR-302 Regulates Pluripotency, Teratoma Formation and Differentiation in Stem Cells via an AKT1/OCT4-Dependent Manner. Cell Death Dis. 2016, 7, e2078. [Google Scholar] [CrossRef] [PubMed]
- Ghasemi-Kasman, M.; Shojaei, A.; Gol, M.; Moghadamnia, A.A.; Baharvand, H.; Javan, M. MiR-302/367-Induced Neurons Reduce Behavioral Impairment in an Experimental Model of Alzheimer’s Disease. Mol. Cell. Neurosci. 2018, 86, 50–57. [Google Scholar] [CrossRef] [PubMed]
- Lin, S.-L.; Chang, D.C.; Lin, C.-H.; Ying, S.-Y.; Leu, D.; Wu, D.T.S. Regulation of Somatic Cell Reprogramming through Inducible Mir-302 Expression. Nucleic Acids Res. 2011, 39, 1054–1065. [Google Scholar] [CrossRef]
- Hino, K.; Tsuchiya, K.; Fukao, T.; Kiga, K.; Okamoto, R.; Kanai, T.; Watanabe, M. Inducible Expression of MicroRNA-194 Is Regulated by HNF-1α during Intestinal Epithelial Cell Differentiation. RNA 2008, 14, 1433–1442. [Google Scholar] [CrossRef]
- Wang, X.; You, Z.; Zhao, G.; Wang, T. MicroRNA-194-5p Levels Decrease during Deep Hypothermic Circulatory Arrest. Sci. Rep. 2018, 8, 14044. [Google Scholar] [CrossRef]
- Niu, X.; Zhu, H.-L.; Liu, Q.; Yan, J.-F.; Li, M.-L. MiR-194-5p Serves as a Potential Biomarker and Regulates the Proliferation and Apoptosis of Hippocampus Neuron in Children with Temporal Lobe Epilepsy. J. Chin. Med. Assoc. JCMA 2021, 84, 510–516. [Google Scholar] [CrossRef]
- Du, J.; Zhang, X.; Cao, H.; Jiang, D.; Wang, X.; Zhou, W.; Chen, K.; Zhou, J.; Jiang, H.; Ba, L. MiR-194 Is Involved in Morphogenesis of Spiral Ganglion Neurons in Inner Ear by Rearranging Actin Cytoskeleton via Targeting RhoB. Int. J. Dev. Neurosci. 2017, 63, 16–26. [Google Scholar] [CrossRef]
- Zhang, M.; Zhu, Y.; Wei, M.; Liu, H. Neuroprotective Effects of MiR-30c on Rats with Cerebral Ischemia/Reperfusion Injury by Targeting SOX9. Pathol.-Res. Pract. 2020, 216, 153271. [Google Scholar] [CrossRef]
- Lagos-Quintana, M.; Rauhut, R.; Yalcin, A.; Meyer, J.; Lendeckel, W.; Tuschl, T. Identification of Tissue-Specific MicroRNAs from Mouse. Curr. Biol. CB 2002, 12, 735–739. [Google Scholar] [CrossRef] [Green Version]
- Mao, L.; Liu, S.; Hu, L.; Jia, L.; Wang, H.; Guo, M.; Chen, C.; Liu, Y.; Xu, L. MiR-30 Family: A Promising Regulator in Development and Disease. BioMed Res. Int. 2018, 2018, e9623412. [Google Scholar] [CrossRef] [PubMed]
- Khandelwal, N.; Dey, S.K.; Chakravarty, S.; Kumar, A. MiR-30 Family MiRNAs Mediate the Effect of Chronic Social Defeat Stress on Hippocampal Neurogenesis in Mouse Depression Model. Front. Mol. Neurosci. 2019, 12. [Google Scholar] [CrossRef] [PubMed]
- He, Z.; An, S.; Chen, J.; Zhang, S.; Tan, C.; Yu, J.; Ye, H.; Wu, Y.; Yuan, J.; Wu, J.; et al. Neural Progenitor Cell Pyroptosis Contributes to Zika Virus-Induced Brain Atrophy and Represents a Therapeutic Target. Proc. Natl. Acad. Sci. USA 2020, 117, 23869–23878. [Google Scholar] [CrossRef]
- Yamaoka, Y.; Matsunaga, S.; Jeremiah, S.S.; Nishi, M.; Miyakawa, K.; Morita, T.; Khatun, H.; Shimizu, H.; Okabe, N.; Kimura, H.; et al. Zika Virus Protease Induces Caspase-Independent Pyroptotic Cell Death by Directly Cleaving Gasdermin, D. Biochem. Biophys. Res. Commun. 2021, 534, 666–671. [Google Scholar] [CrossRef] [PubMed]
- Davis, B.K.; Roberts, R.A.; Huang, M.T.; Willingham, S.B.; Conti, B.J.; Brickey, W.J.; Barker, B.R.; Kwan, M.; Taxman, D.J.; Accavitti-Loper, M.-A.; et al. NLRC5 dependent activation of the inflammasome in response to bacteria (114.8). J. Immunol. Baltim. Md 1950 2011, 186, 1333–1337. [Google Scholar]
- Kong, L.; Sun, M.; Jiang, Z.; Li, L.; Lu, B. MicroRNA-194 Inhibits Lipopolysaccharide-Induced Inflammatory Response in Nucleus Pulposus Cells of the Intervertebral Disc by Targeting TNF Receptor-Associated Factor 6 (TRAF6). Med. Sci. Monit. 2018, 24, 3056–3067. [Google Scholar] [CrossRef]
- Dang, J.; Tiwari, S.K.; Lichinchi, G.; Qin, Y.; Patil, V.S.; Eroshkin, A.M.; Rana, T.M. Zika Virus Depletes Neural Progenitors in Human Cerebral Organoids through Activation of the Innate Immune Receptor TLR3. Cell Stem Cell 2016, 19, 258–265. [Google Scholar] [CrossRef]
- Tappe, D.; Pérez-Girón, J.V.; Zammarchi, L.; Rissland, J.; Ferreira, D.F.; Jaenisch, T.; Gómez-Medina, S.; Günther, S.; Bartoloni, A.; Muñoz-Fontela, C.; et al. Cytokine Kinetics of Zika Virus-Infected Patients from Acute to Reconvalescent Phase. Med. Microbiol. Immunol. (Berl.) 2016, 205, 269–273. [Google Scholar] [CrossRef]
- Zanluqui, N.G.; Oliveira, L.G.; Polonio, C.M.; França, T.T.; Souza, G.D.; Muraro, S.P.; Amorim, M.R.; Carregari, V.C.; Brandão-Teles, C.; da Silva, P.; et al. Zika Virus Infection of Murine and Human Neutrophils and Their Function as Trojan Horses to the Placenta. BioRxiv 2021. [Google Scholar] [CrossRef]
- Wang, Y.; Shi, H.; Zhang, Y.; Zeng, Q.; Chen, T.; Chai, C. Identification of Differentially Expressed Hub Genes Associated with Immune Cell Recruitment in Claudin-Low Breast Cancer. Front. Oncol. 2022, 12, 848206. [Google Scholar] [CrossRef]
- Elong Ngono, A.; Vizcarra, E.A.; Tang, W.W.; Sheets, N.; Joo, Y.; Kim, K.; Gorman, M.J.; Diamond, M.S.; Shresta, S. Mapping and Role of the CD8+ T Cell Response During Primary Zika Virus Infection in Mice. Cell Host Microbe 2017, 21, 35–46. [Google Scholar] [CrossRef] [Green Version]
- Cho, S.X.; Vijayan, S.; Yoo, J.-S.; Watanabe, T.; Ouda, R.; An, N.; Kobayashi, K.S. MHC Class I Transactivator NLRC5 in Host Immunity, Cancer and Beyond. Immunology 2021, 162, 252–261. [Google Scholar] [CrossRef] [PubMed]
- Meissner, T.B.; Li, A.; Biswas, A.; Lee, K.H.; Liu, Y.J.; Bayir, E.; Iliopoulos, D.; van den Elsen, P.J.; Kobayashi, K.S. NLR Family Member NLRC5 Is a Transcriptional Regulator of MHC Class I Genes. Proc. Natl. Acad. Sci. USA 2010, 107, 13794–13799. [Google Scholar] [CrossRef]
- Triantafilou, K. Enigmatic Inflammasomes. Immunology 2021, 162, 249–251. [Google Scholar] [CrossRef] [PubMed]
- Zhou, M.; Li, C.; Lu, C.; Zhang, X.; Pan, Y.; Liu, X.; Liu, G.; Zhao, Z.; Sun, B. MiRNA29 Promotes Viral Replication During Early Stage of PRRSV Infection In Vitro. DNA Cell Biol. 2016, 35, 636–642. [Google Scholar] [CrossRef]
- Kanokudom, S.; Vilaivan, T.; Wikan, N.; Thepparit, C.; Smith, D.R.; Assavalapsakul, W. MiR-21 Promotes Dengue Virus Serotype 2 Replication in HepG2 Cells. Antiviral Res. 2017, 142, 169–177. [Google Scholar] [CrossRef]
- Ashraf, U.; Zhu, B.; Ye, J.; Wan, S.; Nie, Y.; Chen, Z.; Cui, M.; Wang, C.; Duan, X.; Zhang, H.; et al. MicroRNA-19b-3p Modulates Japanese Encephalitis Virus-Mediated Inflammation via Targeting RNF11. J. Virol. 2016, 90, 4780–4795. [Google Scholar] [CrossRef]
- Fernandes, J.C.R.; Aoki, J.I.; Maia Acuña, S.; Zampieri, R.A.; Markus, R.P.; Floeter-Winter, L.M.; Muxel, S.M. Melatonin and Leishmania Amazonensis Infection Altered MiR-294, MiR-30e, and MiR-302d Impacting on Tnf, Mcp-1, and Nos2 Expression. Front. Cell. Infect. Microbiol. 2019, 9, 60. [Google Scholar] [CrossRef]
- Zhu, X.; He, Z.; Hu, Y.; Wen, W.; Lin, C.; Yu, J.; Pan, J.; Li, R.; Deng, H.; Liao, S.; et al. MicroRNA-30e* Suppresses Dengue Virus Replication by Promoting NF-ΚB–Dependent IFN Production. PLoS Negl. Trop. Dis. 2014, 8, e3088. [Google Scholar] [CrossRef]
- Giraldo, M.I.; Xia, H.; Aguilera-Aguirre, L.; Hage, A.; van Tol, S.; Shan, C.; Xie, X.; Sturdevant, G.L.; Robertson, S.J.; McNally, K.L.; et al. Envelope Protein Ubiquitination Drives Entry and Pathogenesis of Zika Virus. Nature 2020, 585, 414–419. [Google Scholar] [CrossRef] [PubMed]
- Russo, F.B.; Freitas, B.C.; Pignatari, G.C.; Fernandes, I.R.; Sebat, J.; Muotri, A.R.; Beltrão-Braga, P.C.B. Modeling the Interplay Between Neurons and Astrocytes in Autism Using Human Induced Pluripotent Stem Cells. Biol. Psychiatry 2018, 83, 569–578. [Google Scholar] [CrossRef] [PubMed]
- Bolger, A.M.; Lohse, M.; Usadel, B. Trimmomatic: A Flexible Trimmer for Illumina Sequence Data. Bioinforma. Oxf. Engl. 2014, 30, 2114–2120. [Google Scholar] [CrossRef]
- Simpson, J.T.; Durbin, R. Efficient de Novo Assembly of Large Genomes Using Compressed Data Structures. Genome Res. 2012, 22, 549–556. [Google Scholar] [CrossRef]
- Kim, D.; Paggi, J.M.; Park, C.; Bennett, C.; Salzberg, S.L. Graph-Based Genome Alignment and Genotyping with HISAT2 and HISAT-Genotype. Nat. Biotechnol. 2019, 37, 907–915. [Google Scholar] [CrossRef]
- Baruzzo, G.; Hayer, K.E.; Kim, E.J.; Di Camillo, B.; FitzGerald, G.A.; Grant, G.R. Simulation-Based Comprehensive Benchmarking of RNA-Seq Aligners. Nat. Methods 2017, 14, 135–139. [Google Scholar] [CrossRef]
- Anders, S.; Pyl, P.T.; Huber, W. HTSeq--a Python Framework to Work with High-Throughput Sequencing Data. Bioinforma. Oxf. Engl. 2015, 31, 166–169. [Google Scholar] [CrossRef]
- Love, M.I.; Huber, W.; Anders, S. Moderated Estimation of Fold Change and Dispersion for RNA-Seq Data with DESeq2. Genome Biol. 2014, 15, 550. [Google Scholar] [CrossRef]
- Mi, H.; Muruganujan, A.; Casagrande, J.T.; Thomas, P.D. Large-Scale Gene Function Analysis with the PANTHER Classification System. Nat. Protoc. 2013, 8, 1551–1566. [Google Scholar] [CrossRef]
Gene | Forward Sequence | Reverse Sequence |
---|---|---|
ISG20 | TCTACGACACGTCCACTGACA | CTGTTCTGGATGCTCTTGTGC |
MXD1 | CGTGGAGAGCACGGACTATC | CCAAGACACGCCTTGTGACT |
HPRT | CCCTGGCGTCGTGATTAGTG | ACACCCTTTCCAAATCCTCAGC |
ZIKV | TTGGTCATGATACTGCTGATTGC | CCTTCCACAAAGTCCCTATTGC |
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations. |
© 2022 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Polonio, C.M.; da Silva, P.; Russo, F.B.; Hyppolito, B.R.N.; Zanluqui, N.G.; Benazzato, C.; Beltrão-Braga, P.C.B.; Muxel, S.M.; Peron, J.P.S. microRNAs Control Antiviral Immune Response, Cell Death and Chemotaxis Pathways in Human Neuronal Precursor Cells (NPCs) during Zika Virus Infection. Int. J. Mol. Sci. 2022, 23, 10282. https://doi.org/10.3390/ijms231810282
Polonio CM, da Silva P, Russo FB, Hyppolito BRN, Zanluqui NG, Benazzato C, Beltrão-Braga PCB, Muxel SM, Peron JPS. microRNAs Control Antiviral Immune Response, Cell Death and Chemotaxis Pathways in Human Neuronal Precursor Cells (NPCs) during Zika Virus Infection. International Journal of Molecular Sciences. 2022; 23(18):10282. https://doi.org/10.3390/ijms231810282
Chicago/Turabian StylePolonio, Carolina M., Patrick da Silva, Fabiele B. Russo, Brendo R. N. Hyppolito, Nagela G. Zanluqui, Cecília Benazzato, Patrícia C. B. Beltrão-Braga, Sandra M. Muxel, and Jean Pierre S. Peron. 2022. "microRNAs Control Antiviral Immune Response, Cell Death and Chemotaxis Pathways in Human Neuronal Precursor Cells (NPCs) during Zika Virus Infection" International Journal of Molecular Sciences 23, no. 18: 10282. https://doi.org/10.3390/ijms231810282