Role of Fibroblast Growth Factors in the Crosstalk of Hepatic Stellate Cells and Uveal Melanoma Cells in the Liver Metastatic Niche
Abstract
:1. Introduction
2. Results
2.1. Interaction between Hepatic Stellate Cells and Uveal Melanoma Cells
2.2. Role of the FGF/FGFR System in the Prognosis of Uveal Melanoma (UM) Patients and in the Interaction between Hepatic Stellate Cells (HSCs) and UM Cells
2.3. Identification of FGF9 as a Factor Secreted by Hepatic Stellate Cells That Promotes the Tumorigenicity of Uveal Melanoma Cells
3. Discussion
4. Materials and Methods
4.1. Cells and Cell Culture
4.2. Analysis of Cell Proliferation
4.3. Protein Analysis
4.4. Hematoxylin and Eosin Staining and Immunohistochemical Staining
4.5. Immunofluorescence Staining
4.6. Analysis of mRNA Expression
4.7. In Silico Analysis
4.8. Statistical Analysis
Supplementary Materials
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Kaliki, S.; Shields, C.L. Uveal melanoma: Relatively rare but deadly cancer. Eye (Lond.) 2017, 31, 241–257. [Google Scholar] [CrossRef] [PubMed]
- Singh, A.D.; Turell, M.E.; Topham, A.K. Uveal melanoma: Trends in incidence, treatment, and survival. Ophthalmology 2011, 118, 1881–1885. [Google Scholar] [CrossRef] [PubMed]
- Rose, D.M.; Essner, R.; Hughes, T.M.; Tang, P.C.; Bilchik, A.; Wanek, L.A.; Thompson, J.F.; Morton, D.L. Surgical resection for metastatic melanoma to the liver: The John Wayne Cancer Institute and Sydney Melanoma Unit experience. Arch. Surg. 2001, 136, 950–955. [Google Scholar] [CrossRef]
- Mariani, P.; Piperno-Neumann, S.; Servois, V.; Berry, M.G.; Dorval, T.; Plancher, C.; Couturier, J.; Levy-Gabriel, C.; Lumbroso-Le Rouic, L.; Desjardins, L.; et al. Surgical management of liver metastases from uveal melanoma: 16 years’ experience at the Institut Curie. Eur. J. Surg. Oncol. 2009, 35, 1192–1197. [Google Scholar] [CrossRef] [PubMed]
- Spagnolo, F.; Caltabiano, G.; Queirolo, P. Uveal melanoma. Cancer Treat. Rev. 2012, 38, 549–553. [Google Scholar] [CrossRef]
- Kang, N.; Gores, G.J.; Shah, V.H. Hepatic stellate cells: Partners in crime for liver metastases? Hepatology 2011, 54, 707–713. [Google Scholar] [CrossRef]
- Hellerbrand, C. Hepatic stellate cells--the pericytes in the liver. Pflugers Arch. 2013, 465, 775–778. [Google Scholar] [CrossRef]
- Shimizu, S.; Yamada, N.; Sawada, T.; Ikeda, K.; Kawada, N.; Seki, S.; Kaneda, K.; Hirakawa, K. In vivo and in vitro interactions between human colon carcinoma cells and hepatic stellate cells. Jpn. J. Cancer Res. 2000, 91, 1285–1295. [Google Scholar] [CrossRef]
- Bhattacharjee, S.; Hamberger, F.; Ravichandra, A.; Miller, M.; Nair, A.; Affo, S.; Filliol, A.; Chin, L.; Savage, T.M.; Yin, D.; et al. Tumor restriction by type I collagen opposes tumor-promoting effects of cancer-associated fibroblasts. J. Clin. Invest. 2021, 131. [Google Scholar] [CrossRef]
- Correia, A.L.; Guimaraes, J.C.; der Maur, P.A.; de Silva, D.; Trefny, M.P.; Okamoto, R.; Bruno, S.; Schmidt, A.; Mertz, K.; Volkmann, K.; et al. Hepatic stellate cells suppress NK cell-sustained breast cancer dormancy. Nature 2021, 594, 566–571. [Google Scholar] [CrossRef]
- Cheng, H.; Chua, V.; Liao, C.; Purwin, T.J.; Terai, M.; Kageyama, K.; Davies, M.A.; Sato, T.; Aplin, A.E. Co-targeting HGF/cMET Signaling with MEK Inhibitors in Metastatic Uveal Melanoma. Mol. Cancer Ther. 2017, 16, 516–528. [Google Scholar] [CrossRef] [PubMed]
- Schmidt, K.M.; Dietrich, P.; Hackl, C.; Guenzle, J.; Bronsert, P.; Wagner, C.; Fichtner-Feigl, S.; Schlitt, H.J.; Geissler, E.K.; Hellerbrand, C.; et al. Inhibition of mTORC2/RICTOR Impairs Melanoma Hepatic Metastasis. Neoplasia 2018, 20, 1198–1208. [Google Scholar] [CrossRef] [PubMed]
- Ornitz, D.M.; Itoh, N. The Fibroblast Growth Factor signaling pathway. Wiley Interdiscip. Rev. Dev. Biol. 2015, 4, 215–266. [Google Scholar] [CrossRef] [PubMed]
- Xie, Y.; Su, N.; Yang, J.; Tan, Q.; Huang, S.; Jin, M.; Ni, Z.; Zhang, B.; Zhang, D.; Luo, F.; et al. FGF/FGFR signaling in health and disease. Signal Transduct. Target. Ther. 2020, 5, 181. [Google Scholar] [CrossRef] [PubMed]
- Rezzola, S.; Ronca, R.; Loda, A.; Nawaz, M.I.; Tobia, C.; Paganini, G.; Maccarinelli, F.; Giacomini, A.; Semeraro, F.; Mor, M.; et al. The Autocrine FGF/FGFR System in both Skin and Uveal Melanoma: FGF Trapping as a Possible Therapeutic Approach. Cancers 2019, 11, 1305. [Google Scholar] [CrossRef] [PubMed]
- Czyz, M. Fibroblast Growth Factor Receptor Signaling in Skin Cancers. Cells 2019, 8, 540. [Google Scholar] [CrossRef]
- Kisseleva, T. The origin of fibrogenic myofibroblasts in fibrotic liver. Hepatology 2017, 65, 1039–1043. [Google Scholar] [CrossRef]
- Jørgensen, K.; Davidson, B.; Flørenes, V.A. Activation of c-jun N-terminal kinase is associated with cell proliferation and shorter relapse-free period in superficial spreading malignant melanoma. Mod. Pathol. 2006, 19, 1446–1455. [Google Scholar] [CrossRef]
- Chen, X.; Wu, Q.; Tan, L.; Porter, D.; Jager, M.J.; Emery, C.; Bastian, B.C. Combined PKC and MEK inhibition in uveal melanoma with GNAQ and GNA11 mutations. Oncogene 2014, 33, 4724–4734. [Google Scholar] [CrossRef]
- Ghedini, G.C.; Ronca, R.; Presta, M.; Giacomini, A. Future applications of FGF/FGFR inhibitors in cancer. Expert Rev. Anticancer Ther. 2018, 18, 861–872. [Google Scholar] [CrossRef]
- Presta, M.; Chiodelli, P.; Giacomini, A.; Rusnati, M.; Ronca, R. Fibroblast growth factors (FGFs) in cancer: FGF traps as a new therapeutic approach. Pharmacol. Ther. 2017, 179, 171–187. [Google Scholar] [CrossRef] [PubMed]
- Al-Obaidy, K.I.; Cheng, L. Fibroblast growth factor receptor (FGFR) gene: Pathogenesis and treatment implications in urothelial carcinoma of the bladder. J. Clin. Pathol. 2021, 74, 491–495. [Google Scholar] [CrossRef] [PubMed]
- Pacini, L.; Jenks, A.D.; Lima, N.C.; Huang, P.H. Targeting the Fibroblast Growth Factor Receptor (FGFR) Family in Lung Cancer. Cells 2021, 10, 1154. [Google Scholar] [CrossRef]
- Ferguson, H.R.; Smith, M.P.; Francavilla, C. Fibroblast Growth Factor Receptors (FGFRs) and Noncanonical Partners in Cancer Signaling. Cells 2021, 10, 1201. [Google Scholar] [CrossRef] [PubMed]
- Tang, Z.; Li, C.; Kang, B.; Gao, G.; Li, C.; Zhang, Z. GEPIA: A web server for cancer and normal gene expression profiling and interactive analyses. Nucleic Acids Res. 2017, 45, W98–W102. [Google Scholar] [CrossRef]
- Hagel, M.; Miduturu, C.; Sheets, M.; Rubin, N.; Weng, W.; Stransky, N.; Bifulco, N.; Kim, J.L.; Hodous, B.; Brooijmans, N.; et al. First Selective Small Molecule Inhibitor of FGFR4 for the Treatment of Hepatocellular Carcinomas with an Activated FGFR4 Signaling Pathway. Cancer Discov. 2015, 5, 424–437. [Google Scholar] [CrossRef] [PubMed]
- Guagnano, V.; Furet, P.; Spanka, C.; Bordas, V.; Le Douget, M.; Stamm, C.; Brueggen, J.; Jensen, M.R.; Schnell, C.; Schmid, H.; et al. Discovery of 3-(2,6-dichloro-3,5-dimethoxy-phenyl)-1-{6-4-(4-ethyl-piperazin-1-yl)-phenylamino-pyrimidin-4-yl}-1-methyl-urea (NVP-BGJ398), a potent and selective inhibitor of the fibroblast growth factor receptor family of receptor tyrosine kinase. J. Med. Chem. 2011, 54, 7066–7083. [Google Scholar] [CrossRef] [PubMed]
- Baglieri, J.; Brenner, D.A.; Kisseleva, T. The Role of Fibrosis and Liver-Associated Fibroblasts in the Pathogenesis of Hepatocellular Carcinoma. Int. J. Mol. Sci. 2019, 20, 1723. [Google Scholar] [CrossRef]
- Piquet, L.; Dewit, L.; Schoonjans, N.; Millet, M.; Bérubé, J.; Gerges, P.R.A.; Bordeleau, F.; Landreville, S. Synergic Interactions Between Hepatic Stellate Cells and Uveal Melanoma in Metastatic Growth. Cancers 2019, 11, 1043. [Google Scholar] [CrossRef]
- Grossniklaus, H.E. Progression of ocular melanoma metastasis to the liver: The 2012 Zimmerman lecture. JAMA Ophthalmol. 2013, 131, 462–469. [Google Scholar] [CrossRef] [Green Version]
- Babchia, N.; Landreville, S.; Clément, B.; Coulouarn, C.; Mouriaux, F. The bidirectional crosstalk between metastatic uveal melanoma cells and hepatic stellate cells engenders an inflammatory microenvironment. Exp. Eye Res. 2019, 181, 213–222. [Google Scholar] [CrossRef] [PubMed]
- Herrmann, J.; Gressner, A.M.; Weiskirchen, R. Immortal hepatic stellate cell lines: Useful tools to study hepatic stellate cell biology and function? J. Cell. Mol. Med. 2007, 11, 704–722. [Google Scholar] [CrossRef] [PubMed]
- Ambrosini, G.; Pratilas, C.A.; Qin, L.-X.; Tadi, M.; Surriga, O.; Carvajal, R.D.; Schwartz, G.K. Identification of unique MEK-dependent genes in GNAQ mutant uveal melanoma involved in cell growth, tumor cell invasion, and MEK resistance. Clin. Cancer Res. 2012, 18, 3552–3561. [Google Scholar] [CrossRef] [PubMed]
- Faião-Flores, F.; Emmons, M.F.; Durante, M.A.; Kinose, F.; Saha, B.; Fang, B.; Koomen, J.M.; Chellappan, S.P.; Maria-Engler, S.S.; Rix, U.; et al. HDAC Inhibition Enhances the In Vivo Efficacy of MEK Inhibitor Therapy in Uveal Melanoma. Clin. Cancer Res. 2019, 25, 5686–5701. [Google Scholar] [CrossRef]
- Kappelmann, M.; Bosserhoff, A.; Kuphal, S. AP-1/c-Jun transcription factors: Regulation and function in malignant melanoma. Eur. J. Cell Biol. 2014, 93, 76–81. [Google Scholar] [CrossRef]
- Zhu, Q.; Guo, B.; Chen, L.; Ji, Q.; Liang, H.; Wen, N.; Zhang, L. Cepharanthine exerts antitumor activity on choroidal melanoma by reactive oxygen species production and c-Jun N-terminal kinase activation. Oncol. Lett. 2017, 13, 3760–3766. [Google Scholar] [CrossRef]
- Khalili, J.S.; Yu, X.; Wang, J.; Hayes, B.C.; Davies, M.A.; Lizee, G.; Esmaeli, B.; Woodman, S.E. Combination small molecule MEK and PI3K inhibition enhances uveal melanoma cell death in a mutant GNAQ- and GNA11-dependent manner. Clin. Cancer Res. 2012, 18, 4345–4355. [Google Scholar] [CrossRef]
- Seitz, T.; Freese, K.; Dietrich, P.; Thasler, W.E.; Bosserhoff, A.; Hellerbrand, C. Fibroblast Growth Factor 9 is expressed by activated hepatic stellate cells and promotes progression of hepatocellular carcinoma. Sci. Rep. 2020, 10, 4546. [Google Scholar] [CrossRef]
- Nogova, L.; Sequist, L.V.; Perez Garcia, J.M.; Andre, F.; Delord, J.-P.; Hidalgo, M.; Schellens, J.H.M.; Cassier, P.A.; Camidge, D.R.; Schuler, M.; et al. Evaluation of BGJ398, a Fibroblast Growth Factor Receptor 1-3 Kinase Inhibitor, in Patients With Advanced Solid Tumors Harboring Genetic Alterations in Fibroblast Growth Factor Receptors: Results of a Global Phase I, Dose-Escalation and Dose-Expansion Study. J. Clin. Oncol. 2017, 35, 157–165. [Google Scholar] [CrossRef]
- Zhou, Y.; Wu, C.; Lu, G.; Hu, Z.; Chen, Q.; Du, X. FGF/FGFR signaling pathway involved resistance in various cancer types. J. Cancer 2020, 11, 2000–2007. [Google Scholar] [CrossRef]
- Chua, V.; Orloff, M.; Teh, J.L.; Sugase, T.; Liao, C.; Purwin, T.J.; Lam, B.Q.; Terai, M.; Ambrosini, G.; Carvajal, R.D.; et al. Stromal fibroblast growth factor 2 reduces the efficacy of bromodomain inhibitors in uveal melanoma. EMBO Mol. Med. 2019, 11. [Google Scholar] [CrossRef]
- Cheng, H.; Terai, M.; Kageyama, K.; Ozaki, S.; McCue, P.A.; Sato, T.; Aplin, A.E. Paracrine Effect of NRG1 and HGF Drives Resistance to MEK Inhibitors in Metastatic Uveal Melanoma. Cancer Res. 2015, 75, 2737–2748. [Google Scholar] [CrossRef] [PubMed]
- Economou, M.A.; All-Ericsson, C.; Bykov, V.; Girnita, L.; Bartolazzi, A.; Larsson, O.; Seregard, S. Receptors for the liver synthesized growth factors IGF-1 and HGF/SF in uveal melanoma: Intercorrelation and prognostic implications. Acta Ophthalmol. 2008, 86 Thesis 4, 20–25. [Google Scholar] [CrossRef]
- Bakalian, S.; Marshall, J.-C.; Logan, P.; Faingold, D.; Maloney, S.; Di Cesare, S.; Martins, C.; Fernandes, B.F.; Burnier, M.N. Molecular pathways mediating liver metastasis in patients with uveal melanoma. Clin. Cancer Res. 2008, 14, 951–956. [Google Scholar] [CrossRef] [PubMed]
- Loda, A.; Turati, M.; Semeraro, F.; Rezzola, S.; Ronca, R. Exploring the FGF/FGFR System in Ocular Tumors: New Insights and Perspectives. Int. J. Mol. Sci. 2022, 23, 3835. [Google Scholar] [CrossRef] [PubMed]
- Verbik, D.J.; Murray, T.G.; Tran, J.M.; Ksander, B.R. Melanomas that develop within the eye inhibit lymphocyte proliferation. Int. J. Cancer 1997, 73, 470–478. [Google Scholar] [CrossRef]
- Luyten, G.P.; Naus, N.C.; Mooy, C.M.; Hagemeijer, A.; Kan-Mitchell, J.; van Drunen, E.; Vuzevski, V.; de Jong, P.T.; Luider, T.M. Establishment and characterization of primary and metastatic uveal melanoma cell lines. Int. J. Cancer 1996, 66, 380–387. [Google Scholar] [CrossRef]
- Chen, P.W.; Murray, T.G.; Uno, T.; Salgaller, M.L.; Reddy, R.; Ksander, B.R. Expression of MAGE genes in ocular melanoma during progression from primary to metastatic disease. Clin. Exp. Metastasis 1997, 15, 509–518. [Google Scholar] [CrossRef]
- Kittler, J.M.; Sommer, J.; Fischer, A.; Britting, S.; Karg, M.M.; Bock, B.; Atreya, I.; Heindl, L.M.; Mackensen, A.; Bosch, J.J. Characterization of CD4+ T cells primed and boosted by MHCII primary uveal melanoma cell-based vaccines. Oncotarget 2019, 10, 1812–1828. [Google Scholar] [CrossRef]
- Jager, M.J.; Magner, J.A.B.; Ksander, B.R.; Dubovy, S.R. Uveal Melanoma Cell Lines: Where do they come from? (An American Ophthalmological Society Thesis). Trans. Am. Ophthalmol. Soc. 2016, 114, T5. [Google Scholar]
- Lee, S.M.L.; Schiergens, T.S.; Demmel, M.; Thasler, R.M.K.; Thasler, W.E. Isolation of Hepatocytes and Stellate Cells from a Single Piece of Human Liver. Methods Mol. Biol. 2017, 1506, 247–258. [Google Scholar] [CrossRef]
- Lee, S.M.L.; Schelcher, C.; Demmel, M.; Hauner, M.; Thasler, W.E. Isolation of human hepatocytes by a two-step collagenase perfusion procedure. J. Vis. Exp. 2013. [Google Scholar] [CrossRef] [PubMed]
- Thasler, W.E.; Weiss, T.S.; Schillhorn, K.; Stoll, P.-T.; Irrgang, B.; Jauch, K.-W. Charitable State-Controlled Foundation Human Tissue and Cell Research: Ethic and Legal Aspects in the Supply of Surgically Removed Human Tissue For Research in the Academic and Commercial Sector in Germany. Cell Tissue Bank. 2003, 4, 49–56. [Google Scholar] [CrossRef] [PubMed]
- Mühlbauer, M.; Bosserhoff, A.K.; Hartmann, A.; Thasler, W.E.; Weiss, T.S.; Herfarth, H.; Lock, G.; Schölmerich, J.; Hellerbrand, C. A novel MCP-1 gene polymorphism is associated with hepatic MCP-1 expression and severity of HCV-related liver disease. Gastroenterology 2003, 125, 1085–1093. [Google Scholar] [CrossRef]
- Amann, T.; Bataille, F.; Spruss, T.; Mühlbauer, M.; Gäbele, E.; Schölmerich, J.; Kiefer, P.; Bosserhoff, A.-K.; Hellerbrand, C. Activated hepatic stellate cells promote tumorigenicity of hepatocellular carcinoma. Cancer Sci. 2009, 100, 646–653. [Google Scholar] [CrossRef]
- Dietrich, P.; Wormser, L.; Fritz, V.; Seitz, T.; de Maria, M.; Schambony, A.; Kremer, A.E.; Günther, C.; Itzel, T.; Thasler, W.E.; et al. Molecular crosstalk between Y5 receptor and neuropeptide Y drives liver cancer. J. Clin. Invest. 2020, 130, 2509–2526. [Google Scholar] [CrossRef] [Green Version]
Gene | Forward (5′-3′) | Reverse (5′-3′) |
---|---|---|
FGF2 | GCGACCCTCACATCAAGCTACA | CTGCCCAGTTCGTTTCAGTGC |
FGF5 | CAGCAGTAGCGCTATGTCTTCCT | TACAATCCCCTGAGACACAGCA |
FGF6 | AGTGCCCTCTTCGTTGCCAT | CCCGCTTTACCCGTCCGTAT |
FGF7 | GGCAATCAAAGGGGTGGA | CCTCCGTTGTGTGTCCATTTA |
FGF8 | AGGGTGTCTCCCAACAGGTAAC | GGTGTCCGTCTCCACGATGA |
FGF9 | ATTTCGGTGTGCAGGATGCG | CTGACCAGGCCCACTGCTAT |
FGF10 | GAGTTGTTGCCGTCAAAGCCA | TTGCCTCCCATTATGCTGCCA |
FGF18 | ATGGGGACAAGTATGCCCAGC | TGGTGAAGCCCACGTACCAG |
FGF20 | CTATTGCCGCACCGGCTTC | CCACAAAATACCTGCGGCCAG |
GAPDH | GGCTCTCCAGAACATCATCCCTGC | GGGTGTCGCTGTTGAAGTCAGAGG |
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations. |
© 2022 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Seitz, T.; John, N.; Sommer, J.; Dietrich, P.; Thasler, W.E.; Hartmann, A.; Evert, K.; Lang, S.A.; Bosserhoff, A.; Hellerbrand, C. Role of Fibroblast Growth Factors in the Crosstalk of Hepatic Stellate Cells and Uveal Melanoma Cells in the Liver Metastatic Niche. Int. J. Mol. Sci. 2022, 23, 11524. https://doi.org/10.3390/ijms231911524
Seitz T, John N, Sommer J, Dietrich P, Thasler WE, Hartmann A, Evert K, Lang SA, Bosserhoff A, Hellerbrand C. Role of Fibroblast Growth Factors in the Crosstalk of Hepatic Stellate Cells and Uveal Melanoma Cells in the Liver Metastatic Niche. International Journal of Molecular Sciences. 2022; 23(19):11524. https://doi.org/10.3390/ijms231911524
Chicago/Turabian StyleSeitz, Tatjana, Nora John, Judith Sommer, Peter Dietrich, Wolfgang E. Thasler, Arndt Hartmann, Katja Evert, Sven A. Lang, Anja Bosserhoff, and Claus Hellerbrand. 2022. "Role of Fibroblast Growth Factors in the Crosstalk of Hepatic Stellate Cells and Uveal Melanoma Cells in the Liver Metastatic Niche" International Journal of Molecular Sciences 23, no. 19: 11524. https://doi.org/10.3390/ijms231911524