Mechanisms of Cd-Induced Cytotoxicity in Normal Human Skin Keratinocytes: Implication for Human Health
Abstract
:1. Introduction
2. Results and Discussion
2.1. Cd Decreased Cell Viability and Changed Cell Morphology
2.2. Cd Exposure Caused DNA Damage
2.3. Cd Exposure Induced Cell Cycle Arrest and Apoptosis
2.4. Cd Exposure Altered ER Stress Gene Expression
3. Materials and Methods
3.1. Chemicals and Reagents
3.2. Cell Culture and Cd Treatment
3.3. Cell Viability Assay
3.4. Immunofluorescence Staining
3.5. Cell Cycle and Apoptosis Assays
3.6. RNA Extraction, cDNA Synthesis, and Quantitative RT-PCR
3.7. Statistical Analysis
4. Conclusions
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Conflicts of Interest
References
- Dehghani, S.; Moore, F.; Keshavarzi, B.; Beverley, A.H. Health risk implications of potentially toxic metals in street dust and surface soil of Tehran, Iran. Ecotoxicol. Environ. Saf. 2017, 136, 92–103. [Google Scholar] [CrossRef] [PubMed]
- Dala-Paula, B.M.; Custodio, F.B.; Knupp, E.A.N.; Palmieri, H.E.L.; Silva, J.B.B.; Gloria, M.B.A. Cadmium, copper and lead levels in different cultivars of lettuce and soil from urban agriculture. Environ. Pollut. 2018, 242, 383–389. [Google Scholar] [CrossRef] [PubMed]
- Shahid, M.; Dumat, C.; Khalid, S.; Niazi, N.K.; Antunes, P. Cadmium bioavailability, uptake, toxicity and detoxification in soil-plant system. Rev. Environ. Contam. Toxicol. 2016, 241, 73–137. [Google Scholar]
- Liu, B.; Huang, F.; Yu, Y.; Li, X.; He, Y.; Gao, L.; Hu, X. Heavy Metals in Indoor Dust Across China: Occurrence, Sources and Health Risk Assessment. Arch. Environ. Contam. Toxicol. 2021, 81, 67–76. [Google Scholar] [CrossRef] [PubMed]
- Thévenod, F.; Lee, W.-K. Toxicology of Cadmium and Its Damage to Mammalian Organs. Cadmium Toxic. Essent. 2012, 11, 415–490. [Google Scholar] [CrossRef]
- Han, Q.; Liu, Y.; Feng, X.; Mao, P.; Sun, A.; Wang, M.; Wang, M. Pollution effect assessment of industrial activities on potentially toxic metal distribution in windowsill dust and surface soil in central China. Sci. Total Environ. 2021, 759, 144023. [Google Scholar] [CrossRef] [PubMed]
- Kabir, M.H.; Kormoker, T.; Islam, M.S.; Khan, R.; Shammi, R.S.; Tusher, T.R.; Proshad, R.; Islam, M.S.; Idris, A.M. Potentially toxic elements in street dust from an urban city of a developing country: Ecological and probabilistic health risks assessment. Environ. Sci. Pollut. Res. 2021, 28, 57126–57148. [Google Scholar] [CrossRef]
- Uetani, M.; Kobayashi, E.; Suwazono, Y.; Honda, R.; Nishijo, M.; Nakagawa, H.; Kido, T.; Nogawa, K. Tissue cadmium (Cd) concentrations of people living in a Cd polluted area, Japan. BioMetals 2006, 19, 521–525. [Google Scholar] [CrossRef]
- Liang, Y.; Pi, H.; Liao, L.; Tan, M.; Deng, P.; Yue, Y.; Xi, Y.; Tian, L.; Xie, J.; Chen, M.; et al. Cadmium promotes breast cancer cell proliferation, migration and invasion by inhibiting ACSS2/ATG5-mediated autophagy. Environ. Pollut. 2021, 273, 116504. [Google Scholar] [CrossRef]
- Gong, Z.-G.; Wang, X.-Y.; Wang, J.-H.; Fan, R.-F.; Wang, L. Trehalose prevents cadmium-induced hepatotoxicity by blocking Nrf2 pathway, restoring autophagy and inhibiting apoptosis. J. Inorg. Biochem. 2019, 192, 62–71. [Google Scholar] [CrossRef]
- Gu, J.; Ren, Z.; Zhao, J.; Peprah, F.A.; Xie, Y.; Cheng, D.; Wang, Y.; Liu, H.; Wong, C.K.C.; Zhou, Y.; et al. Calcimimetic compound NPS R-467 protects against chronic cadmium-induced mouse kidney injury by restoring autophagy process. Ecotoxicol. Environ. Saf. 2020, 189, 110052. [Google Scholar] [CrossRef]
- Johri, N.; Jacquillet, G.; Unwin, R. Heavy metal poisoning: The effects of cadmium on the kidney. BioMetals 2010, 23, 783–792. [Google Scholar] [CrossRef]
- Hyder, O.; Chung, M.; Cosgrove, D.; Herman, J.M.; Li, Z.; Firoozmand, A.; Gurakar, A.; Koteish, A.; Pawlik, T.M. Cadmium Exposure and Liver Disease among US Adults. J. Gastrointest. Surg. 2013, 17, 1265–1273. [Google Scholar] [CrossRef]
- Wang, J.; Gao, P.; Li, M.-Y.; Ma, J.-Y.; Li, J.-Y.; Yang, D.-L.; Cui, D.-L.; Xiang, P. Dermal bioaccessibility and cytotoxicity of heavy metals in urban soils from a typical plateau city: Implication for human health. Sci. Total Environ. 2022, 835, 155544. [Google Scholar] [CrossRef]
- Żukowska, J.; Biziuk, M. Methodological evaluation of method for dietary heavy metal intake. J. Food Sci. 2008, 73, 21–29. [Google Scholar] [CrossRef]
- Byber, K.; Lison, D.; Verougstraete, V.; Dressel, H.; Hotz, P. Cadmium or cadmium compounds and chronic kidney disease in workers and the general population: A systematic review. Crit. Rev. Toxicol. 2016, 46, 191–240. [Google Scholar] [CrossRef]
- Zeng, X.; Jin, T.; Buchet, J.P.; Jiang, X.; Kong, Q.; Ye, T.; Bernard, A.; Nordberg, G.F. Impact of cadmium exposure on male sex hormones: A population-based study in China. Environ. Res. 2004, 96, 338–344. [Google Scholar] [CrossRef]
- Zeng, X.; Jin, T.; Zhou, Y.; Nordberg, G.F. Changes of serum sex hormone levels and MT mRNA expression in rats orally exposed to cadmium. Toxicology 2003, 186, 109–118. [Google Scholar] [CrossRef]
- Wang, M.; Wang, X.-f.; Li, Y.-m.; Chen, N.; Fan, Y.; Huang, W.-k.; Hu, S.-f.; Rao, M.; Zhang, Y.-z.; Su, P. Cross-talk between autophagy and apoptosis regulates testicular injury/recovery induced by cadmium via PI3K with mTOR-independent pathway. Cell Death Dis. 2020, 11, 46. [Google Scholar] [CrossRef] [Green Version]
- Gao, Y.; Hong, J.; Guo, Y.; Chen, M.; Chang, A.K.; Xie, L.; Ying, X. Assessment spermatogenic cell apoptosis and the transcript levels of metallothionein and p53 in Meretrix meretrix induced by cadmium. Ecotoxicol. Environ. Saf. 2021, 217, 112230. [Google Scholar] [CrossRef]
- Huang, Y.; Dai, Y.; Li, M.; Guo, L.; Cao, C.; Huang, Y.; Ma, R.; Qiu, S.; Su, X.; Zhong, K.; et al. Exposure to cadmium induces neuroinflammation and impairs ciliogenesis in hESC-derived 3D cerebral organoids. Sci. Total Environ. 2021, 797, 149043. [Google Scholar] [CrossRef]
- Zhang, J.; Zheng, S.; Wang, S.; Liu, Q.; Xu, S. Cadmium-induced oxidative stress promotes apoptosis and necrosis through the regulation of the miR-216a-PI3K/AKT axis in common carp lymphocytes and antagonized by selenium. Chemosphere 2020, 258, 127341. [Google Scholar] [CrossRef]
- Yiming, L.; Yanfei, H.; Hang, Y.; Yimei, C.; Guangliang, S.; Shu, L. Cadmium induces apoptosis of pig lymph nodes by regulating the PI3K/AKT/HIF-1α pathway. Toxicology 2021, 451, 152694. [Google Scholar] [CrossRef]
- Jiaxin, S.; Shengchen, W.; Yirong, C.; Shuting, W.; Shu, L. Cadmium exposure induces apoptosis, inflammation and immunosuppression through CYPs activation and antioxidant dysfunction in common carp neutrophils. Fish Shellfish Immunol. 2020, 99, 284–290. [Google Scholar] [CrossRef]
- Wang, C.; Nie, G.; Zhuang, Y.; Hu, R.; Wu, H.; Xing, C.; Li, G.; Hu, G.; Yang, F.; Zhang, C. Inhibition of autophagy enhances cadmium-induced apoptosis in duck renal tubular epithelial cells. Ecotoxicol. Environ. Saf. 2020, 205, 111188. [Google Scholar] [CrossRef]
- Abbas, I.; Badran, G.; Verdin, A.; Ledoux, F.; Roumie, M.; Guidice, J.-M.L.; Courcot, D.; Garçon, G. In vitro evaluation of organic extractable matter from ambient PM2.5 using human bronchial epithelial BEAS-2B cells: Cytotoxicity, oxidative stress, pro-inflammatory response, genotoxicity, and cell cycle deregulation. Environ. Res. 2019, 171, 510–522. [Google Scholar] [CrossRef]
- Wang, H.; Yu, Y.; Li, J.; Wu, H.; Sun, J.; Zhang, Z.; Geng, L.; Yu, X.; Liu, Z. Cadmium stimulates mouse skin fibroblast apoptosis by affecting intracellular homeostasis. Drug Chem. Toxicol. 2017, 40, 74–84. [Google Scholar] [CrossRef]
- Xie, J.; Shaikh, Z.A. Cadmium induces cell cycle arrest in rat kidney epithelial cells in G2/M phase. Toxicology 2006, 224, 56–65. [Google Scholar] [CrossRef] [PubMed]
- Choi, Y.-J.; Yin, H.-Q.; Suh, H.-R.; Lee, Y.-J.; Park, S.-R.; Lee, B.-H. Involvement of E2F1 transcriptional activity in cadmium-induced cell-cycle arrest at G1 in human lung fibroblasts. Environ. Mol. Mutagen. 2011, 52, 145–152. [Google Scholar] [CrossRef] [PubMed]
- Filon, F.L.; D’agostin, F.; Crosera, M.; Adami, G.; Bovenzi, M.; Maina, G. In vitro absorption of metal powders through intact and damaged human skin. Toxicol. Vitr. 2009, 23, 574–579. [Google Scholar] [CrossRef] [PubMed]
- Leal LT, C.; Guney, M.; Zagury, G.J. In vitro dermal bioaccessibility of selected metals in contaminated soil and mine tailings and human health risk characterization. Chemosphere 2018, 197, 42–49. [Google Scholar] [CrossRef]
- Rauf, A.U.; Mallongi, A.; Astuti, R.D.P. Heavy metal contributions on human skin disease near cement plant: A systematic review. Open Access Maced. J. Med. Sci. 2020, 8, 117–122. [Google Scholar] [CrossRef]
- Pfeffer, C.; Singh, A. Apoptosis: A Target for Anticancer Therapy. Int. J. Mol. Sci. 2018, 19, 448. [Google Scholar] [CrossRef] [Green Version]
- Du, K.; Zheng, X.; Lv, J.; Zhong, X.; Wei, M.; Liu, M. Cordycepin exacerbates cadmium-induced neurotoxicity via promoting endoplasmic reticulum stress-associated apoptosis. J. Funct. Foods 2022, 89, 104935. [Google Scholar] [CrossRef]
- Liu, W.; Xu, C.; Ran, D.; Wang, Y.; Zhao, H.; Gu, J.; Liu, X.; Bian, J.; Yuan, Y.; Liu, Z. CaMKⅡ mediates cadmium induced apoptosis in rat primary osteoblasts through MAPK activation and endoplasmic reticulum stress. Toxicology 2018, 406–407, 70–80. [Google Scholar] [CrossRef]
- Xiang, P.; Wu, K.-C.; Zhu, Y.; Xiang, L.; Li, C.; Chen, D.-L.; Chen, F.; Xu, G.; Wang, A.; Li, M. A novel Bruch’s membrane-mimetic electrospun substrate scaffold for human retinal pigment epithelium cells. Biomaterials 2014, 35, 9777–9788. [Google Scholar] [CrossRef] [Green Version]
- Chen, H.; Lu, Y.; Cao, Z.; Ma, Q.; Pi, H.; Fang, Y.; Yu, Z.; Hu, H.; Zhou, Z. Cadmium induces NLRP3 inflammasome-dependent pyroptosis in vascular endothelial cells. Toxicol. Lett. 2016, 246, 7–16. [Google Scholar] [CrossRef]
- Kim, A.; Park, S.; Sung, J.H. Cell Viability and Immune Response to Low Concentrations of Nickel and Cadmium: An In Vitro Model. Int. J. Environ. Res. Public Health 2020, 17, 9218. [Google Scholar] [CrossRef]
- Wang, K.; Ma, J.-Y.; Li, M.-Y.; Qin, Y.-S.; Bao, X.-C.; Wang, C.-C.; Cui, D.-L.; Xiang, P.; Ma, L.Q. Mechanisms of Cd and Cu induced toxicity in human gastric epithelial cells: Oxidative stress, cell cycle arrest and apoptosis. Sci. Total Environ. 2021, 756, 143951. [Google Scholar] [CrossRef]
- Slobodskova, V.; Solodova, E.; Chelomin, V. DNA damage (Comet assay) as biomarker of Cd exposure in marine seed scallops Mizuhopecten yessoensis age 1 year. J. Environ. Sci. Eng. 2010, 4, 63. [Google Scholar]
- Cheng, Y.; Zhang, J.; Wu, T.; Jiang, X.; Jia, H.; Qing, S.; An, Q.; Zhang, Y.; Su, J. Reproductive toxicity of acute Cd exposure in mouse: Resulting in oocyte defects and decreased female fertility. Toxicol. Appl. Pharmacol. 2019, 379, 114684. [Google Scholar] [CrossRef]
- Giaginis, C.; Gatzidou, E.; Theocharis, S. DNA repair systems as targets of cadmium toxicity. Toxicol. Appl. Pharmacol. 2006, 213, 282–290. [Google Scholar] [CrossRef]
- Norbury, C.J.; Zhivotovsky, B. DNA damage-induced apoptosis. Oncogene 2004, 23, 2797–2808. [Google Scholar] [CrossRef] [Green Version]
- Roos, W.P.; Kaina, B. DNA damage-induced cell death by apoptosis. Trends Mol. Med. 2006, 1, 440–450. [Google Scholar] [CrossRef]
- Markiewicz, E.; Idowu, O.C. DNA damage in human skin and the capacities of natural compounds to modulate the bystander signalling. Open Biol. 2019, 9, 190208. [Google Scholar] [CrossRef] [Green Version]
- Bekeschus, S.; Schütz, C.S.; Nießner, F.; Wende, K.; Weltmann, K.-D.; Gelbrich, N.; von Woedtke, T.; Schmidt, A.; Stope, M.B. Elevated H2AX Phosphorylation Observed with kINPen Plasma Treatment Is Not Caused by ROS-Mediated DNA Damage but Is the Consequence of Apoptosis. Oxid. Med. Cell. Longev. 2019, 2019, 8535163. [Google Scholar] [CrossRef] [Green Version]
- Moeglin, E.; Desplancq, D.; Conic, S.; Oulad-Abdelghani, M.; Stoessel, A.; Chiper, M.; Vigneron, M.; Didier, P.; Tora, L.; Weiss, E. Uniform Widespread Nuclear Phosphorylation of Histone H2AX Is an Indicator of Lethal DNA Replication Stress. Cancers 2019, 11, 355. [Google Scholar] [CrossRef] [Green Version]
- Ou, L.; Wang, H.; Wu, Z.; Wang, P.; Yang, L.; Li, X.; Sun, K.; Zhu, X.; Zhang, R. Effects of cadmium on osteoblast cell line: Exportin 1 accumulation, p-JNK activation, DNA damage and cell apoptosis. Ecotoxicol. Environ. Saf. 2020, 208, 111668. [Google Scholar] [CrossRef] [PubMed]
- Skipper, A.; Sims, J.N.; Yedjou, C.G.; Tchounwou, P.B. Cadmium Chloride Induces DNA Damage and Apoptosis of Human Liver Carcinoma Cells via Oxidative Stress. Int. J. Environ. Res. Public Health 2016, 13, 88. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Xu, D.-X.; Shen, H.-M.; Zhu, Q.-X.; Chua, L.; Wang, Q.-N.; Chia, S.E.; Ong, C.N. The associations among semen quality, oxidative DNA damage in human spermatozoa and concentrations of cadmium, lead and selenium in seminal plasma. Mutat. Res. Toxicol. Environ. Mutagen. 2003, 534, 155–163. [Google Scholar] [CrossRef]
- Chen, S.; Yu, Q.; Dong, W.; Zhang, H.; Zou, H. Isoorientin plays an important role in alleviating Cadmium-induced DNA damage and G0/G1 cell cycle arrest. Ecotoxicol. Environ. Saf. 2020, 187, 109851. [Google Scholar] [CrossRef]
- Elmore, S. Apoptosis: A review of programmed cell death. Toxicol. Pathol. 2007, 35, 495–516. [Google Scholar] [CrossRef]
- Xu, G.; Liu, S.; Huang, M.; Jiang, X.; Yang, M. Cadmium induces apoptosis of human granulosa cell line KGN via mitochondrial dysfunction-mediated pathways. Ecotoxicol. Environ. Saf. 2021, 220, 112341. [Google Scholar] [CrossRef]
- Zhu, Q.; Liu, Z.; Wang, Y.; Song, E.; Song, Y. Endoplasmic reticulum stress manipulates autophagic response that antagonizes polybrominated diphenyl ethers quinone induced cytotoxicity in microglial BV2 cells. J. Hazard. Mater. 2021, 411, 124958. [Google Scholar] [CrossRef]
- Kim, J.; Song, H.; Heo, H.-R.; Kim, J.W.; Kim, H.-R.; Hong, Y.; Yang, S.-R.; Han, S.-S.; Lee, S.-J.; Kim, W.J.; et al. Cadmium-induced ER stress and inflammation are mediated through C/EBP–DDIT3 signaling in human bronchial epithelial cells. Exp. Mol. Med. 2017, 49, e372. [Google Scholar] [CrossRef]
- Komoike, Y.; Inamura, H.; Matsuoka, M. Effects of salubrinal on cadmium-induced apoptosis in HK-2 human renal proximal tubular cells. Arch. Toxicol. 2012, 86, 37–44. [Google Scholar] [CrossRef]
- Heindryckx, F.; Binet, F.; Ponticos, M.; Rombouts, K.; Lau, J.; Kreuger, J.; Gerwins, P. Endoplasmic reticulum stress enhances fibrosis through IRE 1α-mediated degradation of miR-150 and XBP-1 splicing. EMBO Mol. Med. 2016, 8, 729–744. [Google Scholar] [CrossRef]
- Chen, C.-y.; Zhang, S.-l.; Liu, Z.-y.; Tian, Y.; Sun, Q. Cadmium toxicity induces ER stress and apoptosis via impairing energy homoeostasis in cardiomyocytes. Biosci. Rep. 2015, 35, e00214. [Google Scholar] [CrossRef]
Gene | Forward Primer (5′-3′) | Reserve Primer (5′-3′) | Accession No. | Production Size (bp) |
---|---|---|---|---|
XBP-1 | TTACGAGAGAAAACTCATGGCC | GGGTCCAAGTTGTCCAGAATGC | NM_005080.3 | 283 |
BiP | CACGGTCTTTGACGCCAAG | CCAAATAAGCCTCAGCGGTTT | NM_005347.4 | 215 |
ATF4 | ATGACCGAAATGAGCTTCCTG | GCTGGAGAACCCATGAGGT | NM_182810 | 153 |
CHOP | GGAAACAGAGTGGTCATTCCC | CTGCTTGAGCCGTTCATTCTC | NM_001195055 | 116 |
β-actin | GTACCACTGGCATCGTGATGGACT | CCGCTCATTGCCAATGGTGAT | NM_001101.3 | 323 |
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations. |
© 2022 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Li, J.-Y.; Cui, D.-L.; Xie, Y.-M.; Su, J.-Z.; Zhang, M.-Y.; Niu, Y.-Y.; Xiang, P. Mechanisms of Cd-Induced Cytotoxicity in Normal Human Skin Keratinocytes: Implication for Human Health. Int. J. Mol. Sci. 2022, 23, 11767. https://doi.org/10.3390/ijms231911767
Li J-Y, Cui D-L, Xie Y-M, Su J-Z, Zhang M-Y, Niu Y-Y, Xiang P. Mechanisms of Cd-Induced Cytotoxicity in Normal Human Skin Keratinocytes: Implication for Human Health. International Journal of Molecular Sciences. 2022; 23(19):11767. https://doi.org/10.3390/ijms231911767
Chicago/Turabian StyleLi, Jing-Ya, Dao-Lei Cui, Yu-Mei Xie, Jin-Zhou Su, Meng-Yan Zhang, You-Ya Niu, and Ping Xiang. 2022. "Mechanisms of Cd-Induced Cytotoxicity in Normal Human Skin Keratinocytes: Implication for Human Health" International Journal of Molecular Sciences 23, no. 19: 11767. https://doi.org/10.3390/ijms231911767
APA StyleLi, J.-Y., Cui, D.-L., Xie, Y.-M., Su, J.-Z., Zhang, M.-Y., Niu, Y.-Y., & Xiang, P. (2022). Mechanisms of Cd-Induced Cytotoxicity in Normal Human Skin Keratinocytes: Implication for Human Health. International Journal of Molecular Sciences, 23(19), 11767. https://doi.org/10.3390/ijms231911767