β-Klotho Promotes the Development of Intrauterine Adhesions via the PI3K/AKT Signaling Pathway
Abstract
:1. Introduction
2. Results
2.1. KLB Is Up-Regulated in ESCs of IUA Patients
2.2. Construction of an IUA Animal Model and Verification of KLB Expression
2.3. Construction of an IUA Cell Model and Verification of KLB Expression
2.4. KLB Promotes ESCs Proliferation and Fibrosis Induced by TGF-β1
2.5. KLB Activates the PI3K/AKT Signaling Pathway in ESCs
3. Discussion
4. Materials and Methods
4.1. Human Endometrial Tissue Collection
4.2. Animal Model
4.3. Immunofluorescence and Immunohistochemistry
4.4. Quantitative Real-Time PCR (qRT-PCR) Analysis
4.5. Western Blot Analysis
4.6. Primary Human Endometrial Stromal Cell (ESC) Isolation and Culture
4.7. Cell Culture
4.8. Plasmid Transfection
4.9. Cell Counting Kit-8 (CCK8) Assay
4.10. Assay Based on 5-Ethyl-2′-deoxyuridine (EdU)
4.11. Statistical Analysis
5. Conclusions
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Conflicts of Interest
References
- Yu, D.; Wong, Y.M.; Cheong, Y.; Xia, E.; Li, T.C. Asherman syndrome—One century later. Fertil Steril 2008, 89, 759–779. [Google Scholar] [CrossRef] [PubMed]
- Schenker, J.G.; Margalioth, E.J. Intrauterine adhesions: An updated appraisal. Fertil Steril 1982, 37, 593–610. [Google Scholar] [CrossRef] [PubMed]
- Chen, Y.; Liu, L.; Luo, Y.; Chen, M.; Huan, Y.; Fang, R. Prevalence and Impact of Chronic Endometritis in Patients With Intrauterine Adhesions: A Prospective Cohort Study. J. Minim. Invasive Gynecol. 2017, 24, 74–79. [Google Scholar] [CrossRef]
- Prianishnikov, V.A. On the concept of stem cell and a model of functional-morphological structure of the endometrium. Contraception 1978, 18, 213–223. [Google Scholar] [CrossRef]
- Gargett, C.E.; Ye, L. Endometrial reconstruction from stem cells. Fertil Steril 2012, 98, 11–20. [Google Scholar] [CrossRef]
- Toaff, R.; Ballas, S. Traumatic hypomenorrhea-amenorrhea (Asherman’s syndrome). Fertil Steril 1978, 30, 379–387. [Google Scholar] [CrossRef]
- Hu, J.; Zeng, B.; Jiang, X.; Hu, L.; Meng, Y.; Zhu, Y.; Mao, M. The expression of marker for endometrial stem cell and fibrosis was increased in intrauterine adhesious. Int. J. Clin. Exp. Pathol. 2015, 8, 1525–1534. [Google Scholar]
- Salma, U.; Xue, M.; Ali Sheikh, M.S.; Guan, X.; Xu, B.; Zhang, A.; Huang, L.; Xu, D. Role of Transforming Growth Factor-β1 and Smads Signaling Pathway in Intrauterine Adhesion. Mediat. Inflamm. 2016, 2016, 4158287. [Google Scholar] [CrossRef]
- Wilkes, M.C.; Mitchell, H.; Penheiter, S.G.; Doré, J.J.; Suzuki, K.; Edens, M.; Sharma, D.K.; Pagano, R.E.; Leof, E.B. Transforming Growth Factor-β Activation of Phosphatidylinositol 3-Kinase Is Independent of Smad2 and Smad3 and Regulates Fibroblast Responses via p21-Activated Kinase-2. Cancer Res. 2005, 65, 10431–10440. [Google Scholar] [CrossRef]
- Xiong, T.; Tang, J.; Zhao, J.; Chen, H.; Zhao, F.; Li, J.; Qu, Y.; Ferriero, D.; Mu, D. Involvement of the Akt/GSK-3β/CRMP-2 pathway in axonal injury after hypoxic–ischemic brain damage in neonatal rat. Neuroscience 2012, 216, 123–132. [Google Scholar] [CrossRef]
- Sahu, A.; Mamiya, H.; Shinde, S.N.; Cheikhi, A.; Winter, L.L.; Vo, N.V.; Stolz, D.; Roginskaya, V.; Tang, W.Y.; St Croix, C.; et al. Age-related declines in α-Klotho drive progenitor cell mitochondrial dysfunction and impaired muscle regeneration. Nat. Commun. 2018, 9, 4859. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Zhu, Y.; Xu, L.; Zhang, J.; Xu, W.; Liu, Y.; Yin, H.; Lv, T.; An, H.; Liu, L.; He, H.; et al. Klotho suppresses tumor progression via inhibiting PI3K/Akt/GSK3β/Snail signaling in renal cell carcinoma. Cancer Sci. 2013, 104, 663–671. [Google Scholar] [CrossRef]
- Suzuki, Y.; Kuzina, E.; An, S.J.; Tome, F.; Mohanty, J.; Li, W.; Lee, S.; Liu, Y.; Lax, I.; Schlessinger, J. FGF23 contains two distinct high-affinity binding sites enabling bivalent interactions with α-Klotho. Proc. Natl. Acad. Sci. USA 2020, 117, 31800–31807. [Google Scholar] [CrossRef] [PubMed]
- Barnes, J.W.; Duncan, D.; Helton, S.; Hutcheson, S.; Kurundkar, D.; Logsdon, N.J.; Locy, M.; Garth, J.; Denson, R.; Farver, C.; et al. Role of fibroblast growth factor 23 and klotho cross talk in idiopathic pulmonary fibrosis. Am. J. Physiol. Lung Cell. Mol. Physiol. 2019, 317, L141–L154. [Google Scholar] [CrossRef] [PubMed]
- Ito, S.; Kinoshita, S.; Shiraishi, N.; Nakagawa, S.; Sekine, S.; Fujimori, T.; Nabeshima, Y.I. Molecular cloning and expression analyses of mouse betaklotho, which encodes a novel Klotho family protein. Mech. Dev. 2000, 98, 115–119. [Google Scholar] [CrossRef]
- Liu, Z.; Zhang, H.; Ding, S.; Qi, S.; Liu, S.; Sun, D.; Dong, W.; Yin, L.; Li, M.; Zhao, X.; et al. βKlotho inhibits androgen/androgen receptor-associated epithelial-mesenchymal transition in prostate cancer through inactivation of ERK1/2 signaling. Oncol. Rep. 2018, 40, 217–225. [Google Scholar] [CrossRef] [PubMed]
- Motylewska, E.; Stępień, T.; Borkowska, M.; Kuzdak, K.; Siejka, A.; Komorowski, J.; Stępień, H.; Ławnicka, H. Alteration in the serum concentrations of FGF19, FGFR4 and βKlotho in patients with thyroid cancer. Cytokine 2018, 105, 32–36. [Google Scholar] [CrossRef]
- Li, F.; Li, X.; Li, Z.; Ji, W.; Lu, S.; Xia, W. βKlotho is identified as a target for theranostics in non-small cell lung cancer. Theranostics 2019, 9, 7474–7489. [Google Scholar] [CrossRef]
- Hori, S.; Miyake, M.; Onishi, S.; Tatsumi, Y.; Morizawa, Y.; Nakai, Y.; Anai, S.; Tanaka, N.; Fujimoto, K. Clinical significance of α- and β-Klotho in urothelial carcinoma of the bladder. Oncol. Rep. 2016, 36, 2117–2125. [Google Scholar] [CrossRef]
- Lin, Z.Z.; Hsu, C.; Jeng, Y.M.; Hu, F.C.; Pan, H.W.; Wu, Y.M.; Hsu, H.C.; Hu, M.C.; Cheng, A.L. Klotho-beta and fibroblast growth factor 19 expression correlates with early recurrence of resectable hepatocellular carcinoma. Liver Int. Off. J. Int. Assoc. Study Liver 2019, 39, 1682–1691. [Google Scholar] [CrossRef]
- Chen, T.; Chen, J.; Zhao, X.; Zhou, J.; Sheng, Q.; Zhu, L.; Lv, Z. βKlotho, a direct target of miR-206, contributes to the growth of hepatoblastoma through augmenting PI3K/Akt/mTOR signaling. Am. J. Cancer Res. 2021, 11, 1982–2004. [Google Scholar]
- Luo, Y.; Yang, C.; Lu, W.; Xie, R.; Jin, C.; Huang, P.; Wang, F.; McKeehan, W.L. Metabolic regulator betaKlotho interacts with fibroblast growth factor receptor 4 (FGFR4) to induce apoptosis and inhibit tumor cell proliferation. J. Biol. Chem. 2010, 285, 30069–30078. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Dongiovanni, P.; Crudele, A.; Panera, N.; Romito, I.; Meroni, M.; De Stefanis, C.; Palma, A.; Comparcola, D.; Fracanzani, A.L.; Miele, L.; et al. β-Klotho gene variation is associated with liver damage in children with NAFLD. J. Hepatol. 2020, 72, 411–419. [Google Scholar] [CrossRef] [PubMed]
- Lee, K.J.; Jang, Y.O.; Cha, S.-K.; Kim, M.Y.; Park, K.-S.; Eom, Y.W.; Baik, S.K. Expression of Fibroblast Growth Factor 21 and β-Klotho Regulates Hepatic Fibrosis through the Nuclear Factor-κB and c-Jun N-Terminal Kinase Pathways. Gut Liver 2018, 12, 449–456. [Google Scholar] [CrossRef]
- Manchanda, R.; Rathore, A.; Carugno, J.; Della Corte, L.; Tesarik, J.; Török, P.; Vilos, G.A.; Vitale, S.G. Classification systems of Asherman’s syndrome. An old problem with new directions. Minim. Invasive Ther. Allied Technol. MITAT Off. J. Soc. Minim. Invasive Ther. 2021, 30, 304–310. [Google Scholar] [CrossRef] [PubMed]
- Carbonnel, M.; Pirtea, P.; de Ziegler, D.; Ayoubi, J.M. Uterine factors in recurrent pregnancy losses. Fertil Steril 2021, 115, 538–545. [Google Scholar] [CrossRef]
- Hooker, A.B.; de Leeuw, R.A.; Twisk, J.W.R.; Brölmann, H.A.M.; Huirne, J.A.F. Reproductive performance of women with and without intrauterine adhesions following recurrent dilatation and curettage for miscarriage: Long-term follow-up of a randomized controlled trial. Hum. Reprod. 2021, 36, 70–81. [Google Scholar] [CrossRef]
- Owusu-Akyaw, A.; Krishnamoorthy, K.; Goldsmith, L.T.; Morelli, S.S. The role of mesenchymal-epithelial transition in endometrial function. Hum. Reprod. Update 2019, 25, 114–133. [Google Scholar] [CrossRef]
- Lee, W.L.; Liu, C.H.; Cheng, M.; Chang, W.H.; Liu, W.M.; Wang, P.H. Focus on the Primary Prevention of Intrauterine Adhesions: Current Concept and Vision. Int. J. Mol. Sci. 2021, 22, 5175. [Google Scholar] [CrossRef]
- Cortes-Araya, Y.; Stenhouse, C.; Salavati, M.; Dan-Jumbo, S.O.; Ho, W.; Ashworth, C.J.; Clark, E.; Esteves, C.L.; Donadeu, F.X. KLB dysregulation mediates disrupted muscle development in intrauterine growth restriction. J. Physiol. 2022, 600, 1771–1790. [Google Scholar] [CrossRef]
- Kuro, O.M. The Klotho proteins in health and disease. Nat. Rev. Nephrol. 2019, 15, 27–44. [Google Scholar] [CrossRef] [PubMed]
- Alsamman, M.; Sterzer, V.; Meurer, S.K.; Sahin, H.; Schaeper, U.; Kuscuoglu, D.; Strnad, P.; Weiskirchen, R.; Trautwein, C.; Scholten, D. Endoglin in human liver disease and murine models of liver fibrosis-A protective factor against liver fibrosis. Liver Int. Off. J. Int. Assoc. Study Liver 2018, 38, 858–867. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Roberts, A.B.; Piek, E.; Böttinger, E.P.; Ashcroft, G.; Mitchell, J.B.; Flanders, K.C. Is Smad3 a major player in signal transduction pathways leading to fibrogenesis? Chest 2001, 120, 43s–47s. [Google Scholar] [CrossRef]
- Yu, Q.Y.; Tang, X.X. Irreversibility of Pulmonary Fibrosis. Aging Dis. 2022, 13, 73–86. [Google Scholar] [CrossRef] [PubMed]
- Eremichev, R.; Kulebyakina, M.; Alexandrushkina, N.; Nimiritsky, P.; Basalova, N.; Grigorieva, O.; Egiazaryan, M.; Dyikanov, D.; Tkachuk, V.; Makarevich, P. Scar-Free Healing of Endometrium: Tissue-Specific Program of Stromal Cells and Its Induction by Soluble Factors Produced after Damage. Front. Cell Dev. Biol. 2021, 9, 616893. [Google Scholar] [CrossRef]
- Abudukeyoumu, A.; Li, M.Q.; Xie, F. Transforming growth factor-β1 in intrauterine adhesion. Am. J. Reprod. Immunol. 2020, 84, e13262. [Google Scholar] [CrossRef]
- Parsons, C.J.; Takashima, M.; Rippe, R.A. Molecular mechanisms of hepatic fibrogenesis. J. Gastroenterol. Hepatol. 2007, 22 (Suppl. S1), S79–S84. [Google Scholar] [CrossRef]
- Poncelet, A.C.; de Caestecker, M.P.; Schnaper, H.W. The transforming growth factor-beta/SMAD signaling pathway is present and functional in human mesangial cells. Kidney Int. 1999, 56, 1354–1365. [Google Scholar] [CrossRef]
- Doi, S.; Zou, Y.; Togao, O.; Pastor, J.V.; John, G.B.; Wang, L.; Shiizaki, K.; Gotschall, R.; Schiavi, S.; Yorioka, N.; et al. Klotho inhibits transforming growth factor-beta1 (TGF-beta1) signaling and suppresses renal fibrosis and cancer metastasis in mice. J. Biol. Chem. 2011, 286, 8655–8665. [Google Scholar] [CrossRef]
- Cui, L.H.; Li, C.X.; Zhuo, Y.Z.; Yang, L.; Cui, N.Q.; Zhang, S.K. Saikosaponin d ameliorates pancreatic fibrosis by inhibiting autophagy of pancreatic stellate cells via PI3K/Akt/mTOR pathway. Chem.-Biol. Interact. 2019, 300, 18–26. [Google Scholar] [CrossRef]
- Chen, L.; Alam, A.; Pac-Soo, A.; Chen, Q.; Shang, Y.; Zhao, H.; Yao, S.; Ma, D. Pretreatment with valproic acid alleviates pulmonary fibrosis through epithelial-mesenchymal transition inhibition in vitro and in vivo. Lab. Investig. A J. Tech. Methods Pathol. 2021, 101, 1166–1175. [Google Scholar] [CrossRef] [PubMed]
- Cheng, Y.; Tian, Y.; Xia, J.; Wu, X.; Yang, Y.; Li, X.; Huang, C.; Meng, X.; Ma, T.; Li, J. The role of PTEN in regulation of hepatic macrophages activation and function in progression and reversal of liver fibrosis. Toxicol. Appl. Pharmacol. 2017, 317, 51–62. [Google Scholar] [CrossRef] [PubMed]
- Zhang, L.; Zhang, B.; Wei, M.; Xu, Z.; Kong, W.; Deng, K.; Xu, X.; Zhang, L.; Ζhao, X.; Yan, L. TRIM22 inhibits endometrial cancer progression through the NOD2/NF-κB signaling pathway and confers a favorable prognosis. Int. J. Oncol. 2020, 56, 1225–1239. [Google Scholar] [CrossRef] [PubMed]
- Xu, Z.; Zhang, L.; Yu, Q.; Zhang, Y.; Yan, L.; Chen, Z.J. The estrogen-regulated lncRNA H19/miR-216a-5p axis alters stromal cell invasion and migration via ACTA2 in endometriosis. Mol. Hum. Reprod. 2019, 25, 550–561. [Google Scholar] [CrossRef]
Gene | Forward Sequence | Reverse Sequence |
---|---|---|
Homo-KLB | GCAGTCAGACCCAAGAAAA TAC | GAGTAGAACCAGGGTGGAGAA |
Homo-Collagen I | TAAAGGGTCACCGTGGCTTC | GGGAGACCGTTGAGTCCA TC |
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations. |
© 2022 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Guo, Z.; Wang, Y.; Wen, X.; Xu, X.; Yan, L. β-Klotho Promotes the Development of Intrauterine Adhesions via the PI3K/AKT Signaling Pathway. Int. J. Mol. Sci. 2022, 23, 11294. https://doi.org/10.3390/ijms231911294
Guo Z, Wang Y, Wen X, Xu X, Yan L. β-Klotho Promotes the Development of Intrauterine Adhesions via the PI3K/AKT Signaling Pathway. International Journal of Molecular Sciences. 2022; 23(19):11294. https://doi.org/10.3390/ijms231911294
Chicago/Turabian StyleGuo, Zizhen, Yuqing Wang, Xiaoyang Wen, Xinxin Xu, and Lei Yan. 2022. "β-Klotho Promotes the Development of Intrauterine Adhesions via the PI3K/AKT Signaling Pathway" International Journal of Molecular Sciences 23, no. 19: 11294. https://doi.org/10.3390/ijms231911294