Genome-Wide Identification, Characterization and Expression Analysis of Toll-like Receptors in Marbled Rockfish (Sebastiscus marmoratus)
Abstract
:1. Introduction
2. Results
2.1. Identification and Characterization of SmaTLRs in Marbled Rockfish
2.2. Phylogenetic Relation of the TLR Gene Family among Several Species
2.3. Gene Structure Characterization and Protein Domain Prediction
2.4. Expression of SmaTLRs in Different Tissues
2.5. Expression of SmaTLRs after Poly(I:C) Challenge
3. Discussion
3.1. Characterization of TLRs in Marbled Rockfish
3.2. Expression of SmaTLRs in Different Tissues of Healthy Individuals
3.3. Immune Response of SmaTLRs against Poly (I:C) Challenge
4. Materials and Methods
4.1. Ethics Statement
4.2. Identification of Members of the TLR Gene Family
4.3. Gene Structure Characterization and Protein-Conserved Domain Prediction
4.4. Phylogenetic and Syntenic Analysis of TLR Genes in Marbled Rockfish
4.5. Chromosomal Locations of TLR Genes in Marbled Rockfish
4.6. Challenge Experiment and Sample Collection
4.7. RNA Extraction, cDNA Synthesis and qRT-PCR Analysis of SmaTLR Expression
5. Conclusions
Supplementary Materials
Author Contributions
Funding
Institutional Review Board Statement
Data Availability Statement
Conflicts of Interest
References
- Janeway, C.A.; Medzhitov, R. Innate immune recognition. Annu. Rev. Immunol. 2002, 20, 197–216. [Google Scholar] [CrossRef] [PubMed]
- Iwasaki, A.; Medzhitov, R. Toll-like receptor control of the adaptive immune responses. Nat. Immunol. 2004, 5, 987–995. [Google Scholar] [CrossRef] [PubMed]
- Anderson, K.V.; Jurgens, G.; Nusslein-Volhard, C. Establishment of dorsal-ventral polarity in the Drosophila embryo: Genetic studies on the role of the toll gene product. Cell 1985, 42, 779–789. [Google Scholar] [CrossRef]
- Lemaitre, B.; Nicolas, E.; Michaut, L.; Reichhart, J.-M.; Hoffmann, J.A. The dorsoventral regulatory gene cassette spatzle/Toll/cactus controls the potent antifungal response in Drosophila adults. J. Immunol. 2012, 188, 5210–5220. [Google Scholar] [CrossRef]
- Kawai, T.; Akira, S. The role of pattern-recognition receptors in innate immunity: Update on Toll-like receptors. Nat. Immunol. 2010, 11, 373–384. [Google Scholar] [CrossRef]
- Moresco, E.M.Y.; LaVine, D.; Beutler, B. Toll-like receptors. Curr. Biol. 2011, 21, R488–R493. [Google Scholar] [CrossRef]
- Liao, Z.; Su, J. Progresses on three pattern recognition receptor families (TLRs, RLRs and NLRs) in teleost. Dev. Comp. Immunol. 2021, 122, 104131. [Google Scholar] [CrossRef]
- Quiniou, S.M.A.; Boudinot, P.; Bengtén, E. Comprehensive survey and genomic characterization of toll-like receptors (TLRs) in channel catfish, Ictalurus punctatus: Identification of novel fish TLRs. Immunogenetics 2013, 65, 511–530. [Google Scholar] [CrossRef]
- Takano, T.; Hwang, S.D.; Kondo, H.; Hirono, I.; Aoki, T.; Sano, M. Evidence of molecular toll-like receptor mechanisms in teleosts. Fish Pathol. 2010, 45, 1–16. [Google Scholar] [CrossRef]
- Hwang, S.D.; Kondo, H.; Hirono, I.; Aoki, T. Molecular cloning and expression study on toll-like receptor 5 paralogs in Japanese flounder, Paralichthys olivaceus. Fish Shellfish Immun. 2011, 30, 425–429. [Google Scholar] [CrossRef]
- Wang, J.; Zhang, Z.; Liu, J.; Li, F.; Chang, F.; Fu, H.; Zhao, J.; Yin, D. Structural characterization and evolutionary analysis of fish-specific TLR27. Fish Shellfish Immun. 2015, 45, 940–945. [Google Scholar] [CrossRef] [PubMed]
- Meijer, A.H.; Gabby Krens, S.F.; Medina Rodriguez, I.A.; He, S.; Bitter, W.; Ewa Snaar-Jagalska, B.; Spaink, H.P. Expression analysis of the toll-like receptor and TIR domain adaptor families of zebrafish. Mol. Immunol. 2004, 40, 773–783. [Google Scholar] [CrossRef] [PubMed]
- Sundaram, A.Y.M.; Kiron, V.; Dopazo, J.; Fernandes, J.M.O. Diversification of the expanded teleost-specific toll-like receptor family in Atlantic cod, Gadus morhua. BMC Evol. Biol. 2012, 12, 256. [Google Scholar] [CrossRef]
- O’Neill, L.A.J.; Golenbock, D.; Bowie, A.G. The history of toll-like receptors—Redefining innate immunity. Nat. Rev. Immunol. 2013, 13, 453–460. [Google Scholar] [CrossRef] [PubMed]
- Debnath, S.; Hao, G.Y.; Guan, B.; Thapa, P.; Hao, J.; Hammers, H.; Sun, X.K. Theranostic small-molecule prodrug conjugates for targeted delivery and controlled release of toll-like receptor 7 agonists. Int. J. Mol. Sci. 2022, 23, 7160. [Google Scholar] [CrossRef]
- Jin, M.S.; Kim, S.E.; Heo, J.Y.; Lee, M.E.; Kim, H.M.; Paik, S.G.; Lee, H.; Lee, J.O. Crystal structure of the TLR1-TLR2 heterodimer induced by binding of a tri-acylated lipopeptide. Cell 2007, 130, 1071–1082. [Google Scholar] [CrossRef]
- Hasan, U.; Chaffois, C.; Gaillard, C.; Saulnier, V.; Merck, E.; Tancredi, S.; Guiet, C.; Briere, F.; Vlach, J.; Lebecque, S.; et al. Human TLR10 is a functional receptor, expressed by B cells and plasmacytoid dendritic cells, which activates gene transcription through MyD88. J. Immunol. 2005, 174, 2942–2950. [Google Scholar] [CrossRef]
- Peri, F.; Calabrese, V. Toll-like receptor 4 (TLR4) modulation by synthetic and natural compounds: An update. J. Med. Chem. 2014, 57, 3612–3622. [Google Scholar] [CrossRef]
- Hayashi, F.; Smith, K.D.; Ozinsky, A.; Hawn, T.R.; Yi, E.C.; Goodlett, D.R.; Eng, J.K.; Akira, S.; Underhill, D.M.; Aderem, A. The innate immune response to bacterial flagellin is mediated by toll-like receptor 5. Nature 2001, 410, 1099–1103. [Google Scholar] [CrossRef]
- Vasilakos, J.P.; Tomai, M.A. The use of toll-like receptor 7/8 agonists as vaccine adjuvants. Expert Rev. Vaccines 2013, 12, 809–819. [Google Scholar] [CrossRef]
- Yeh, D.W.; Liu, Y.L.; Lo, Y.C.; Yuh, C.H.; Yu, G.Y.; Lo, J.F.; Luo, Y.P.; Xiang, R.; Chuang, T.H. Toll-like receptor 9 and 21 have different ligand recognition profiles and cooperatively mediate activity of CpG-oligodeoxynucleotides in zebrafish. Proc. Natl. Acad. Sci. USA 2013, 110, 20711–20716. [Google Scholar] [CrossRef] [PubMed]
- Matsuo, A.; Oshiumi, H.; Tsujita, T.; Mitani, H.; Kasai, H.; Yoshimizu, M.; Matsumoto, M.; Seya, T. Teleost TLR22 recognizes RNA duplex to induce IFN and protect cells from birnaviruses. J. Immunol. 2008, 181, 3474–3485. [Google Scholar] [CrossRef] [PubMed]
- Palti, Y. Toll-like receptors in bony fish: From genomics to function. Dev. Comp. Immunol. 2011, 35, 1263–1272. [Google Scholar] [CrossRef] [PubMed]
- Takeda, K.; Akira, S. Toll-like receptors. Curr. Protoc. Immunol. 2015, 109, 14.12.1–14.12.10. [Google Scholar] [CrossRef]
- Lee, Y.; Wada, S.; Kurata, O. Cellular inflammatory response on marbled rockfish Sebastiscus marmoratus experimentally infected with Ochroconis humicola. Fish Shellfish. Immun. 2019, 91, 419. [Google Scholar] [CrossRef]
- Yin, F.; Qian, D. Transcriptomic analysis reveals the key immune-related signalling pathways of Sebastiscus marmoratus in response to infection with the parasitic ciliate Cryptocaryon irritans. Parasit. Vector. 2017, 10, 576. [Google Scholar] [CrossRef]
- Bo, J.; Yang, Y.; Zheng, R.; Fang, C.; Jiang, Y.; Liu, J.; Chen, M.; Hong, F.; Bailey, C.; Segner, H.; et al. Antimicrobial activity and mechanisms of multiple antimicrobial peptides isolated from rockfish Sebastiscus marmoratus. Fish Shellfish Immun. 2019, 93, 1007–1017. [Google Scholar] [CrossRef]
- Wang, Y.B.; Zhang, S.T.; Li, H.Y.; Wang, H.S.; Zhang, T.S.; Hutchinson, M.R.; Yin, H.; Wang, X.H. Small-molecule modulators of toll-like receptors. Acc. Chem. Res. 2020, 53, 1046–1055. [Google Scholar] [CrossRef]
- Kaur, A.; Baldwin, J.; Brar, D.; Salunke, D.B.; Petrovsky, N. Toll-like receptor (TLR) agonists as a driving force behind next-generation vaccine adjuvants and cancer therapeutics. Curr. Opin. Chem. Biol. 2022, 70, 102172. [Google Scholar] [CrossRef]
- Avunje, S.; Jung, S.J. Poly (I:C) and imiquimod induced immune responses and their effects on the survival of olive flounder (Paralichthys olivaceus) from viral haemorrhagic septicaemia. Fish Shellfish Immun. 2017, 71, 338–345. [Google Scholar] [CrossRef]
- Zhou, Z.; Zhang, B.; Sun, L. Poly(I:C) induces antiviral immune responses in Japanese flounder (Paralichthys olivaceus) that require TLR3 and MDA5 and is negatively regulated by Myd88. PLoS ONE 2014, 9, e112918. [Google Scholar] [CrossRef] [PubMed]
- Gong, Y.; Feng, S.; Li, S.; Zhang, Y.; Zhao, Z.; Hu, M.; Xu, P.; Jiang, Y. Genome-wide characterization of toll-like receptor gene family in common carp (Cyprinus carpio) and their involvement in host immune response to Aeromonas hydrophila infection. Comp. Biochem. Phys. D 2017, 24, 89–98. [Google Scholar] [CrossRef] [PubMed]
- Zhang, J.; Kong, X.; Zhou, C.; Li, L.; Nie, G.; Li, X. Toll-like receptor recognition of bacteria in fish: Ligand specificity and signal pathways. Fish Shellfish Immun. 2014, 41, 380–388. [Google Scholar] [CrossRef]
- Sepulcre, M.P.; Alcaraz-Perez, F.; Lopez-Munoz, A.; Roca, F.J.; Meseguer, J.; Cayuela, M.L.; Mulero, V. Evolution of lipopolysaccharide (LPS) recognition and signaling: Fish TLR4 does not recognize LPS and negatively regulates NF-kappa B activation. J. Immunol. 2009, 182, 1836–1845. [Google Scholar] [CrossRef] [PubMed]
- Sullivan, C.; Charette, J.; Catchen, J.; Lage, C.R.; Giasson, G.; Postlethwait, J.H.; Millard, P.J.; Kim, C.H. The gene history of zebrafish tlr4a and tlr4b is predictive of their divergent functions. J. Immunol. 2009, 183, 5896–5908. [Google Scholar] [CrossRef]
- Bai, J.S.; Li, Y.W.; Deng, Y.; Huang, Y.Q.; He, S.H.; Dai, J.; Zhao, S.Z.; Dan, X.M.; Luo, X.C. Molecular identification and expression analysis of TLR5M and TLR5S from orange-spotted grouper (Epinephelus coioides). Fish Shellfish Immun. 2017, 63, 97–102. [Google Scholar] [CrossRef]
- Han, F.; Zhang, Y.; Xu, A.; Wang, X.; He, Y.; Song, N.; Gao, T. Genome-wide identification and characterization of toll-like receptor genes in black rockfish (Sebastes schlegelii) and their response mechanisms following poly (I:C) injection. Comp. Biochem. Phys. C 2022, 254, 109277. [Google Scholar] [CrossRef]
- Salazar, C.; Haussmann, D.; Kausel, G.; Figueroa, J. Molecular cloning of Salmo salar toll-like receptors (TLR1, TLR22, TLR5M and TLR5S) and expression analysis in SHK-1 cells during Piscirickettsia salmonis infection. J. Fish. Dis. 2016, 39, 239–248. [Google Scholar] [CrossRef]
- Hynes, N.A.; Furnes, C.; Fredriksen, B.N.; Winther, T.; Bøgwald, J.; Larsen, A.N.; Dalmo, R.A. Immune response of Atlantic salmon to recombinant flagellin. Vaccine 2011, 29, 7678–7687. [Google Scholar] [CrossRef]
- Huang, S.; Yuan, S.; Guo, L.; Yu, Y.; Li, J.; Wu, T.; Liu, T.; Yang, M.; Wu, K.; Liu, H.; et al. Genomic analysis of the immune gene repertoire of amphioxus reveals extraordinary innate complexity and diversity. Genome Res. 2008, 18, 1112–1126. [Google Scholar] [CrossRef] [Green Version]
- Messier-Solek, C.; Buckley, K.M.; Rast, J.P. Highly diversified innate receptor systems and new forms of animal immunity. Semin. Immunol. 2010, 22, 39–47. [Google Scholar] [CrossRef] [PubMed]
- Rast, J.P.; Smith, L.C.; Loza-Coll, M.; Hibino, T.; Litman, G.W. Review—Genomic insights into the immune system of the sea urchin. Science 2006, 314, 952–956. [Google Scholar] [CrossRef] [PubMed]
- Oshiumi, H.; Tsujita, T.; Shida, K.; Matsumoto, M.; Ikeo, K.; Seya, T. Prediction of the prototype of the human toll-like receptor gene family from the pufferfish, Fugu rubripes, genome. Immunogenetics 2003, 54, 791–800. [Google Scholar] [CrossRef] [PubMed]
- Pang, J.; Gao, F.; Wang, M.; Zhao, J.; Lu, M. I Isolation and characterization of toll-like receptor 21 and 22 genes from Nile tilapia, Oreochromis niloticus (Linnaeus). Aquac. Res. 2017, 48, 3528–3544. [Google Scholar] [CrossRef]
- Kang, J.Y.; Lee, J.O. Structural biology of the toll-like receptor family. Annu. Rev. Biochem. 2011, 80, 917–941. [Google Scholar] [CrossRef]
- Kobe, B.; Kajava, A.V. The leucine-rich repeat as a protein recognition motif. Curr. Opin. Struct. Biol. 2001, 11, 725–732. [Google Scholar] [CrossRef]
- Matsushima, N.; Tanaka, T.; Enkhbayar, P.; Mikami, T.; Taga, M.; Yamada, K.; Kuroki, Y. Comparative sequence analysis of leucine-rich repeats (LRRs) within vertebrate toll-like receptors. BMC Genom. 2007, 8, 124. [Google Scholar] [CrossRef]
- Medzhitov, R. Toll-like receptors and innate immunity. Nat. Rev. Immunol. 2001, 1, 135–145. [Google Scholar] [CrossRef]
- Uematsu, S.; Akira, S. Toll-like receptors and innate immunity. J. Mol. Med. 2006, 84, 712–725. [Google Scholar] [CrossRef]
- Dinarello, C.A. Overview of the IL-1 family in innate inflammation and acquired immunity. Immunol. Rev. 2018, 281, 8–27. [Google Scholar] [CrossRef] [Green Version]
- Huo, R.; Zhao, X.; Han, J.; Xu, T. Genomic organization, evolution and functional characterization of soluble toll-like receptor 5 (TLR5S) in miiuy croaker (Miichthys miiuy). Fish Shellfish Immun. 2018, 80, 109–114. [Google Scholar] [CrossRef] [PubMed]
- Albiger, B.; Dahlberg, S.; Henriques-Normark, B.; Normark, S. Role of the innate immune system in host defence against bacterial infections: Focus on the toll-like receptors. J. Intern. Med. 2007, 261, 511–528. [Google Scholar] [CrossRef] [PubMed]
- Slack, J.L.; Schooley, K.; Bonnert, T.P.; Mitcham, J.L.; Qwarnstrom, E.E.; Sims, J.E.; Dower, S.K. Identification of two major sites in the type I interleukin-1 receptor cytoplasmic region responsible for coupling to pro-inflammatory signaling pathways. J. Biol. Chem. 2000, 275, 4670–4678. [Google Scholar] [CrossRef] [PubMed]
- Watters, T.M.; Kenny, E.F.; O’Neill, L.A.J. Structure, function and regulation of the toll/IL-1 receptor adaptor proteins. Immunol. Cell Biol. 2007, 85, 411–419. [Google Scholar] [CrossRef]
- Gao, H.; Wu, L.; Sun, J.S.; Geng, X.Y.; Pan, B.P. Molecular characterization and expression analysis of toll-like receptor 21 cDNA from Paralichthys olivaceus. Fish Shellfish Immun. 2013, 35, 1138–1145. [Google Scholar] [CrossRef] [PubMed]
- Reyes-Becerril, M.; Ascencio-Valle, F.; Hirono, I.; Kondo, H.; Jirapongpairoj, W.; Esteban, M.A.; Alamillo, E.; Angulo, C. TLR21’s agonists in combination with Aeromonas antigens synergistically up-regulate functional TLR21 and cytokine gene expression in yellowtail leucocytes. Dev. Comp. Immunol. 2016, 61, 107–115. [Google Scholar] [CrossRef] [PubMed]
- Sun, M.; Mu, Y.; Ding, Y.; Ao, J.; Chen, X. Molecular and functional characterization of toll-like receptor 21 in large yellow croaker (Larimichthys crocea). Fish Shellfish Immun. 2016, 59, 179–188. [Google Scholar] [CrossRef]
- Han, F.; Zhang, Y.; Qin, G.; Wang, X.; Song, N.; Gao, T. Genome-wide characterization of toll-like receptors in Japanese meagre Argyrosomus japonicus and their response to poly (I:C) injection. Aquaculture 2021, 542, 736907. [Google Scholar] [CrossRef]
- Gao, F.Y.; Zhou, X.; Lu, M.X.; Wang, M.; Liu, Z.G.; Cao, J.M.; Ke, X.L.; Yi, M.M.; Qiu, D.G. TLR1 in Nile tilapia: The conserved receptor cannot interact with MyD88 and TIRAP but can activate NF-κB in vitro. Dev. Comp. Immunol. 2022, 127, 104300. [Google Scholar] [CrossRef]
- Zhu, Y.; Li, S.; Su, B.; Xue, T.; Cao, M.; Li, C. Genome-wide identification, characterization, and expression of the toll-like receptors in Japanese flounder (Paralichthys olivaceus). Aquaculture 2021, 545, 737127. [Google Scholar] [CrossRef]
- Baoprasertkul, P.; Xu, P.; Peatman, E.; Kucuktas, H.; Liu, Z. Divergent toll-like receptors in catfish (Ictalurus punctatus): TLR5S, TLR20, TLR21. Fish Shellfish Immun. 2007, 23, 1218–1230. [Google Scholar] [CrossRef] [PubMed]
- Pietretti, D.; Wiegertjes, G.F. Ligand specificities of toll-like receptors in fish: Indications from infection studies. Dev. Comp. Immunol. 2014, 43, 205–222. [Google Scholar] [CrossRef] [PubMed]
- Wang, K.L.; Chen, S.N.; Huo, H.J.; Nie, P. Identification and expression analysis of sixteen toll-like receptor genes, TLR1, TLR2a, TLR2b, TLR3, TLR5M, TLR5S, TLR7-9, TLR13a-c, TLR14, TLR21-23 in mandarin fish Siniperca chuatsi. Dev. Comp. Immunol. 2021, 121, 104100. [Google Scholar] [CrossRef] [PubMed]
- Gao, F.Y.; Pang, J.C.; Wang, M.; Lu, M.X.; Liu, Z.G.; Cao, J.M.; Ke, X.L.; Yi, M.M. Structurally diverse genes encode TLR13 in Nile tilapia: The two receptors can recognize Streptococcus 23S RNA and conduct signal transduction through MyD88. Mol. Immunol. 2021, 132, 60–78. [Google Scholar] [CrossRef]
- Zhang, Y.; Qin, G.; Zhang, B.; Lin, Q. The gene structure of tlr21 in lined seahorse, Hippocampus erectus, and its responses to CpG-ODN treatment. J. Trop. Oceanogr. 2019, 38, 67–75. [Google Scholar]
- Pasare, C.; Medzhitov, R. Control of B-cell responses by toll-like receptors. Nature 2005, 438, 364–368. [Google Scholar] [CrossRef]
- Huang, X.N.; Wang, Z.Y.; Yao, C.L. Characterization of toll-like receptor 3 gene in large yellow croaker, Pseudosciaena crocea. Fish Shellfish Immun. 2011, 31, 98–106. [Google Scholar] [CrossRef]
- Sahoo, B.R.; Basu, M.; Swain, B.; Maharana, J.; Dikhit, M.R.; Jayasankar, P.; Samanta, M. Structural insights of rohu TLR3, its binding site analysis with fish reovirus dsRNA, poly I:C and zebrafish TRIF. Int. J. Biol. Macromol. 2012, 51, 531–543. [Google Scholar] [CrossRef]
- Rodriguez, M.F.; Wiens, G.D.; Purcell, M.K.; Palti, Y. Characterization of toll-like receptor 3 gene in rainbow trout (Oncorhynchus mykiss). Immunogenetics 2005, 57, 510–519. [Google Scholar] [CrossRef]
- Su, J.G.; Zhu, Z.Y.; Wang, Y.P.; Zou, J.; Hu, W. Toll-like receptor 3 regulates Mx expression in rare minnow Gobiocypris rarus after viral infection. Immunogenetics 2008, 60, 195–205. [Google Scholar] [CrossRef]
- Rebl, A.; Goldammer, T.; Seyfert, H.M. Toll-like receptor signaling in bony fish. Vet. Immunol. Immunop. 2010, 134, 139–150. [Google Scholar] [CrossRef] [PubMed]
- Zhu, K.C.; Wu, M.; Zhang, D.C.; Guo, H.Y.; Zhang, N.; Guo, L.; Liu, B.S.; Jiang, S.G. T Toll-Like receptor 5 of golden pompano Trachinotus ovatus (Linnaeus 1758): Characterization, promoter activity and functional analysis. Int. J. Mol. Sci. 2020, 21, 5916. [Google Scholar] [CrossRef]
- Qian, T.; Wang, K.; Mu, Y.; Ao, J.; Chen, X. Molecular characterization and expression analysis of TLR 7 and TLR 8 homologs in large yellow croaker (Pseudosciaena crocea). Fish Shellfish Immun. 2013, 35, 671–679. [Google Scholar] [CrossRef] [PubMed]
- Wu, Y.; Zhang, H.; Zhang, B.; Lin, Q.; Liu, Y. Molecular characterization of TLR22 and its role in immunological modification of the brood pouch of the lined seahorse, Hippocampus erectus. Aquaculture 2021, 539, 736628. [Google Scholar] [CrossRef]
- Bailey, T.L.; Johnson, J.; Grant, C.E.; Noble, W.S. The MEME suite. Nucleic Acids Res. 2015, 43, W39–W49. [Google Scholar] [CrossRef]
- Voorrips, R.E. MapChart: Software for the graphical presentation of linkage maps and QTLs. J. Hered. 2002, 93, 77–78. [Google Scholar] [CrossRef] [PubMed]
- Livak, K.J.; Schmittgen, T.D. Analysis of relative gene expression data using real-time quantitative PCR and the 2(-Delta Delta C(T)) Method. Methods 2001, 25, 402–408. [Google Scholar] [CrossRef]
- Zhang, Y.; Wang, X.Y.; Shi, H.L.; Song, N.; Han, F.; Chai, X.J.; Liu, Q.; Wang, Y.B.; Gao, T.X. Comparative transcriptomic analysis of the liver and spleen in marbled rockfish (Sebastiscus Marmoratus) challenged with polyriboinosinic polyribocytidylic acid (poly(I:C)). Aquaculture 2022, 554, 738144. [Google Scholar] [CrossRef]
Name | Gene ID | ORF (bp) | Amino Acid | MW (kDa) | pI | Chr | Accession Number |
---|---|---|---|---|---|---|---|
TLR1-1 | Seb006043 | 2400 | 799 | 90.40 | 6.21 | chr10 | OM891535.1 |
TLR1-2 | Seb020825 | 3621 | 1206 | 134.59 | 6.5 | chr22 | OM891536.1 |
TLR2-1 | Seb022133 | 2466 | 821 | 93.23 | 6.21 | chr23 | OM891537.1 |
TLR2-2 | Seb021445 | 2397 | 798 | 90.37 | 5.94 | chr3 | OM891538.1 |
TLR3 | Seb019353 | 2733 | 910 | 103.49 | 8.85 | chr3 | OM891539.1 |
TLR5S | Seb003500 | 1914 | 637 | 71.43 | 8.21 | chr18 | OM891540.1 |
TLR7 | Seb001894 | 3135 | 1044 | 119.93 | 8.26 | chr12 | OM891541.1 |
TLR13 | Seb002611 | 2724 | 907 | 102.44 | 8.66 | chr20 | OM891542.1 |
TLR14 | Seb013611 | 3039 | 1012 | 116.55 | 8.62 | chr11 | OM891543.1 |
TLR21 | Seb016897 | 2931 | 976 | 113.19 | 8.41 | chr11 | OM891544.1 |
TLR22 | Seb013813 | 2886 | 961 | 109.25 | 9 | chr21 | OM891545.1 |
Gene | Forward Primer (5′-3′) | Reverse Primer (5′-3′) |
---|---|---|
TLR1-2 | CTCCTATTGGTTCGTCACTT | TTCCTGCCTCTCCTCTTC |
TLR2-1 | TGCGATACCTCAACATCTC | GCTCTCCTCTCCATCTGT |
TLR2-2 | GCGTTCAGCGGTAATAATC | CCAGGTCCAGGTCATCTT |
TLR3 | CTACAACCTCCTCAATAGTCT | CAGTGCTGCTCAGTATGT |
TLR5S | CGCTTCAAGACTCCATCC | CCAACTAGATCAGACTCACAT |
TLR7 | CACATACAGCACATTGAGAA | TAGAGGATGATTGACAGGTAG |
TLR13 | CTTACCTCAGTCGCCATC | GCTCTTCTGTCGTTGTCA |
TLR14 | TCACGCCACACCAATAAC | GATGTCAAGATGCTCCAGTA |
TLR21 | TCACCATCTCCTCTAATCCT | CACAGACTCAGCAATCACT |
TLR22 | GCCTTCGTCTCCTACAAC | GATGGTCTTCCTGCTTCC |
β-actin | AGGGAAATCGTGCGTG | ATGATGCTGTTGTAGGTGGT |
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations. |
© 2022 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Zhang, Y.; Wang, X.; Han, F.; Gao, T. Genome-Wide Identification, Characterization and Expression Analysis of Toll-like Receptors in Marbled Rockfish (Sebastiscus marmoratus). Int. J. Mol. Sci. 2022, 23, 11357. https://doi.org/10.3390/ijms231911357
Zhang Y, Wang X, Han F, Gao T. Genome-Wide Identification, Characterization and Expression Analysis of Toll-like Receptors in Marbled Rockfish (Sebastiscus marmoratus). International Journal of Molecular Sciences. 2022; 23(19):11357. https://doi.org/10.3390/ijms231911357
Chicago/Turabian StyleZhang, Yuan, Xiaoyan Wang, Fei Han, and Tianxiang Gao. 2022. "Genome-Wide Identification, Characterization and Expression Analysis of Toll-like Receptors in Marbled Rockfish (Sebastiscus marmoratus)" International Journal of Molecular Sciences 23, no. 19: 11357. https://doi.org/10.3390/ijms231911357