Flavonoid Baicalein Suppresses Oral Biofilms and Protects Enamel Hardness to Combat Dental Caries
Abstract
1. Introduction
2. Results
3. Discussion
4. Materials and Methods
4.1. Chemicals, Bacterial and Fungal Strains and Growth Conditions
4.2. Biofilm Formation
4.3. Cytotoxicity Assays
4.4. Scanning Electron Microscopy (SEM)
4.5. Crystal Violet (CV) Staining
4.6. Polysaccharide Synthesis
4.7. Lactic Acid Secretion
4.8. Biofilm Viability Using the MTT Assay
4.9. Biofilm CFU Counts
4.10. Confocal Laser Scanning Microscopy (CLSM)
4.11. Quantitative Real-Time-Polymerase-Chain Reaction (qRT-PCR)
4.12. Enamel Hardness Measurement
4.13. Statistical Analysis
5. Conclusions
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Conflicts of Interest
References
- Pitts, N.B.; Zero, D.T.; Marsh, P.D.; Ekstrand, K.; Weintraub, J.A.; Ramos-Gomez, F.; Tagami, J.; Twetman, S.; Tsakos, G.; Ismail, A. Dental caries. Nat. Rev. Dis. Primers 2017, 3, 17030. [Google Scholar] [CrossRef]
- Ajdić, D.; McShan, W.M.; McLaughlin, R.E.; Savić, G.; Chang, J.; Carson, M.B.; Primeaux, C.; Tien, R.; Kenton, F.; Jia, H.; et al. Genome sequence of Streptococcus mutans UA159, a cariogenic dental pathogen. Proc. Natl. Acad. Sci. USA 2002, 99, 14434–14439. [Google Scholar] [CrossRef] [PubMed]
- Du, Q.; Ren, B.; He, J.; Peng, X.; Guo, Q.; Zheng, L.; Li, J.; Dai, H.; Chen, V.; Zhang, L.; et al. Candida albicans promotes tooth decay by inducing oral microbial dysbiosis. ISME J. 2020, 15, 894–908. [Google Scholar] [CrossRef] [PubMed]
- Daniluk, T.; Tokajuk, G.; Stokowska, W.; Fiedoruk, K.; Sciepuk, M.; Zaremba, M.L.; Rozkiewicz, D.; Cylwik-Rokicka, D.; A Kedra, B.; Anielska, I.; et al. Occurrence rate of oral Candida albicans in denture wearer patients. Adv. Med. Sci. 2006, 51, 77–80. [Google Scholar]
- Takahashi, N.; Nyvad, B. Ecological Hypothesis of Dentin and Root Caries. Caries Res. 2016, 50, 422–431. [Google Scholar] [CrossRef]
- Fakhruddin, K.S.; Samaranayake, L.P.; Egusa, H.; Ngo, H.C.; Panduwawala, C.; Venkatachalam, T.; Kumarappan, A.; Pesee, S. Candida biome of severe early childhood caries (S-ECC) and its cariogenic virulence traits. J. Oral Microbiol. 2020, 12, 1724484. [Google Scholar] [CrossRef]
- Shen, S.; Samaranayake, L.P.; Yip, H.K.; Dyson, J.E. Bacterial and yeast flora of root surface caries in elderly, ethnic Chinese. Oral Dis. 2002, 8, 207–217. [Google Scholar] [CrossRef]
- He, J.; Kim, D.; Zhou, X.; Ahn, S.-J.; Burne, R.A.; Richards, V.; Koo, H. RNA-Seq Reveals Enhanced Sugar Metabolism in Streptococcus mutans Co-cultured with Candida albicans within Mixed-Species Biofilms. Front. Microbiol. 2017, 8, 1036. [Google Scholar] [CrossRef] [PubMed]
- Pereira, D.; Seneviratne, C.; Ito, C.K.; Samaranayake, L. Is the oral fungal pathogen Candida albicans a cariogen? Oral Dis. 2018, 24, 518–526. [Google Scholar] [CrossRef] [PubMed]
- Zaremba, M.L.; Stokowska, W.; Klimiuk, A.; Daniluk, T.; Rozkiewicz, D.; Cylwik-Rokicka, D.; Waszkiel, D.; Tokajuk, G.; Kierklo, A.; Abdelrazek, S. Microorganisms in root carious lesions in adults. Adv. Med. Sci. 2006, 51, 237–240. [Google Scholar]
- Chen, H.; Tang, Y.; Weir, M.D.; Gao, J.; Imazato, S.; Oates, T.W.; Lei, L.; Wang, S.; Hu, T.; Xu, H.H. Effects of S. mutans gene-modification and antibacterial monomer dimethylaminohexadecyl methacrylate on biofilm growth and acid production. Dent. Mater. 2020, 36, 296–309. [Google Scholar] [CrossRef] [PubMed]
- Varoni, E.M.; Tarce, M.; Lodi, G.; Carrassi, A. Chlorhexidine (CHX) in dentistry: State of the art. Minerva Stomatol. 2012, 61, 399–419. [Google Scholar] [PubMed]
- Seneviratne, C.J.; Leung, K.C.-F.; Wong, C.-H.; Lee, S.-F.; Li, X.; Leung, P.C.; Lau, C.; Wat, E.; Jin, L. Nanoparticle-Encapsulated Chlorhexidine against Oral Bacterial Biofilms. PLoS ONE 2014, 9, e103234. [Google Scholar] [CrossRef] [PubMed]
- Kumar, S.B. Chlorhexidine mouthwash-A review. J. Pharm. Pharm. Sci. 2017, 9, 1450. [Google Scholar]
- Chen, H.; Zhang, B.; Weir, M.D.; Homayounfar, N.; Fay, G.G.; Martinho, F.; Lei, L.; Bai, Y.; Hu, T.; Xu, H.H. S. mutans gene-modification and antibacterial resin composite as dual strategy to suppress biofilm acid production and inhibit caries. J. Dent. 2020, 93, 103278. [Google Scholar] [CrossRef]
- Sreenivasan, P.; Gaffar, A. Antiplaque biocides and bacterial resistance: A review. J. Clin. Periodontol. 2002, 29, 965–974. [Google Scholar] [CrossRef]
- Mohammadi, Z.; Abbott, P.V. Antimicrobial substantivity of root canal irrigants and medicaments: A review. Aust. Endod. J. 2009, 35, 131–139. [Google Scholar] [CrossRef]
- Gutiérrez-Venegas, G.; González-Rosas, Z. Apigenin reduce lipoteichoic acid-induced inflammatory response in rat cardiomyoblast cells. Arch. Pharmacal. Res. 2017, 40, 240–249. [Google Scholar] [CrossRef]
- Serpa, R.; França, E.J.G.; Maia, L.; Andrade, C.G.T.J.; Diniz, A.; Furlaneto, M.C. In vitro antifungal activity of the flavonoid baicalein against Candida species. J. Med. Microbiol. 2012, 61, 1704–1708. [Google Scholar] [CrossRef]
- Gutiérrez-Venegas, G.; Gómez-Mora, J.A.; Meraz-Rodríguez, M.A.; Flores-Sánchez, M.A.; Ortiz-Miranda, L.F. Effect of flavonoids on antimicrobial activity of microorganisms present in dental plaque. Heliyon 2019, 5, e03013. [Google Scholar] [CrossRef]
- Lobo, C.I.V.; Lopes, A.C.U.D.A.; Klein, M.I. Compounds with distinct targets present diverse antimicrobial and antibiofilm efficacy against Candida albicans and Streptococcus mutans, and combinations of compounds potentiate their effect. J. Fungi 2021, 7, 340. [Google Scholar] [CrossRef] [PubMed]
- Choi, H.-A.; Cheong, D.-E.; Lim, H.-D.; Kim, W.-H.; Ham, M.-H.; Oh, M.-H.; Wu, Y.; Shin, H.-J.; Kim, G.-J. Antimicrobial and Anti-Biofilm Activities of the Methanol Extracts of Medicinal Plants against Dental Pathogens Streptococcus mutans and Candida albicans. J. Microbiol. Biotechnol. 2017, 27, 1242–1248. [Google Scholar] [CrossRef] [PubMed]
- Zhou, Y.; Wang, S.; Zhou, X.; Zou, Y.; Li, M.; Peng, X.; Ren, B.; Xu, H.H.K.; Weir, M.D.; Cheng, L.; et al. Short-Time Antibacterial Effects of Dimethylaminododecyl Methacrylate on Oral Multispecies Biofilm In Vitro. BioMed Res. Int. 2019, 2019, 6393470. [Google Scholar] [CrossRef] [PubMed]
- Weng, L.; Wu, L.; Guo, R.; Ye, J.; Liang, W.; Wu, W.; Chen, L.; Yang, D. Lactobacillus cell envelope-coated nanoparticles for antibiotic delivery against cariogenic biofilm and dental caries. J. Nanobiotechnol. 2022, 20, 356. [Google Scholar] [CrossRef]
- Müller, H.-D.; Eick, S.; Moritz, A.; Lussi, A.; Gruber, R. Cytotoxicity and Antimicrobial Activity of Oral Rinses In Vitro. BioMed Res. Int. 2017, 2017, 4019723–4019729. [Google Scholar] [CrossRef]
- Wyganowska-Swiatkowska, M.; Kotwicka, M.; Urbaniak, P.; Nowak, A.; Skrzypczak-Jankun, E.; Jankun, J. Clinical implications of the growth-suppressive effects of chlorhexidine at low and high concentrations on human gingival fibroblasts and changes in morphology. Int. J. Mol. Med. 2016, 37, 1594–1600. [Google Scholar] [CrossRef]
- Nakamura, M.; Kawahara, H.; Kataoka, Y.; Maehara, S.; Izutani, M.; Taguchi, H. Biocompatibility of dental amalgams in vitro during 52 week period. Shika Rikogaku Zasshi J. Jpn. Soc. Dent. Appar. Mater. 1980, 21, 228–244. [Google Scholar]
- Koo, H.; Falsetta, M.; Klein, M. The exopolysaccharide matrix: A virulence determinant of cariogenic biofilm. J. Dent. Res. 2013, 92, 1065–1073. [Google Scholar] [CrossRef]
- Koo, H.; Xiao, J.; I Klein, M. Extracellular Polysaccharides Matrix—An Often Forgotten Virulence Factor in Oral Biofilm Research. Int. J. Oral Sci. 2009, 1, 229. [Google Scholar] [CrossRef]
- Law, V.; Seow, W.; Townsend, G. Factors influencing oral colonization of mutans streptococci in young children. Aust. Dent. J. 2007, 52, 93–100. [Google Scholar] [CrossRef]
- Rosenberg, M. Microbial adhesion to hydrocarbons: Twenty-five years of doing MATH. FEMS Microbiol. Lett. 2006, 262, 129–134. [Google Scholar] [CrossRef] [PubMed]
- Strużycka, I. The Oral Microbiome in Dental Caries. Pol. J. Microbiol. 2014, 63, 127–135. [Google Scholar] [CrossRef] [PubMed]
- Yue, J.; Yang, H.; Liu, S.; Song, F.; Guo, J.; Huang, C. Influence of naringenin on the biofilm formation of Streptococcus mutans. J. Dent. 2018, 76, 24–31. [Google Scholar] [CrossRef] [PubMed]
- Krzyściak, W.; Jurczak, A.; Kościelniak, D.; Bystrowska, B.; Skalniak, A. The virulence of Streptococcus mutans and the ability to form biofilms. Eur. J. Clin. Microbiol. 2014, 33, 499–515. [Google Scholar] [CrossRef] [PubMed]
- Worthington, R.J.; Richards, J.J.; Melander, C. Small molecule control of bacterial biofilms. Org. Biomol. Chem. 2012, 10, 7457–7474. [Google Scholar] [CrossRef] [PubMed]
- Ding, Y.; Wang, W.; Fan, M.; Tong, Z.; Kuang, R.; Jiang, W.; Ni, L. Antimicrobial and anti-biofilm effect of Bac8c on major bacteria associated with dental caries and Streptococcus mutans biofilms. Peptides 2014, 52, 61–67. [Google Scholar] [CrossRef]
- Suntharalingam, P.; Cvitkovitch, D.G. Quorum sensing in streptococcal biofilm formation. Trends Microbiol. 2005, 13, 3–6. [Google Scholar] [CrossRef]
- Liu, S.; Qiu, W.; Zhang, K.; Zhou, X.; Ren, B.; He, J.; Xu, X.; Cheng, L.; Li, M. Nicotine enhances interspecies relationship between Streptococcus mutans and Candida albicans. BioMed Res. Int. 2017, 2017, 7953920. [Google Scholar] [CrossRef]
- Nagai, J.; Shi, H.; Kubota, Y.; Bundow, K.; Okudaira, N.; Uesawa, Y.; Sakagami, H.; Tomomura, M.; Tomomura, A.; Takao, K.; et al. Quantitative structure–cytotoxicity relationship of pyrano[4,3-b]chromones. Anticancer Res. 2018, 38, 4449–4457. [Google Scholar] [CrossRef]
- Chen, H.; Yang, H.; Weir, M.D.; Schneider, A.; Ren, K.; Homayounfar, N.; Oates, T.W.; Zhang, K.; Liu, J.; Hu, T.; et al. An antibacterial and injectable calcium phosphate scaffold delivering human periodontal ligament stem cells for bone tissue engineering. RSC Adv. 2020, 10, 40157–40170. [Google Scholar] [CrossRef]
- Mao, M.-Y.; Yang, Y.-M.; Li, K.-Z.; Lei, L.; Li, M.; Yang, Y.; Tao, X.; Yin, J.-X.; Zhang, R.; Ma, X.-R.; et al. The rnc gene promotes exopolysaccharide synthesis and represses the vicRKX gene expressions via microRNA-size small RNAs in Streptococcus mutans. Front. Microbiol. 2016, 7, 687. [Google Scholar]
- Chen, H.; Tang, Y.; Weir, M.D.; Lei, L.; Masri, R.; Lynch, C.D.; Oates, T.W.; Zhang, K.; Hu, T.; Xu, H.H.K. Effects of S. mutans gene-modification and antibacterial calcium phosphate nanocomposite on secondary caries and marginal enamel hardness. RSC Adv. 2019, 9, 41672–41683. [Google Scholar] [CrossRef] [PubMed]
- Wang, Y.; Wang, X.; Jiang, W.; Wang, K.; Luo, J.; Li, W.; Zhou, X.; Zhang, L. Antimicrobial peptide GH12 suppresses cariogenic virulence factors of Streptococcus mutans. J. Oral Microbiol. 2018, 10, 1442089. [Google Scholar] [CrossRef] [PubMed]
- Escobar, I.E.; Rossatto, F.C.P.; Kim, S.M.; Kang, H.M.; Kim, W.; Mylonakis, E. Repurposing Kinase Inhibitor Bay 11–7085 to Combat Staphylococcus aureus and Candida albicans Biofilms. Front. Pharmacol. 2021, 12, 675300. [Google Scholar] [CrossRef] [PubMed]
- Li, Z.; Xiang, Z.; Zeng, J.; Li, Y.; Li, J. A GntR family transcription factor in Streptococcus mutans regulates biofilm formation and expression of multiple sugar transporter genes. Front. Microbiol. 2019, 9, 3224. [Google Scholar] [CrossRef]
- Korithoski, B.; Levesque, C.M.; Cvitkovitch, D.G. The involvement of the pyruvate dehydrogenase E1α subunit, in Streptococcus mutans acid tolerance. FEMS Microbiol. Lett. 2008, 289, 13–19. [Google Scholar] [CrossRef][Green Version]
- Li, B.; Li, X.; Lin, H.; Zhou, Y. Curcumin as a Promising Antibacterial Agent: Effects on Metabolism and Biofilm Formation in S. mutans. BioMed Res. Int. 2018, 2018, 4508709. [Google Scholar] [CrossRef] [PubMed]
- Mao, M.; Zhang, W.; Huang, Z.; Huang, J.; Wang, J.; Li, W.; Gu, S. Graphene Oxide-Copper Nanocomposites Suppress Cariogenic Streptococcus mutans Biofilm Formation. Int. J. Nanomed. 2021, 16, 7727–7739. [Google Scholar] [CrossRef]
Primer | Nucleotide Sequence | Reference |
---|---|---|
gyrA-F | 5′ ATTGTTGCTCGGGCTCTTCCAG 3′ | [46] |
gyrA-R | 5′ ATGCGGCTTGTCAGGAGTAACC 3′ | |
gtfB-F | 5′ ACACTTTCGGGTGGCTTG 3′ | [47] |
gtfB-R | 5′ GCTTAGATGTCACTTCGGTTG 3′ | |
gtfC-F | 5′ CCAAAATGGTATTATGGCTGTCG 3′ | [47] |
gtfC-R | 5′ TGAGTCTCTATCAAAGTAACGCAG 3′ | |
gtfD-F | 5′ AATGAAATTCGCAGCGGACTTGAG 3′ | [48] |
gtfD-R | 5′ TTAGCCTGACGCATGTCTTCATTGTA 3′ | |
comC-F | 5′ GACTTTAAAGAAATTAAGACTG 3′ | [47] |
comC-R | 5′ AAGCTTGTGTAAAACTTCTGT 3′ | |
comD-F | 5′ CTCTGATTGACCATTCTTCTGG 3′ | [47] |
comD-R | 5′ CATTCTGAGTTTATGCCCCTC 3′ | |
comE-F | 5′ CCTGAAAAGGGCAATCACCAG 3′ | [47] |
comE-R | 5′ GGGGCATAAACTCAGAATGTGTCG 3′ |
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations. |
© 2022 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Chen, H.; Xie, S.; Gao, J.; He, L.; Luo, W.; Tang, Y.; Weir, M.D.; Oates, T.W.; Xu, H.H.K.; Yang, D. Flavonoid Baicalein Suppresses Oral Biofilms and Protects Enamel Hardness to Combat Dental Caries. Int. J. Mol. Sci. 2022, 23, 10593. https://doi.org/10.3390/ijms231810593
Chen H, Xie S, Gao J, He L, Luo W, Tang Y, Weir MD, Oates TW, Xu HHK, Yang D. Flavonoid Baicalein Suppresses Oral Biofilms and Protects Enamel Hardness to Combat Dental Caries. International Journal of Molecular Sciences. 2022; 23(18):10593. https://doi.org/10.3390/ijms231810593
Chicago/Turabian StyleChen, Hong, Sihong Xie, Jing Gao, Liwen He, Wenping Luo, Yunhao Tang, Michael D. Weir, Thomas W. Oates, Hockin H. K. Xu, and Deqin Yang. 2022. "Flavonoid Baicalein Suppresses Oral Biofilms and Protects Enamel Hardness to Combat Dental Caries" International Journal of Molecular Sciences 23, no. 18: 10593. https://doi.org/10.3390/ijms231810593
APA StyleChen, H., Xie, S., Gao, J., He, L., Luo, W., Tang, Y., Weir, M. D., Oates, T. W., Xu, H. H. K., & Yang, D. (2022). Flavonoid Baicalein Suppresses Oral Biofilms and Protects Enamel Hardness to Combat Dental Caries. International Journal of Molecular Sciences, 23(18), 10593. https://doi.org/10.3390/ijms231810593