Proviral ALV-LTR Sequence Is Essential for Continued Proliferation of the ALV-Transformed B Cell Line
Abstract
:1. Introduction
2. Results
2.1. ALV-LTR Editing Downregulates Expression of Insertionally Activated Genes
2.2. Knockdown of c-myc Did Not Affect Expression of Other LTR-Regulated Genes
2.3. LTR Editing Inhibits Proliferation of HP45 Cells
2.4. Downregulated c-myc Contributes to Proliferation Defect of LTR-Edited HP45
2.5. Knockdown of LTR and c-myc Induces Apoptosis in HP45 Cells
3. Discussion
4. Materials and Methods
4.1. Cell Culture and Generation of HP45-Cas9 Cell Line
4.2. Guide-RNA Design
4.3. Genomic DNA Isolation
4.4. Electroporation of gRNAs into HP45-Cas9 Cell Line for Targeted Editing
4.5. RNA Extraction, cDNA Synthesis, and RT-qPCR
4.6. Proliferation Assay with IncuCyte NucLight Rapid Red Reagent
4.7. B-Cell Isolation from Bursa of Fabricius (BF)
4.8. Apoptosis Assay
Supplementary Materials
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Conflicts of Interest
References
- Nair, V. Leukosis/sarcoma group. In Diseases of Poultry; Swayne, D.E., Boulianne, M., Logue, C.M., McDougald, L.R., Nair, V., Suarez, D.L., Eds.; Wiley: Hoboken, NJ, USA, 2020; Volume 1, pp. 587–625. [Google Scholar]
- Hayward, W.S.; Neel, B.G.; Astrin, S.M. Activation of a cellular onc gene by promoter insertion in alv-induced lymphoid leukosis. Nature 1981, 290, 475–480. [Google Scholar] [CrossRef] [PubMed]
- Clurman, B.E.; Hayward, W.S. Multiple proto-oncogene activations in avian leukosis virus-induced lymphomas: Evidence for stage-specific events. Mol. Cell. Biol. 1989, 9, 2657–2664. [Google Scholar]
- Tam, W.; Hughes, S.H.; Hayward, W.S.; Besmer, P. Avian bic, a gene isolated from a common retroviral site in avian leukosis virus-induced lymphomas that encodes a noncoding rna, cooperates with c-myc in lymphomagenesis and erythroleukemogenesis. J. Virol. 2002, 76, 4275–4286. [Google Scholar] [CrossRef]
- Tam, W.; Dahlberg, J.E. Mir-155/bic as an oncogenic microrna. Genes Chromosomes Cancer 2006, 45, 211–212. [Google Scholar] [CrossRef] [PubMed]
- Gulei, D.; Raduly, L.; Broseghini, E.; Ferracin, M.; Berindan-Neagoe, I. The extensive role of mir-155 in malignant and non-malignant diseases. Mol. Asp. Med. 2019, 70, 33–56. [Google Scholar] [CrossRef] [PubMed]
- Witten, L.; Slack, F.J. Mir-155 as a novel clinical target for hematological malignancies. Carcinogenesis 2020, 41, 2–7. [Google Scholar] [CrossRef] [PubMed]
- Bushman, F.D. Retroviral insertional mutagenesis in humans: Evidence for four genetic mechanisms promoting expansion of cell clones. Mol. Ther. 2020, 28, 352–356. [Google Scholar] [CrossRef] [PubMed]
- Kung, H.J.; Liu, J.L. Retroviral oncogenesis. In Viral Pathogenesis; Nathanson, N., Ed.; Lippincott-Raven Publishers: Philadelphia, PA, USA, 1997; pp. 235–266. [Google Scholar]
- Beaulieu, M.E.; Castillo, F.; Soucek, L. Structural and biophysical insights into the function of the intrinsically disordered myc oncoprotein. Cells 2020, 9, 1038. [Google Scholar] [CrossRef]
- Amjadi-Moheb, F.; Paniri, A.; Akhavan-Niaki, H. Insights into the links between myc and 3d chromatin structure and epigenetic regulation: Implications for cancer therapy. Cancer Res. 2021, 81, 1925–1936. [Google Scholar] [CrossRef] [PubMed]
- Cole, M.D. The myc oncogene: Its role in transformation and differentiation. Annu. Rev. Genet. 1986, 20, 361–384. [Google Scholar] [CrossRef] [PubMed]
- Justice, J.F., IV; Morgan, R.W.; Beemon, K.L. Common viral integration sites identified in avian leukosis virus-induced b-cell lymphomas. mBio 2015, 6, e01863-15. [Google Scholar] [CrossRef] [Green Version]
- Justice, J., IV; Malhotra, S.; Ruano, M.; Li, Y.; Zavala, G.; Lee, N.; Morgan, R.; Beemon, K. The met gene is a common integration target in avian leukosis virus subgroup j-induced chicken hemangiomas. J. Virol. 2015, 89, 4712–4719. [Google Scholar] [CrossRef] [PubMed]
- Kanter, M.R.; Smith, R.E.; Hayward, W.S. Rapid induction of b-cell lymphomas: Insertional activation of c-myb by avian leukosis virus. J. Virol. 1988, 62, 1423–1432. [Google Scholar] [CrossRef]
- Winans, S.; Flynn, A.; Malhotra, S.; Balagopal, V.; Beemon, K.L. Integration of alv into ctdspl and ctdspl2 genes in b-cell lymphomas promotes cell immortalization, migration and survival. Oncotarget 2017, 8, 57302–57315. [Google Scholar] [CrossRef]
- Yang, F.; Xian, R.R.; Li, Y.; Polony, T.S.; Beemon, K.L. Telomerase reverse transcriptase expression elevated by avian leukosis virus integration in b cell lymphomas. Proc. Natl. Acad. Sci. USA 2007, 104, 18952–18957. [Google Scholar] [CrossRef] [PubMed]
- Wells, D.W.; Guo, S.; Shao, W.; Bale, M.J.; Coffin, J.M.; Hughes, S.H.; Wu, X. An analytical pipeline for identifying and mapping the integration sites of hiv and other retroviruses. BMC Genom. 2020, 21, 216. [Google Scholar]
- Uemura, S.; Nagaoka, T.; Yokoyama, M.; Igarashi, M.; Kishi, M. A simple and highly efficient method to identify the integration site of a transgene in the animal genome. Neurosci. Res. 2014, 80, 91–94. [Google Scholar] [CrossRef] [PubMed]
- Uren, A.G.; Mikkers, H.; Kool, J.; van der Weyden, L.; Lund, A.H.; Wilson, C.H.; Rance, R.; Jonkers, J.; van Lohuizen, M.; Berns, A.; et al. A high-throughput splinkerette-pcr method for the isolation and sequencing of retroviral insertion sites. Nat. Protoc. 2009, 4, 789–798. [Google Scholar] [CrossRef] [PubMed]
- Van Haasteren, J.; Munis, A.M.; Gill, D.R.; Hyde, S.C. Genome-wide integration site detection using cas9 enriched amplification-free long-range sequencing. Nucleic Acids Res. 2021, 49, e16. [Google Scholar] [CrossRef] [PubMed]
- Livak, K.J.; Schmittgen, T.D. Analysis of relative gene expression data using real-time quantitative pcr and the 2−ΔΔCT method. Methods 2001, 25, 402–408. [Google Scholar] [CrossRef]
- Staines, K.; Batra, A.; Mwangi, W.; Maier, H.J.; Van Borm, S.; Young, J.R.; Fife, M.; Butter, C. A versatile panel of reference gene assays for the measurement of chicken mrna by quantitative pcr. PLoS ONE 2016, 11, e0160173. [Google Scholar] [CrossRef] [PubMed]
- Malhotra, S.; Winans, S.; Lam, G.; Justice, J.; Morgan, R.; Beemon, K. Selection for avian leukosis virus integration sites determines the clonal progression of b-cell lymphomas. PLoS Pathog. 2017, 13, e1006708. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Eis, P.S.; Tam, W.; Sun, L.; Chadburn, A.; Li, Z.; Gomez, M.F.; Lund, E.; Dahlberg, J.E. Accumulation of mir-155 and bic rna in human b cell lymphomas. Proc. Natl. Acad. Sci. USA 2005, 102, 3627–3632. [Google Scholar] [CrossRef] [PubMed]
- Kluiver, J.; Poppema, S.; de Jong, D.; Blokzijl, T.; Harms, G.; Jacobs, S.; Kroesen, B.J.; van den Berg, A. Bic and mir-155 are highly expressed in hodgkin, primary mediastinal and diffuse large b cell lymphomas. J. Pathol. 2005, 207, 243–249. [Google Scholar] [CrossRef] [PubMed]
- Van den Berg, A.; Kroesen, B.J.; Kooistra, K.; de Jong, D.; Briggs, J.; Blokzijl, T.; Jacobs, S.; Kluiver, J.; Diepstra, A.; Maggio, E.; et al. High expression of b-cell receptor inducible gene bic in all subtypes of hodgkin lymphoma. Genes Chromosomes Cancer 2003, 37, 20–28. [Google Scholar] [CrossRef] [PubMed]
- Bondada, M.S.; Yao, Y.; Nair, V. Multifunctional mir-155 pathway in avian oncogenic virus-induced neoplastic diseases. Non-Coding RNA 2019, 5, 24. [Google Scholar] [CrossRef] [PubMed]
- Schubach, W.; Groudine, M. Alteration of c-myc chromatin structure by avian leukosis virus integration. Nature 1984, 307, 702–708. [Google Scholar] [CrossRef] [PubMed]
- Bouchard, C.; Staller, P.; Eilers, M. Control of cell proliferation by myc. Trends Cell Biol. 1998, 8, 202–206. [Google Scholar] [CrossRef]
- Hartl, M.; Bister, K. Myc analysis in cancer and evolution. Methods Mol. Biol. 2021, 2318, 87–117. [Google Scholar] [PubMed]
- Lu, D.; Wilson, C.; Littlewood, T.D. Methods for determining myc-induced apoptosis. Methods Mol. Biol. 2021, 2318, 209–229. [Google Scholar] [PubMed]
- Zhang, J.; Song, N.; Zang, D.; Yu, J.; Li, J.; Di, W.; Guo, R.; Zhao, W.; Wang, H. C-myc promotes tumor proliferation and anti-apoptosis by repressing p21 in rhabdomyosarcomas. Mol. Med. Rep. 2017, 16, 4089–4094. [Google Scholar] [CrossRef] [PubMed]
- Price, A.M.; Messinger, J.E.; Luftig, M.A. C-myc represses transcription of epstein-barr virus latent membrane protein 1 early after primary b cell infection. J. Virol. 2018, 92, e01178-17. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Guo, R.; Jiang, C.; Zhang, Y.; Govande, A.; Trudeau, S.J.; Chen, F.; Fry, C.J.; Puri, R.; Wolinsky, E.; Schineller, M.; et al. Myc controls the epstein-barr virus lytic switch. Mol. Cell 2020, 78, 653–669.e658. [Google Scholar] [CrossRef] [PubMed]
- Nazerian, K.; Witter, R.L. Properties of a chicken lymphoblastoid cell line from marek’s disease tumor. J. Natl. Cancer Inst. 1975, 54, 453–458. [Google Scholar]
- Reddy, E.P.; Reynolds, R.K.; Watson, D.K.; Schultz, R.A.; Lautenberger, J.; Papas, T.S. Nucleotide sequence analysis of the proviral genome of avian myelocytomatosis virus (mc29). Proc. Natl. Acad. Sci. USA 1983, 80, 2500–2504. [Google Scholar] [CrossRef]
- Watson, D.K.; Reddy, E.P.; Duesberg, P.H.; Papas, T.S. Nucleotide sequence analysis of the chicken c-myc gene reveals homologous and unique coding regions by comparison with the transforming gene of avian myelocytomatosis virus mc29, delta gag-myc. Proc. Natl. Acad. Sci. USA 1983, 80, 2146–2150. [Google Scholar] [CrossRef] [Green Version]
Primer | Sequence (5′–3′) |
---|---|
c-myc-F | CTCCCCAGCAAGAACTACGAT |
c-myc-R | GCAGATGAAGCTCTGGTTGAC |
ALV-LTR-F | GGGGTAGGTGGCTATGATCG |
ALV-LTR-R | CCCGAATAAGCGAGACGGAT |
TP63-F | GATTGCACCTCCTAGCCACCTGATC |
TP63-R | TGATGAGAATTGGGCGACGGTTCAT |
BATF-F | TTGGAGAGCGAAGACCTGGAGAGAC |
BATF-R | CAAGTTGGTTCTTAGCCGCCCCAG |
c-Rel-F | CTGAACGTCGAGTCCTGTCTTTTCA |
c-Rel-R | TCCACAGTTCTTATTCACACGGCAA |
EP400-F | AGGAGTTAGTTGCTGTTGTGGATCA |
EP400-R | TGTATGCATCCTCCCGAGTGTAGGT |
B2M-F | AAGGAGCCGCAGGTCTAC |
B2M-R | CTTGCTCTTTGCCGTCATAC |
NEK2-F | TTATGTGCTCTCACGCCTCC |
NEK2-R | TCCTGATCTCCGGCCTCTTT |
Guide-RNA | Sequence (5′–3′) | Specificity | |
---|---|---|---|
ALV-LTR-gRNAs | gRNA-1 (F) | CAGACGGGTCTAACACGGAT | 99% |
gRNA-2 (R) | GGCGTTTATTGTATCGAGCT | 99% | |
gRNA-3 (F) | GTTGATTCCCTGACGACTAC | 97% | |
c-myc-gRNAs | gRNA-1 (F) | CTACGATTACGACTACGACT | 99% |
gRNA-2 (R) | CTTCCAGATGTCCTCGGACG | 96% |
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations. |
© 2022 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Roy, S.; Bondada, M.S.; Zhang, Y.; Moffat, K.; Nair, V.; Yao, Y. Proviral ALV-LTR Sequence Is Essential for Continued Proliferation of the ALV-Transformed B Cell Line. Int. J. Mol. Sci. 2022, 23, 11263. https://doi.org/10.3390/ijms231911263
Roy S, Bondada MS, Zhang Y, Moffat K, Nair V, Yao Y. Proviral ALV-LTR Sequence Is Essential for Continued Proliferation of the ALV-Transformed B Cell Line. International Journal of Molecular Sciences. 2022; 23(19):11263. https://doi.org/10.3390/ijms231911263
Chicago/Turabian StyleRoy, Swagata, Megha Sravani Bondada, Yaoyao Zhang, Katy Moffat, Venugopal Nair, and Yongxiu Yao. 2022. "Proviral ALV-LTR Sequence Is Essential for Continued Proliferation of the ALV-Transformed B Cell Line" International Journal of Molecular Sciences 23, no. 19: 11263. https://doi.org/10.3390/ijms231911263