Next Article in Journal
The Flavonol Quercitrin Hinders GSK3 Activity and Potentiates the Wnt/β-Catenin Signaling Pathway
Next Article in Special Issue
Improvement of Seed Germination under Salt Stress via Overexpressing Caffeic Acid O-methyltransferase 1 (SlCOMT1) in Solanum lycopersicum L.
Previous Article in Journal
Physiological and Transcriptomic Analyses Uncover the Reason for the Inhibition of Photosynthesis by Phosphate Deficiency in Cucumis melo L.
Previous Article in Special Issue
Exogenous Melatonin Reprograms the Rhizosphere Microbial Community to Modulate the Responses of Barley to Drought Stress
 
 
Search for Articles:
Title / Keyword
Author / Affiliation / Email
Journal
Article Type
 
 
Advanced Search
 
Section
Special Issue
Volume
Issue
Number
Page
 
Journals
IJMS
Volume 23
Issue 20
10.3390/ijms232012075
ijms-logo
Submit to this Journal Review for this Journal Propose a Special Issue
► Article Menu

Article Menu

share Share announcement Help format_quote Cite question_answer Discuss in SciProfiles thumb_up
...
Endorse textsms
...
Comment
first_page
settings
Order Article Reprints
Font Type:
Arial Georgia Verdana
Font Size:
Aa Aa Aa
Line Spacing:
Column Width:
Background:
Article

Melatonin Enhances Drought Tolerance in Rice Seedlings by Modulating Antioxidant Systems, Osmoregulation, and Corresponding Gene Expression

by
Chengke Luo
1,*,
Weifang Min
1,
Maryam Akhtar
2,
Xuping Lu
1,
Xiaorong Bai
1,
Yinxia Zhang
1,
Lei Tian
1 and
Peifu Li
1
1
School of Agriculture, Ningxia University, Yinchuan 750021, China
2
College of Life Sciences, Northwest Normal University, Lanzhou 730070, China
*
Author to whom correspondence should be addressed.
Int. J. Mol. Sci. 2022, 23(20), 12075; https://doi.org/10.3390/ijms232012075
Submission received: 5 September 2022 / Revised: 30 September 2022 / Accepted: 6 October 2022 / Published: 11 October 2022
(This article belongs to the Special Issue The Role of Melatonin in Plants)
Browse Figures
Review Reports Versions Notes

Abstract

:
Rice is the third largest food crop in the world, especially in Asia. Its production in various regions is affected to different degrees by drought stress. Melatonin (MT), a novel growth regulator, plays an essential role in enhancing stress resistance in crops. Nevertheless, the underlying mechanism by which melatonin helps mitigate drought damage in rice remains unclear. Therefore, in the present study, rice seedlings pretreated with melatonin (200 μM) were stressed with drought (water potential of −0.5 MPa). These rice seedlings were subsequently examined for their phenotypes and physiological and molecular properties, including metabolite contents, enzyme activities, and the corresponding gene expression levels. The findings demonstrated that drought stress induced an increase in malondialdehyde (MDA) levels, lipoxygenase (LOX) activity, and reactive oxygen species (ROS, e.g., O2− and H2O2) in rice seedlings. However, the melatonin application significantly reduced LOX activity and the MDA and ROS contents (O2− production rate and H2O2 content), with a decrease of 29.35%, 47.23%, and (45.54% and 49.33%), respectively. It activated the expression of ALM1, OsPOX1, OsCATC, and OsAPX2, which increased the activity of antioxidant enzymes such as superoxide dismutase (SOD), peroxidase (POD), catalase (CAT), and ascorbate peroxidase (APX), respectively. Meanwhile, the melatonin pretreatment enhanced the proline, fructose, and sucrose content by inducing OsP5CS, OsSUS7, and OsSPS1 gene expression levels. Moreover, the melatonin pretreatment considerably up-regulated the expression levels of the melatonin synthesis genes TDC2 and ASMT1 under drought stress by 7-fold and 5-fold, approximately. These improvements were reflected by an increase in the relative water content (RWC) and the root-shoot ratio in the drought-stressed rice seedlings that received a melatonin application. Consequently, melatonin considerably reduced the adverse effects of drought stress on rice seedlings and improved rice’s ability to tolerate drought by primarily boosting endogenous antioxidant enzymes and osmoregulation abilities.

1. Introduction

In recent years, the phenomenon of drought stress has become more prominent due to global warming. Drought limits the growth and development of crops, hence affecting agriculture’s sustainable development. It is estimated that crop yield losses typically range from 30% to 90% under drought conditions [1,2]. Drought affects all aspects of a plant’s lifecycle. For instance, drought stress accelerates the aging process of plant leaves, causes chlorophyll to degrade faster, and reduces photosynthesis. This process produces an excessive accumulation of reactive oxygen species (ROS) in plants, which in turn causes oxidative damage to cell membranes, essential enzymes, proteins, and nucleic acids [1,3]. Therefore, it is crucial to balance ROS generation and scavenging under drought stress for normal plant growth and development. In particular, to successfully slow down ROS damage and preserve cellular redox equilibrium during the physiological response to drought, plants have developed a variety of morphological, physiological-biochemical, and molecular mechanisms [4].
Plants primarily activate enzymatic and non-enzymatic antioxidant mechanisms to remove an excessive accumulation of ROS. Superoxide dismutase (SOD), peroxidase (POD), catalase (CAT), ascorbate peroxidase (APX), glutathione peroxidase (GPX), and glutathione reductase (GR) are some of the antioxidant enzymes found in antioxidant systems. However, ascorbic acid (AsA), glutathione (GSH), carotenoids (Car), mannitol, anthocyanin, and alkaloids are the principal non-enzymatic antioxidants [5]. Plants have an activated intrinsic defense mechanism that begins to function only at a particular level of abiotic stress, such as drought stress [6]. Some exogenous chemical substances have been used in plants to reduce the adverse consequences of drought stress and successfully increase plant drought tolerance and adaptability. These chemical substances include osmoprotectants (e.g., glycinebetaine), antioxidants (e.g., glutathione), and plant growth regulators (e.g., melatonin). They play vital roles in reducing the adverse effects of drought stress and enhancing plant drought tolerance and adaptability [7,8,9].
Melatonin (MT), a growth regulator, has demonstrated significant potential for improving plant drought resistance [10]. Since 1995, melatonin has gained recognition as an effective strategy to increase crop tolerance against biotic and abiotic stresses, including drought, salt, low temperatures, high temperatures, heavy metals, nutritional deficiencies, and diseases [6,11,12]. For instance, melatonin pretreatment improved the tolerance of rice (Oryza sativa L.) to salt stress, because it increased rice’s dry and fresh weight while minimizing cell membrane damage [12]. Exogenous melatonin also effectively promoted cucumber (Cucumis sativus L.) seed germination under salt and water stresses [13,14]. In wheat (Triticum aestivum L.), a melatonin foliar spray reduced the damage caused by drought stress through increasing the antioxidant capacity, photosynthetic rate, and maximum efficiency of photosystem II (Fv/Fm) [1].
Under drought stress, melatonin application enhanced CAT, POD, SOD, and APX activities in maize (Zea mays L.) [15], buckwheat (Fagopyrum tataricum L.) [16], sage (Salvia japonica Thunb.) [17], and rapeseed [18]. Correspondingly, melatonin pretreatment upregulated the expression levels of these enzyme genes in chicory (Cichorium intybus L.), which may be the underlying molecular mechanism by which melatonin regulates enzyme activity [19]. Plant cell homeostasis is also controlled by the ascorbic acid-glutathione (AsA-GSH) cycle, which is directly mediated by melatonin [20,21]. For instance, as per the already published literature, melatonin reduced drought-induced leaf senescence in ‘Hanfu’ apple trees (Malus domestica Borkh.) by regulating the AsA-GSH cycle [21]. Tomato (Lycopersicon esculentum Mill.) seedlings treated with melatonin had increased GR production under drought stress [20]. As one of the antioxidant enzymes, GR has been proven to be involved in regulating the AsA-GSH cycle synergistically. Melatonin can increase chloroplast GR activity to maintain AsA homeostasis in drought-stressed plants [17]. Additionally, during drought stress, melatonin pretreatment increased the content of osmoregulatory components such as proline, soluble sugar, and soluble protein in soybean (Glycine max L.) [22].
Rice is the most water-consuming crop in many countries and regions. It uses 2-3 times more water than any other cereal [23,24]. Due to its high sensitivity to drought stress, rice production will inevitably be adversely affected by water shortages [25]. Therefore, increasing rice’s ability to withstand drought stress is crucial. As noted previously, exogenous melatonin treatment can successfully improve plant drought stress tolerance, mainly by promoting antioxidant systems [15,16,17]. Despite these results, it is largely unclear whether melatonin has a common or different mechanism for regulating plant tolerance. Its specific regulatory mechanism for the response of rice to drought stress is still unknown. In order to reveal the physiological and molecular mechanisms of how melatonin controls the response of rice to drought stress, rice seedlings’ physiological and molecular features, such as its ROS metabolism, antioxidant system, osmoregulatory substance accumulation and the corresponding gene expression, and melatonin synthesis gene expression, were examined under four treatments (control (CK), melatonin (CM), drought (DC), and melatonin plus drought (DM)). This study offers valuable insights into clarifying how melatonin improves rice’s drought tolerance.

2. Results

2.1. Melatonin-Dependent Improvement in the Growth Indices of Rice Seedlings under Drought Stress

As shown in Figure 1, there was no significant difference in the performance of rice seedlings sprayed with exogenous melatonin in both the CM treatment and the control (CK) under normal conditions (Figure 1A, top), which was reflected in the fact that the RWC did not differ between CM and CK (Figure 1B). In contrast, the drought-stressed rice seedlings showed extensive regions of leaf yellowing and withering, and fewer rice leaves stayed green in the DC treatment (Figure 1A, bottom left). The RWC and the root-shoot ratio of the drought-stressed rice seedlings in the DC treatment decreased by 24.03% and 14.38%, respectively, compared to the regular growing rice seedlings in CK (Figure 1B,C). However, these two growth indices of drought-stressed rice seedlings pretreated with exogenous melatonin in the DM treatment were substantially higher than those of drought-stressed rice seedlings in the DC treatment (Figure 1B,C), with an increase of 23.54% and 36.88%, respectively, demonstrating the effectiveness of exogenous melatonin at alleviating damaged leaves and maintaining more green leaves on the rice seedlings under drought stress (Figure 1A, bottom right).

2.2. Melatonin-Dependent Improvement in the Lipid Peroxidation and ROS Content of Rice Seedling Leaves under Drought Stress

Spaying melatonin did not alter the LOX activity, O2− production rate, or MDA content of the leaves of rice seedlings in the CM treatment under normal circumstances (Figure 2A,C,D), except for a reduction in the H2O2 content (with a decrease of 40.19%) compared to CK (Figure 2B). However, drought stress significantly increased the levels of LOX activity, ROS (O2− and H2O2) accumulation, and the MDA of rice seedling leaves in the DC treatment compared to that of CK, with an increase of 3.09-fold, 2.26-fold, 1.30-fold, and 2.38-fold, respectively (Figure 2A–D), which caused damage to the seedlings. An exogenous melatonin application significantly reduced the LOX activity, O2− production rate, H2O2 content, and MDA content of drought-stressed leaves in the DM treatment compared to that of the DC treatment, with a decrease of 29.35%, 45.54%, 49.33%, and 47.23%, respectively (Figure 2A–D), indicating that exogenous melatonin could mitigate the damage brought on by drought stress.

2.3. Melatonin-Dependent Improvement in the Antioxidant Enzyme Activity of Rice Seedling Leaves under Drought Stress

As shown in Figure 3, melatonin pretreatment significantly increased the SOD, POD, and CAT activities of rice seedling leaves in the CM treatment compared to CK under normal conditions, with increases of 2.68-fold, 1.10-fold, and 3.81-fold, respectively (Figure 3A–C), except for no obvious change in APX activity (Figure 3D). Furthermore, the activities of four antioxidant enzymes (SOD, POD, CAT, and APX) of rice seedling leaves were significantly higher in the DC treatment under drought stress compared to those in the CK treatment, with increases of 3.27-fold, 1.09-fold, 6.05-fold, and 1.39-fold, respectively (Figure 3A–D). Notably, an exogenous melatonin application further improved the antioxidant enzyme activities of drought-stressed rice seedling leaves in the DM treatment compared to those of the DC treatment, with increases of 27.62%, 24.41%, 18.47%, and 58.18%, respectively (Figure 3A–D), which aided in reducing the harm caused by excessive ROS to rice seedlings under drought stress.

2.4. Melatonin-Dependent Improvement in the Content of AsA and DHA of Rice Seedling Leaves under Drought Stress

Compared to CK, the melatonin pretreatment considerably increased the AsA content by 30.47% (Figure 4A), but did not affect the DHA content or the AsA/DHA ratio in the CM treatment (Figure 4B,C). Drought stress increased the DHA content by 11.38-fold (Figure 4B) and decreased the AsA/DHA ratio by 92.59% (Figure 4C), but it did not affect the AsA content of rice seedling leaves in the DC treatment compared to CK (Figure 4A). Unexpectedly, the exogenous melatonin application did not increase the ascorbic acid content, as evidenced by a reduction in the DHA content and the lack of apparent changes in the ascorbic acid content and AsA/DHA ratio of the drought-stressed leaves in the DM treatment compared to that of the DC treatment (Figure 4A–C). This suggests that ascorbic acid did not play a significant role in melatonin’s ability to relieve rice’s drought stress.

2.5. Melatonin-Dependent Improvement in the Proline, Sucrose, and Fructose Contents of Rice Seedling Leaves under Drought Stress

Proline is a perfect osmotic regulator, and it may also be employed in vivo as an oxidant, a membrane and enzyme protector, and a free radical scavenger. In plants, sucrose and fructose are essential energy sources, signaling molecules, and osmolytes. Figure 5 demonstrates that under typical growth conditions, spraying melatonin did not significantly change the rice seedling leaves’ proline, sucrose, or fructose levels in the CM treatment compared to CK. Under drought stress, the proline, sucrose, and fructose levels of rice seedling leaves significantly increased by 5.37-fold, 4.11-fold, and 1.27-fold, respectively, in the DC treatment compared to the CK treatment. Additionally, compared to CK, these three chemical concentrations were respectively enhanced by 1.76-fold, 2.19-fold, and 0.62-fold in drought-stressed rice seedling leaves pretreated with melatonin in the DM treatment (Figure 5A–C).

2.6. Melatonin-Dependent Improvement in the Expression Levels of Genes Encoding Physiological and Biochemical Substances of Rice Seedling Leaves under Drought Stress

One of the LOX synthesis genes, OsLOX1, three osmotic adjustment-related genes, OsP5CS, OsSUS7, and OsSPS1, and five antioxidant system-related genes, ALM1, OsPOX1, OsCATC, OsAPX2, and OsVTC1-1, were chosen and checked in rice seedling leaves under various treatments. As shown in Figure 6, an exogenous melatonin pretreatment did not alter the gene expression levels of OsLOX1, OsP5CS, OsSUS7, or OsSPS1 in the CM treatment compared to CK. In contrast, drought stress dramatically increased these four gene expression levels in the DC treatment compared to CK, with an increase of 7.21-fold, 4.11-fold, 0.31-fold, and 0.20-fold, respectively. In response to drought stress, the melatonin application increased the expression of OsP5CS, OsSUS7, and OsSPS1 by 73.21%, 31.26%, and 20.34%, respectively, in the DM treatment compared to in DC. However, the OsLOX1 transcriptional level was unaffected by the melatonin application, which contradicts the decrease in LOX activity in the DM treatment compared to DC (Figure 6), indicating that OsLOX1 may not be an essential gene regulating LOX synthesis.
SOD, POD, CAT, and APX are synthesized by the genes ALM1, OsPOX1, OsCATC, and OsAPX2, respectively. GDP-D-mannose pyrophosphorylase (GMPase), which is involved in the synthesis of AsA in rice leaves, is encoded by the gene OsVTC1-1. As can be observed from Figure 7, in comparison to CK, exogenous melatonin (CM treatment) and drought stress (DC treatment) clearly increased the gene expression levels of ALM1, OsPOX1, and OsCATC by 3.23~7.02-fold, 0.91~1.78-fold, and 2.38~2.95-fold, respectively. Drought stress (DC treatment) or exogenous melatonin (CM treatment) also significantly increased the gene expression levels of the OsAPX2 and OsVTC1-1 genes by 8.33-fold and 2.98-fold, respectively. The transcriptional levels of these five genes considerably increased in the DM treatment compared to the DC treatment, with an increase of 0.75-fold, 1.38-fold, 2.38-fold, 0.93-fold, and 4.68-fold, respectively, indicating that exogenous melatonin efficiently controls the antioxidant system by increasing the related gene expression levels in rice under drought stress.

2.7. Melatonin-Dependent Improvement in the Expression Levels of Endogenous Melatonin Biosynthesis-Related Genes of Rice Seedling Leaves under Drought Stress

It is now understood that melatonin is a signaling molecule. To investigate the effect of exogenous melatonin on the expression of the endogenous melatonin synthetase genes of rice seedling leaves under drought stress, two crucial rate-limiting enzyme genes, TDC2 and ASMT1, were analyzed under various conditions in the melatonin synthesis pathway. The findings demonstrated that, compared to CK, exogenous melatonin (CM treatment) and drought stress (DC treatment) considerably increased the TDC2 and ASMT1 gene expression levels by 7-fold and 5-fold, approximately. Exogenous melatonin application significantly enhanced the transcriptional levels of these two genes in the DM treatment compared to the DC treatment, with an increase of 1.28-fold and 0.95-fold, particularly under drought stress (Figure 8), indicating that exogenous melatonin did indeed upregulate the expression levels of endogenous melatonin synthetase genes.

2.8. Correlation Analysis between Melatonin Biosynthesis-Related Genes and Antioxidant Enzyme Synthesis Genes

Exogenous melatonin also functions as an antioxidant to protect plants against intrinsic oxidative stress and drought. Gene expression levels were used to evaluate the link between the two to investigate the correlation between genes involved in melatonin biosynthesis and those synthesizing antioxidant enzymes under drought stress. The outcomes showed that the R2 values between TDC2 and the genes that make antioxidant enzymes (ALM1, OsPOX1, OsCATC, and OsAPX2) were, respectively, 0.919, 0.797, 0.876, and 0.753 (Figure 9A). Similar to this, there was a higher R2 value between ASMT1 and the genes that make antioxidant enzymes (ALM1, OsPOX1, OsCATC, and OsAPX2) (Figure 9B), indicating that every two genes between the genes related to melatonin biosynthesis and the genes that make antioxidant enzymes had a very significant positive correlation at the gene transcriptional levels under drought stress.

2.9. Construction of A Regulatory Model for Mitigating Effect of Exogenous Melatonin on Rice Seedlings under Drought Stress

We concluded that exogenous melatonin regulated the drought stress tolerance in rice according to the above research results. In-depth summaries of the intracellular physiological and biochemical alterations, changes in gene expression levels, and individual morphological changes associated with melatonin’s alleviation of drought stress in rice are provided (Figure 10).
The degradation of physiological and biochemical regulatory mechanisms in cells causes severe damage to the cell membrane under extreme drought stress, excessive ROS and NOS production accumulation, nucleic acid and protein degradation, increased MDA content, etc. This eventually results in cell death. Several defensive signaling cascades are often engaged when drought stresses plants, which further causes changes in gene expression and adjustments to the protein and energy metabolism in cells that have received stress signals. In this study, drought stress accelerated O2− production, increased H2O2 and MDA content, and increased LOX activity, which caused rice seedlings to endure oxidative damage and membrane lipid peroxidation (Figure 10). In order to reduce oxidative stress and preserve the integrity of the cell membrane as much as possible, the stressed rice seedlings activated their antioxidant defense systems at this moment by upregulating the expression levels of antioxidant enzyme synthesis genes (ALM1, OsPOX1, OsCATC, and OsAPX2) and increasing the activity of antioxidant enzymes (SOD, POD, CAT, and APX) (Figure 10). Additionally, in stressed rice seedlings, osmolyte-like proline was accumulated by the upregulation of OsP5CS expression levels, and the content of energy metabolites such as sucrose and fructose was increased by the induction of OsSUS7 and OsSPS1 gene expression levels. These actions functioned to provide energy and maintain cell turgor pressure for plant growth (Figure 10).
TDC2 and ASMT1 gene expressions related to melatonin biosynthesis were significantly enhanced when exogenous melatonin was pretreated in rice seedling leaves under drought stress, resulting in increased levels of endogenous melatonin in rice cells. Endogenous melatonin increased the SOD, POD, CAT, and APX activities and the amounts of their respective genes’ in vivo expression (ALM1, OsPOX1, OsCATC, and OsAPX2) to either directly eliminate ROS by interacting with ROS, or indirectly scavenge ROS (Figure 10). The endogenous melatonin may then regulate the decline of membrane lipid peroxidation markers, such as LOX activity and MDA content, and further increase the proline, sucrose, and fructose accumulation by upregulating the expression levels of OsP5CS, OsSUS7, and OsSPS1 genes in rice cells during drought stress (Figure 10). All of these might be the results of the physiological and biochemical alterations in vivo generated by the application of exogenous melatonin during drought stress and regulated by endogenous melatonin.

3. Discussion

Drought stress stunts plant growth by disrupting rice’s physiological metabolism and natural morphological structure [26]. As a versatile biomolecule, melatonin regulates physiological and biochemical processes, thereby improving the plant’s phenotype under drought stress [6]. A previous report showed that exogenous melatonin might boost soybean leaves’ RWC and increase their ability to withstand drought stress throughout their growth [27]. This study illustrated that rice seedlings displayed yellowing and wilting of leaves under drought stress, which was reflected by a reduced RWC and root-shoot ratio. Interestingly, exogenous melatonin relieved the drought stress in rice seedlings by turning the originally yellowing and wilting leaves back to green, and by increasing the leaves’ RWC and the root-shoot ratio. Similar findings were also verified in drought-stressed cotton (Gossypium hirsutum L.) [28] and potato (Solanum tuberosum L.) [29].
Drought stress disrupts the immune system’s natural ROS scavenging mechanism, which results in excessive ROS accumulation and lipid peroxidation, damaging cell membranes. Eventually, it impacts the growth and development of plants [30,31]. Our findings demonstrated that LOX activity, ROS (O2− and H2O2), and MDA content considerably increased in rice seedling leaves under drought stress. Similar to our findings, Qi et al. [32] and Laxa et al. [33] found that the O2− production rate and H2O2 content of plants increased during extreme drought stress, resulting in higher MDA content and an increase in membrane permeability. Several studies have shown that exogenous melatonin plays a vital role in reducing lipid peroxidation and reactive oxygen species in plants under abiotic stress [34,35]. For instance, after salt stress, applying exogenous melatonin could reduce ROS and MDA levels in cotton seedlings [34]. Qi et al. also found that exogenous melatonin reduced the level of membrane lipid peroxidation and protected the integrity of membrane lipids under high-temperature stress, inhibiting the MDA and ROS contents of chrysanthemum (Chrysanthemum morifolium ‘Jinba’), which improved the plant’s resistance to high-temperature stress [35]. This study also demonstrated a reduction in the LOX activity, ROS (O2− and H2O2), and MDA levels after applying exogenous melatonin under drought stress, thus reducing membrane lipid peroxidation in rice seedling leaves. Both prior research and our study indicated that an exogenous melatonin application might successfully reduce the oxidative damage caused by drought stress, increasing the drought stress tolerance of rice.
Under typical circumstances, intracellular ROS are dynamically balanced and maintained at a lower level [31]. However, abiotic stress on plants disrupts the dynamic equilibrium of ROS in vivo, accumulating an excessive amount of ROS and cell membrane oxidative damage and ultimately resulting in oxidative stress [36]. At this time, plants start their antioxidant defense systems, including the production of enzymatic and non-enzymatic antioxidants, to eliminate excessive ROS [5]. Studies have shown that melatonin application certainly improves the ability of antioxidant defense systems to resist oxidative stress caused by abiotic stress [34,37]. For example, melatonin significantly increased the CAT, SOD, POD, and APX antioxidant enzyme activities in cotton roots, successfully slowing down the damage induced by salt stress and eventually improving salt tolerance in cotton seedlings [34]. Zhang et al. observed that exogenous melatonin promoted the accumulation of AsA and GSH in sugar beets (Beta vulgaris L.) under salt stress, in which the AsA-GSH cycle could operate swiftly and efficiently under the salt stress and sustain high antioxidant properties [37]. This study showed that exogenous melatonin dramatically upregulated the expression levels of the ALM1, OsPOX, OsCATC, and OsAPX2 genes, improving the activities of the antioxidant enzymes CAT, SOD, POD, and APX, respectively. Consequently, exogenous melatonin relieved drought stress in rice seedlings by primarily strengthening enzymatic antioxidant systems rather than non-enzymatic antioxidants (AsA and DHA), which was somewhat different from our earlier research on the physiological mechanisms of exogenous melatonin alleviating alkaline stress tolerance in rice [38].
Proline and soluble sugars (such as sucrose and fructose) were accumulated in plant cells under drought stress and serve as osmolytes to maintain and protect plant macromolecules and structures from stress injury, eventually increasing the plant’s tolerance to drought stress [39,40]. A previous report showed that under salt stress, the application of 20 μM melatonin might accelerate the accumulation of osmotic compounds (such as proline and soluble sugars) in cotton seeds, improving the tolerance of seed germination to salt stress [41]. Our previous study indicated that exogenous melatonin increased the proline content while decreasing the sucrose and fructose levels in alkaline-stressed rice seedlings, which suggested that exogenous melatonin improved the alkaline tolerance by accumulating proline rather than sucrose and fructose in rice [38]. In the presented study, the application of exogenous melatonin increased the proline accumulation by activating OsP5CS gene expression and increasing the sucrose and fructose contents by upregulating the expression levels of the OsSUS7 and OsSPS1 genes in rice seedling leaves under drought stress. This finding suggests that melatonin may mediate the related metabolism of osmotic substances (proline, sucrose, and fructose), ultimately improving the drought tolerance of rice seedlings.
Melatonin is regarded as a highly effective ROS scavenger and signaling molecule. Our findings first demonstrated that exogenous melatonin increased the expression levels of the melatonin synthesis genes TDC2 and ASMT1 (Figure 8). The increased expressions of these two genes likely contributed to the increased production of endogenous melatonin in rice. It is well known that melatonin scavenges too much ROS in two ways. One is that melatonin can interact with ROS directly to eliminate ROS. Garcia et al. estimated that one melatonin molecule might continuously interact with eight or more ROS molecules to maintain the optimal balance of ROS production to ROS scavenging [42]. In the current study, an exogenous melatonin pretreatment dramatically reduced the O2− production rate and H2O2 content in rice seedling leaves under drought stress, which was likely because the absorbed and newly synthesized melatonin directly interacted with ROS to remove a fraction of the ROS, thus decreasing the O2− and H2O2 contents in rice.
As per an alternative way of ROS scavenging by melatonin, melatonin effectively reduces the accumulation of ROS by regulating the activity of antioxidant enzymes and the corresponding gene expression levels [43]. In this study, the application of exogenous melatonin enhanced SOD, POD, and CAT activities via regulating the expression levels of ALM1, OsPOX1, and OsCATC. The elevated antioxidant enzyme activities then scavenged ROS in rice seedling leaves under drought stress conditions, demonstrating that melatonin had an indirect role in eliminating ROS by activating antioxidant enzymes [44]. Additionally, based on the gene expression levels between melatonin synthesis genes (TDC2 and ASMT1) and antioxidant enzyme synthesis genes (ALM1, OsPOX1, OsCATC, and OsAPX2), a substantial positive correlation between melatonin and antioxidant enzymes was established (Figure 7 and Figure 8). These findings reflect convectively on the hypothesis that melatonin scavenged ROS directly or indirectly via activating antioxidant enzymes, which is consistent with prior observations of melatonin [19,38].

4. Materials and Methods

4.1. Plant Materials and Growth Conditions

Zhonghua 11 (Oryza sativa L. cv. ‘Zhonghua No. 11’) variety of rice seeds that were full and uniform in size were washed with distilled water 5-6 times, disinfected with 15% NaClO for 30 min, and then dried with a filter paper. After five days of germination, the plantlets from the sterilized rice seeds were transferred to 96-well PCR plates with the bottoms of the tubes cut off. Afterward, the plantlets were grown in a greenhouse with rice nutrient solution under the following growth conditions: 28 °C/25 °C (day/night) and a 14/10 h (day/night) photoperiod. The nutrition solution was replenished every three days. The seedlings underwent experimental procedures after 21 days of growth.

4.2. Experimental Design of Melatonin and Drought Stress Treatments

Melatonin (200 μM) was estimated to be the ideal treatment concentration for the phenotype of drought stress reduction, referring to our previous research [38]. The water potential under drought stress was set at −0.5 MPa, calculated using Michel’s formulae, and the drought stress was simulated using PEG-6000. The equation is as follows:
Ψs = −(1.18 × 10−2) C − (1.18 × 10−4) C2 + (2.67 × 10−4) CT+ (8.39 × 10−7) C2T
where Ψs refers to the water potential of the solution (bar), 1 bar = 0.1 MPa, C refers to the concentration of the PEG-6000 solution (g∙kg−1), and T refers to the temperature (°C).
Rice seedlings of uniform size, barely matured around 21 days, were chosen for 4 treatments. As seen in Figure 11, the following treatments were used on seedlings: (1) CK: seedlings were sprayed with double distilled water (ddH2O) on foliage without receiving a drought stress treatment; (2) CM: seedlings were sprayed with melatonin on foliage without drought stress treatment; (3) DC: seedlings were sprayed with ddH2O on foliage for three days and then received a drought stress treatment; and (4) DM: seedlings were treated with drought stress after being sprayed with melatonin on foliage for three days. Forty-eight plants were used in each of the four replicates for each treatment. For 7 days, either a regular nutrient solution (CK and CM) or a nutrient solution with PEG-6000 (DC and DM) was used to grow all stressed seedlings. Leaf samples from these treatments were then collected and stored at −80 °C for later use.

4.3. Measurement of Morphological and Physiological Indices

4.3.1. Determination of Relative Water Content and Root–Shoot Ratio

Three seedlings were chosen at random, and their leaves were clipped off. These leaves were weighed for their fresh weight (FW) and then immediately immersed in test tubes with deionized water. After 24 h, the wet leaves immediately lost their water content. At this point, the leaves’ swelling weight (TW) was calculated. The leaves were then weighed as dry weight after being dried to a consistent weight at 70 °C (DW). The following equation was used to calculate the relative water content:
RWC: RWC (%) = [(FW-DW)/(TW-DW)] × 100%
Fifteen seedlings from each treatment were harvested for their cut roots and shoots. They were weighed after being dried to a consistent weight at 70 °C. The root DW to shoot DW ratio was used to represent the root-shoot ratio.

4.3.2. Determination of Lipid Peroxidation and Reactive Oxygen Species Contents

As previously described, the MDA content was assessed using the thiobarbituric acid technique [38]. The O2− production rate was calculated using the p-aminobenzene sulfonic acid method. Briefly, 0.2 g of rice leaf samples were homogenized with 65 mmol L−1 of phosphate buffer (PBS, pH 7.8) and centrifuged at 5000× g for 15 min at 4 °C. Then, 0.5 mL 10 mM hydrochloride, and 65 mM phosphate buffer were mixed with the supernatant and placed for 1 h. Subsequently, the above mixture was added with 17 mM p-aminobenzene sulfonamide and 7 mM α-theanine and incubated for 20 min. The absorbance of the supernatant was detected at 530 nm. The H2O2 content was obtained using the potassium iodide method. Briefly, 0.2 g of homogenized sample was mixed with ammonia, 20% TiCl4, and 95% hydrochloric acid and centrifuged at 10,000× g for 10 min at 4 °C. After repeatedly washing with acetone, the precipitate was dissolved with 2 mM H2SO4. The supernatant′ absorbance was measured at 410 nm.
The LOX activity was determined according to a previous study [45]. Briefly, 0.1 g of a rice leaf sample was homogenized with 5 mM sodium phosphate buffer (pH 7.5), 10 mM EDTA, 0.1% Triton X-100, and 5 mM β-mercaptoethanol and centrifuged at 4 °C and 16,000× g for 10 min. Then, the supernatant was added to 50 mM sodium phosphate buffer (pH 7.5), including 0.6 mM substrate (α-linolenic acid, dissolved in 100% ethanol). The absorbance was determined at 234 nm.

4.3.3. Activity Assays of Antioxidant Enzyme

The crude enzyme solution was extracted using the Niu et al. technique [46]. Referring to the method of Li et al. [47], the SOD activity was measured using nitrogen blue tetrazolium as follows: The supernatant was added to a 3 mL reaction solution including 1.3 μM riboflavin, 13 mM methionine, 63 μM NBT, 0.1 mM EDTA, and a 50 mM PBS (pH 7.8) to undergo a chemical reaction at 30 °C for 15 min. The resulting solution was used to measure the SOD activity at 560 nm. The enzyme extract was reacted with a mixture of 20 mM guaiacol, 40 mM H2O2, and 100 mM PBS (pH 6.0) for the POD activity using the guaiacol method at 460 nm. The CAT activity was determined using a UV colorimetric method: the enzyme extract was added to a reaction solution containing 30% H2O2 and 0.15 M PBS (pH 7.8) to generate a solution to estimate the CAT activity at 240 nm.

4.3.4. Analysis of AsA and DHA Content

The reduced ascorbic acid (AsA) and dehydroascorbic acid (DHA) contents were determined using our previous approach [38]. For AsA, the homogenized samples from 0.5 g of fresh rice leaf were mixed with 6% trichloroacetic acid (TCA, w/v) and were centrifuged at 16,000× g for 10 min at 4 °C. The supernatant was added with 200 mM PBS (pH 7.4), 10% TCA, 42% phosphoric acid (H3PO4), 4% 2,2′-bipyridine, and 3% ferric chloride under a water bath of 42 °C for 60 min. The absorbance at 525 nm was recorded. The DHA content was obtained by subtracting the AsA content from the total ascorbic acid content. For the total ascorbic acid, the supernatant was added to 6 mM dithiothreitol (DTT) and incubated for 15 min at 42 °C, followed by adding 0.4% N-ethylmaleimide (NEM), and then the solution was placed at 25 °C for 2 min. After that, the above reaction was mixed with 200 mM PBS (pH 7.4), 10% TCA, 42% phosphoric acid, 4% 2,2′-bipyridine, and 3% ferric chloride and incubated for 60 min at 42 °C. The absorbance was measured at 525 nm.

4.3.5. Measurement of Free Proline, Sucrose, and Fructose Contents

The acidic ninhydrin colorimetric technique was used to measure the free proline concentration [48]. The sucrose and fructose contents were extracted using the Rosa et al. approach. The cardini et al. method was used to quantify the sucrose [49], while the Rosa et al. method was used to measure the fructose [48].

4.3.6. Gene Expression Analysis

Using the Plant RNA Kit (TaKaRa, Dalian, China) and following the manufacturer’s instructions, the total RNA was isolated from leaf samples. The qualified total RNA was digested with gDNA Eraser (TaKaRa, Dalian, China) to eliminate genomic DNA. The PrimeScriptTM RT reagent kit (TaKaRa, Dalian, China) was then used to create the first-strand complementary DNA (cDNA) from the treated total RNA. According to the manufacturer’s instructions, qRT-PCR was carried out with a qTOWER3G Real-Time PCR System (Analytik Jena AG, Jena, Germany) using TB Green® Premix Ex Taq™ II reagent (TaKaRa, Dalian, China). The experiment was replicated three times. The rice OsActin gene (LOC_Os03g50885) was used as the internal control. Based on the preceding techniques, the relative expression levels of the target genes were calculated [50]. The details of each gene-specific primer are presented in Table 1 and were taken from our previous study [38].

4.4. Statistical Analysis

Data for various experiments were statistically tested using SPSS 25.0 (IBM, Armonk, NY, USA) with a one-way analysis of variance (ANOVA).

5. Conclusions

Drought decreased the growth indices of RWC and the root-shoot ratio. However, it increased the ROS (O2− and H2O2), MDA content, LOX activity, antioxidant enzyme (SOD, POD, CAT, and APX) activities, and osmolyte (proline, sucrose, and fructose) contents in rice seedlings, resulting in oxidative and osmotic stress. Exogenous melatonin up-regulated the melatonin synthesis gene (TDC2 and ASMT1) expression. It activated antioxidant enzyme synthesis and osmotic substance accumulation to scavenge excessive ROS. It helped maintain cell turgor pressure, alleviating drought-stress damage to rice seedlings and ultimately enhancing drought tolerance. Consistent with these improvements, under drought stress via melatonin application, the relative expression levels of ALM1, OsPOX1, OsCATC, OsAPX2, OsVTC1-1, OsLOX1, OsP5CS, OsSUS7, OsSPS1, TDC2, and ASMT1 were all up-regulated. These results increase our understanding of the melatonin regulation mechanism in rice during drought resistance.

Author Contributions

Conceptualization, C.L., W.M. and X.L.; methodology, W.M., X.L. and X.B.; formal analysis, C.L., W.M. and X.L.; investigation, C.L., W.M., X.L., X.B., Y.Z. and L.T.; resources, C.L., Y.Z., L.T. and P.L.; data curation, W.M. and X.L.; writing-original draft preparation, W.M., M.A. and X.L.; writing-review and editing, C.L., W.M. and M.A.; supervision, C.L., Y.Z., L.T. and P.L. All authors have read and agreed to the published version of the manuscript.

Funding

This work was supported by grants from the National Natural Science Foundation of China (32060425), the National Key Research & Development Program of China (2021YFD1900600), and the Agricultural Breeding Special Program of the Ningxia Province (2018NYYZ0302).

Acknowledgments

The authors are grateful to Xiaolong Kang and Chenglong Li (School of Agriculture, Ningxia University) for the making and typesetting of experimental pictures.

Conflicts of Interest

The authors declare no conflict of interest.

References

  1. Cui, G.; Zhao, X.; Liu, S.; Sun, F.; Zhang, C.; Xi, Y. Beneficial effects of melatonin in overcoming drought stress in wheat seedlings. Plant Physiol. Biochem. 2017, 118, 138–149. [Google Scholar] [CrossRef] [PubMed]
  2. Dietz, K.J.; Zorb, C.; Geilfus, C.M. Drought and crop yield. Plant Biol. 2021, 23, 881–893. [Google Scholar] [CrossRef] [PubMed]
  3. Demidchik, V. Mechanisms of oxidative stress in plants: From classical chemistry to cell biology. Environ. Exp. Bot. 2015, 109, 212–228. [Google Scholar] [CrossRef]
  4. Seleiman, M.F.; Al-Suhaibani, N.; Ali, N.; Akmal, M.; Alotaibi, M.; Refay, Y.; Dindaroglu, T.; Abdul-Wajid, H.H.; Battaglia, M.L. Drought Stress Impacts on Plants and Different Approaches to Alleviate Its Adverse Effects. Plants (Basel) 2021, 10, 259. [Google Scholar] [CrossRef]
  5. Hasanuzzaman, M.; Bhuyan, M.; Zulfiqar, F.; Raza, A.; Mohsin, S.M.; Mahmud, J.A.; Fujita, M.; Fotopoulos, V. Reactive Oxygen Species and Antioxidant Defense in Plants under Abiotic Stress: Revisiting the Crucial Role of a Universal Defense Regulator. Antioxidants 2020, 9, 681. [Google Scholar] [CrossRef]
  6. Tiwari, R.K.; Lal, M.K.; Kumar, R.; Chourasia, K.N.; Naga, K.C.; Kumar, D.; Das, S.K.; Zinta, G. Mechanistic insights on melatonin-mediated drought stress mitigation in plants. Physiol. Plant. 2021, 172, 1212–1226. [Google Scholar] [CrossRef]
  7. Nahar, K.; Hasanuzzaman, M.; Alam, M.M.; Fujita, M. Glutathione-induced drought stress tolerance in mung bean: Coordinated roles of the antioxidant defence and methylglyoxal detoxification systems. AoB Plants 2015, 7, plv069. [Google Scholar] [CrossRef] [Green Version]
  8. Niu, T.; Zhang, T.; Qiao, Y.; Wen, P.; Zhai, G.; Liu, E.; Al-Bakre, D.A.; Al-Harbi, M.S.; Gao, X.; Yang, X. Glycinebetaine mitigates drought stress-induced oxidative damage in pears. PLoS ONE 2021, 16, e251389. [Google Scholar] [CrossRef]
  9. Zhang, H.; Sun, X.; Dai, M. Improving crop drought resistance with plant growth regulators and rhizobacteria: Mechanisms, applications, and perspectives. Plant Commun. 2022, 3, 100228. [Google Scholar] [CrossRef]
  10. Sharma, A.; Zheng, B. Melatonin Mediated Regulation of Drought Stress: Physiological and Molecular Aspects. Plants 2019, 8, 190. [Google Scholar] [CrossRef]
  11. Dubbels, R.; Reiter, R.J.; Klenke, E.; Goebel, A.; Schnakenberg, E.; Ehlers, C.; Schiwara, H.W.; Schloot, W. Melatonin in edible plants identified by radioimmunoassay and by high performance liquid chromatography-mass spectrometry. J. Pineal Res. 1995, 18, 28–31. [Google Scholar] [CrossRef] [PubMed]
  12. Yan, F.; Wei, H.; Ding, Y.; Li, W.; Liu, Z.; Chen, L.; Tang, S.; Ding, C.; Jiang, Y.; Li, G. Melatonin regulates antioxidant strategy in response to continuous salt stress in rice seedlings. Plant Physiol. Biochem. 2021, 165, 239–250. [Google Scholar] [CrossRef] [PubMed]
  13. Zhang, H.; Zhang, N.; Yang, R.; Wang, L.; Sun, Q.; Li, D.; Cao, Y.; Weeda, S.; Zhao, B.; Ren, S.; et al. Melatonin promotes seed germination under high salinity by regulating antioxidant systems, ABA and GA4 interaction in cucumber (Cucumis sativus L.). J. Pineal Res. 2014, 57, 269–279. [Google Scholar] [CrossRef]
  14. Zhang, N.; Zhao, B.; Zhang, H.; Weeda, S.; Yang, C.; Yang, Z.; Ren, S.; Guo, Y. Melatonin promotes water-stress tolerance, lateral root formation, and seed germination in cucumber (Cucumis sativus L.). J. Pineal Res. 2013, 54, 15–23. [Google Scholar] [CrossRef] [PubMed]
  15. Alharby, H.F.; Fahad, S. Melatonin application enhances biochar efficiency for drought tolerance in maize varieties: Modifications in physio-biochemical machinery. Agron. J. 2020, 112, 2826–2847. [Google Scholar] [CrossRef]
  16. Hossain, M.S.; Li, J.; Sikdar, A.; Hasanuzzaman, M.; Uzizerimana, F.; Muhammad, I.; Yuan, Y.; Zhang, C.; Wang, C.; Feng, B. Exogenous Melatonin Modulates the Physiological and Biochemical Mechanisms of Drought Tolerance in Tartary Buckwheat (Fagopyrum tataricum L.) Gaertn. Molecules 2020, 25, 2828. [Google Scholar] [CrossRef] [PubMed]
  17. Bidabadi, S.S.; VanderWeide, J.; Sabbatini, P. Exogenous melatonin improves glutathione content, redox state and increases essential oil production in two Salvia species under drought stress. Sci. Rep. 2020, 10, 6883. [Google Scholar] [CrossRef] [Green Version]
  18. Khan, M.N.; Khan, Z.; Luo, T.; Liu, J.; Rizwan, M.; Zhang, J.; Xu, Z.; Wu, H.; Hu, L. Seed priming with gibberellic acid and melatonin in rapeseed: Consequences for improving yield and seed quality under drought and non-stress conditions. Ind. Crop. Prod. 2020, 156, 112850. [Google Scholar] [CrossRef]
  19. Sharma, A.; Wang, J.; Xu, D.; Tao, S.; Chong, S.; Yan, D.; Li, Z.; Yuan, H.; Zheng, B. Melatonin regulates the functional components of photosynthesis, antioxidant system, gene expression, and metabolic pathways to induce drought resistance in grafted Carya cathayensis plants. Sci. Total Environ. 2020, 713, 136675. [Google Scholar] [CrossRef]
  20. Liu, J.; Wang, W.; Wang, L.; Sun, Y. Exogenous melatonin improves seedling health index and drought tolerance in tomato. Plant Growth Regul. 2015, 77, 317–326. [Google Scholar] [CrossRef]
  21. Wang, P.; Sun, X.; Li, C.; Wei, Z.; Liang, D.; Ma, F. Long-term exogenous application of melatonin delays drought-induced leaf senescence in apple. J. Pineal Res. 2013, 54, 292–302. [Google Scholar] [CrossRef] [PubMed]
  22. Cao, L.; Jin, X.J.; Zhang, Y.X. Melatonin confers drought stress tolerance in soybean (Glycine max L.) by modulating photosynthesis, osmolytes, and reactive oxygen metabolism. Photosynthetica 2019, 57, 812–819. [Google Scholar] [CrossRef]
  23. Tuong, T.P.; Bouman, B.; Mortimer, M. More rice, less water—Integrated approaches for increasing water productivity in irrigated rice-based systems in Asia. Plant Prod. Sci. 2005, 8, 231–241. [Google Scholar] [CrossRef]
  24. Zhang, Q. Strategies for developing green super rice. Proc. Natl. Acad. Sci. USA 2007, 104, 16402–16409. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  25. Zu, X.; Lu, Y.; Wang, Q.; Chu, P.; Miao, W.; Wang, H.; La, H. A new method for evaluating the drought tolerance of upland rice cultivars. Crop J. 2017, 5, 488–498. [Google Scholar] [CrossRef]
  26. Zargar, S.M.; Mir, R.A.; Ebinezer, L.B.; Masi, A.; Hami, A.; Manzoor, M.; Salgotra, R.K.; Sofi, N.R.; Mushtaq, R.; Rohila, J.S.; et al. Physiological and Multi-Omics Approaches for Explaining Drought Stress Tolerance and Supporting Sustainable Production of Rice. Front. Plant Sci. 2021, 12, 803603. [Google Scholar] [CrossRef]
  27. Imran, M.; Latif, K.A.; Shahzad, R.; Aaqil, K.M.; Bilal, S.; Khan, A.; Kang, S.M.; Lee, I.J. Exogenous melatonin induces drought stress tolerance by promoting plant growth and antioxidant defence system of soybean plants. AoB Plants 2021, 13, b26. [Google Scholar] [CrossRef]
  28. Hu, W.; Zhang, J.; Yan, K.; Zhou, Z.; Zhao, W.; Zhang, X.; Pu, Y.; Yu, R. Beneficial effects of abscisic acid and melatonin in overcoming drought stress in cotton (Gossypium hirsutum L.). Physiol. Plant 2021, 173, 2041–2054. [Google Scholar] [CrossRef]
  29. El-Yazied, A.A.; Ibrahim, M.; Ibrahim, M.; Nasef, I.N.; Al-Qahtani, S.M.; Al-Harbi, N.A.; Alzuaibr, F.M.; Alaklabi, A.; Dessoky, E.S.; Alabdallah, N.M.; et al. Melatonin Mitigates Drought Induced Oxidative Stress in Potato Plants through Modulation of Osmolytes, Sugar Metabolism, ABA Homeostasis and Antioxidant Enzymes. Plants 2022, 11, 1151. [Google Scholar] [CrossRef]
  30. Zhang, X.; Goatley, M.; Wu, W.; Ervin, E.; Shang, C. Drought-induced injury is associated with hormonal alteration in Kentucky bluegrass. Plant Signal. Behav. 2019, 14, e1651607. [Google Scholar] [CrossRef]
  31. Mahmood, T.; Khalid, S.; Abdullah, M.; Ahmed, Z.; Shah, M.; Ghafoor, A.; Du, X. Insights into Drought Stress Signaling in Plants and the Molecular Genetic Basis of Cotton Drought Tolerance. Cells 2019, 9, 105. [Google Scholar] [CrossRef] [Green Version]
  32. Qi, J.; Song, C.P.; Wang, B.; Zhou, J.; Kangasjarvi, J.; Zhu, J.K.; Gong, Z. Reactive oxygen species signaling and stomatal movement in plant responses to drought stress and pathogen attack. J. Integr. Plant Biol. 2018, 60, 805–826. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  33. Laxa, M.; Liebthal, M.; Telman, W.; Chibani, K.; Dietz, K.J. The Role of the Plant Antioxidant System in Drought Tolerance. Antioxidants 2019, 8, 94. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  34. Jiang, D.; Lu, B.; Liu, L.; Duan, W.; Chen, L.; Li, J.; Zhang, K.; Sun, H.; Zhang, Y.; Dong, H.; et al. Exogenous melatonin improves salt stress adaptation of cotton seedlings by regulating active oxygen metabolism. PeerJ 2020, 8, e10486. [Google Scholar] [CrossRef] [PubMed]
  35. Qi, X.Y.; Wang, W.L.; Hu, S.Q.; Liu, M.Y.; Zheng, C.S.; Sun, X.Z. Effects of exogenous melatonin on photosynthesis and physiological characteristics of chry-santhemum seedlings under high temperature stress. Ying Yong Sheng Tai Xue Bao 2021, 32, 2496–2504. [Google Scholar] [CrossRef]
  36. Nadarajah, K.K. ROS Homeostasis in Abiotic Stress Tolerance in Plants. Int. J. Mol. Sci. 2020, 21, 5208. [Google Scholar] [CrossRef]
  37. Zhang, P.; Liu, L.; Wang, X.; Wang, Z.; Zhang, H.; Chen, J.; Liu, X.; Wang, Y.; Li, C. Beneficial Effects of Exogenous Melatonin on Overcoming Salt Stress in Sugar Beets (Beta vulgaris L.). Plants (Basel) 2021, 10, 886. [Google Scholar] [CrossRef]
  38. Lu, X.; Min, W.; Shi, Y.; Tian, L.; Li, P.; Ma, T.; Zhang, Y.; Luo, C. Exogenous Melatonin Alleviates Alkaline Stress by Removing Reactive Oxygen Species and Promoting Antioxidant Defence in Rice Seedlings. Front. Plant Sci. 2022, 13, 849553. [Google Scholar] [CrossRef]
  39. Khaleghi, A.; Naderi, R.; Brunetti, C.; Maserti, B.E.; Salami, S.A.; Babalar, M. Morphological, physiochemical and antioxidant responses of Maclura pomifera to drought stress. Sci. Rep. 2019, 9, 19250. [Google Scholar] [CrossRef] [Green Version]
  40. Wu, H.H.; Zou, Y.N.; Rahman, M.M.; Ni, Q.D.; Wu, Q.S. Mycorrhizas alter sucrose and proline metabolism in trifoliate orange exposed to drought stress. Sci. Rep. 2017, 7, 42389. [Google Scholar] [CrossRef]
  41. Chen, L.; Liu, L.; Lu, B.; Ma, T.; Jiang, D.; Li, J.; Zhang, K.; Sun, H.; Zhang, Y.; Bai, Z.; et al. Exogenous melatonin promotes seed germination and osmotic regulation under salt stress in cotton (Gossypium hirsutum L.). PLoS One 2020, 15, e228241. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  42. Garcia, J.J.; Lopez-Pingarron, L.; Almeida-Souza, P.; Tres, A.; Escudero, P.; Garcia-Gil, F.A.; Tan, D.; Reiter, R.J.; Ramirez, J.M.; Bernal-Perez, M. Protective effects of melatonin in reducing oxidative stress and in preserving the fluidity of biological membranes: A review. J. Pineal Res. 2014, 56, 225–237. [Google Scholar] [CrossRef] [PubMed]
  43. Li, R.; Yang, R.; Zheng, W.; Wu, L.; Zhang, C.; Zhang, H. Melatonin Promotes SGT1-Involved Signals to Ameliorate Drought Stress Adaption in Rice. Int. J. Mol. Sci. 2022, 23, 599. [Google Scholar] [CrossRef]
  44. Nawaz, M.A.; Jiao, Y.; Chen, C.; Shireen, F.; Zheng, Z.; Imtiaz, M.; Bie, Z.; Huang, Y. Melatonin pretreatment improves vanadium stress tolerance of watermelon seedlings by reducing vanadium concentration in the leaves and regulating melatonin biosynthesis and antioxidant-related gene expression. J. Plant Physiol. 2018, 220, 115–127. [Google Scholar] [CrossRef]
  45. Huang, F.C.; Studart-Witkowski, C.; Schwab, W. Overexpression of hydroperoxide lyase gene in Nicotiana benthamiana using a viral vector system. Plant Biotechnol. J. 2010, 8, 783–795. [Google Scholar] [CrossRef] [PubMed]
  46. Niu, K.; Ma, X.; Liang, G.; Ma, H.; Jia, Z.; Liu, W.; Yu, Q. 5-Aminolevulinic acid modulates antioxidant defense systems and mitigates drought-induced damage in Kentucky bluegrass seedlings. Protoplasma 2017, 254, 2083–2094. [Google Scholar] [CrossRef] [PubMed]
  47. Li, C.; Wang, P.; Wei, Z.; Liang, D.; Liu, C.; Yin, L.; Jia, D.; Fu, M.; Ma, F. The mitigation effects of exogenous melatonin on salinity-induced stress in Malus hupehensis. J. Pineal Res. 2012, 53, 298–306. [Google Scholar] [CrossRef]
  48. Rosa, M.; Hilal, M.; Gonzalez, J.A.; Prado, F.E. Low-temperature effect on enzyme activities involved in sucrose-starch partitioning in salt-stressed and salt-acclimated cotyledons of quinoa (Chenopodium quinoa Willd.) seedlings. Plant Physiol. Biochem. 2009, 47, 300–307. [Google Scholar] [CrossRef]
  49. Cardini, C.E.; Leloir, L.F.; Chiriboga, J. The biosynthesis of sucrose. J. Biol. Chem. 1955, 214, 149–155. [Google Scholar] [CrossRef]
  50. Livak, K.J.; Schmittgen, T.D. Analysis of relative gene expression data using real-time quantitative PCR and the 2(T)(-Delta Delta C) method. Methods 2001, 25, 402–408. [Google Scholar] [CrossRef]
Ijms 23 12075 g001 550
Figure 1. Effect of exogenous melatonin on rice seedling performance under drought stress. (A) Growth performance of rice seedlings under different treatments; (B) Relative water content; and (C) Root-shoot ratio. Data represent means ±SEs of three replicate samples. Different letters indicate significant differences (n = 3 and p < 0.05). CK, control; CM, control pretreated with melatonin; DC, drought stress; and DM, drought-stressed plants pretreated with melatonin. The same applies to the figures below.
Figure 1. Effect of exogenous melatonin on rice seedling performance under drought stress. (A) Growth performance of rice seedlings under different treatments; (B) Relative water content; and (C) Root-shoot ratio. Data represent means ±SEs of three replicate samples. Different letters indicate significant differences (n = 3 and p < 0.05). CK, control; CM, control pretreated with melatonin; DC, drought stress; and DM, drought-stressed plants pretreated with melatonin. The same applies to the figures below.
Ijms 23 12075 g001
Ijms 23 12075 g002 550
Figure 2. Effect of exogenous melatonin on lipid peroxidation and ROS under drought stress. (A) O2− production rate; (B) H2O2 content; (C) LOX activity; and (D) MDA content.
Figure 2. Effect of exogenous melatonin on lipid peroxidation and ROS under drought stress. (A) O2− production rate; (B) H2O2 content; (C) LOX activity; and (D) MDA content.
Ijms 23 12075 g002
Ijms 23 12075 g003 550
Figure 3. Effect of exogenous melatonin on antioxidant enzyme activity under drought stress. (A) SOD activity; (B) POD activity; (C) CAT activity; and (D) APX activity.
Figure 3. Effect of exogenous melatonin on antioxidant enzyme activity under drought stress. (A) SOD activity; (B) POD activity; (C) CAT activity; and (D) APX activity.
Ijms 23 12075 g003
Ijms 23 12075 g004 550
Figure 4. Effect of exogenous melatonin on ascorbic acid content under drought stress. (A) AsA content; (B) DHA content; and (C) AsA/DHA ratio.
Figure 4. Effect of exogenous melatonin on ascorbic acid content under drought stress. (A) AsA content; (B) DHA content; and (C) AsA/DHA ratio.
Ijms 23 12075 g004
Ijms 23 12075 g005 550
Figure 5. Effect of exogenous melatonin on proline, sucrose, and fructose contents under drought stress. (A) Proline content; (B) Sucrose content; and (C) Fructose content.
Figure 5. Effect of exogenous melatonin on proline, sucrose, and fructose contents under drought stress. (A) Proline content; (B) Sucrose content; and (C) Fructose content.
Ijms 23 12075 g005
Ijms 23 12075 g006 550
Figure 6. Effect of exogenous melatonin on LOX synthesis and osmotic adjustment-related gene expression levels under drought stress. (A) OsLOX1 expression level; (B) OsP5CS expression level; (C) OsSUS7 expression level; and (D) OsSPS1 expression level.
Figure 6. Effect of exogenous melatonin on LOX synthesis and osmotic adjustment-related gene expression levels under drought stress. (A) OsLOX1 expression level; (B) OsP5CS expression level; (C) OsSUS7 expression level; and (D) OsSPS1 expression level.
Ijms 23 12075 g006
Ijms 23 12075 g007 550
Figure 7. Effect of melatonin on antioxidant system-related gene expression levels under drought stress.
Figure 7. Effect of melatonin on antioxidant system-related gene expression levels under drought stress.
Ijms 23 12075 g007
Ijms 23 12075 g008 550
Figure 8. Effect of exogenous melatonin on melatonin synthetase gene expression levels under drought stress.
Figure 8. Effect of exogenous melatonin on melatonin synthetase gene expression levels under drought stress.
Ijms 23 12075 g008
Ijms 23 12075 g009 550
Figure 9. Correlation analysis of melatonin synthesis-related genes and antioxidant enzyme synthesis genes under drought stress. (A) Correlation of TDC2 and antioxidant enzyme synthesis genes. (B) Correlation of ASMT1 and antioxidant enzyme synthesis genes.
Figure 9. Correlation analysis of melatonin synthesis-related genes and antioxidant enzyme synthesis genes under drought stress. (A) Correlation of TDC2 and antioxidant enzyme synthesis genes. (B) Correlation of ASMT1 and antioxidant enzyme synthesis genes.
Ijms 23 12075 g009
Ijms 23 12075 g010 550
Figure 10. A proposed regulatory model for mitigating the effect of exogenous melatonin on rice seedlings under drought stress. The solid boxes represent the results of the well-documented studies, and the dashed boxes represent the results of this study. The diamond boxes represent substrates, intermediates, and final products in the melatonin synthesis pathway. The boxes represent synthetases, and the colored boxes represent two rate-limiting synthetases encoded by TDC2 and ASMT1 in this study.
Figure 10. A proposed regulatory model for mitigating the effect of exogenous melatonin on rice seedlings under drought stress. The solid boxes represent the results of the well-documented studies, and the dashed boxes represent the results of this study. The diamond boxes represent substrates, intermediates, and final products in the melatonin synthesis pathway. The boxes represent synthetases, and the colored boxes represent two rate-limiting synthetases encoded by TDC2 and ASMT1 in this study.
Ijms 23 12075 g010
Ijms 23 12075 g011 550
Figure 11. Diagram of spraying melatonin (refer to a previous report [12]).
Figure 11. Diagram of spraying melatonin (refer to a previous report [12]).
Ijms 23 12075 g011
Table
Table 1. qRT-PCR primers used for gene expression analysis.
Table 1. qRT-PCR primers used for gene expression analysis.
Gene SymbolRGAP IDPrimer Sequence (5′-3′) (Forward/Reverse)Product Size
ALM1LOC_Os06g05110CTGGCTGGGTTTGGCTTGT/TCGCCTGTCATCCTTGTAATC158
OsPOX1LOC_Os01g15830TGCCTGTTGATGCTCTGCT/CCGCCTGTGCTACGATGGA157
OsCATCLOC_Os03g03910ACAACCACTACGACGGCTTCA/CCTTGGCAATCACCACCTT153
OsAPX2LOC_Os07g49400TTGTGAGTGGCGAGAAGGA/GGCGTAATCCGCAAAGAA128
OsVTC1-1LOC_Os01g62840CAAGGGATTACATTACAGGC/TCAGGACCAATCAGACAGC148
OsLOX1LOC_Os03g49380CTGACCCAAATACAGAAAGCA/GGGGAACACCCTCAACAATA136
OsP5CSLOC_Os05g38150AATGACAGTTTAGCAGGAC/ACCACTATACAACCCATCC87
OsSUS7LOC_Os04g17650TACAGGCACCAGATCCTAC/CTGCTGCTTGATTCTTTGA200
OsSPS1LOC_Os01g69030GGCACAGCAAGACACTCCC/CGCCACGAACTAGACCATG134
TDC2LOC_Os07g25590CAGAGTACCGACACCACCT/AACCCATAGCAAGGAACAA104
ASMT1LOC_Os09g17560GCCAAGGCTCCCAGTAACAA/ACCTTTCCTCCAGCATCCC179
OsActinLOC_Os03g50885GACCTTCAACACCCCTGCTA/ACAGTGTGGCTGACACCATC114
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations.

Share and Cite

MDPI and ACS Style

Luo, C.; Min, W.; Akhtar, M.; Lu, X.; Bai, X.; Zhang, Y.; Tian, L.; Li, P. Melatonin Enhances Drought Tolerance in Rice Seedlings by Modulating Antioxidant Systems, Osmoregulation, and Corresponding Gene Expression. Int. J. Mol. Sci. 2022, 23, 12075. https://doi.org/10.3390/ijms232012075

AMA Style

Luo C, Min W, Akhtar M, Lu X, Bai X, Zhang Y, Tian L, Li P. Melatonin Enhances Drought Tolerance in Rice Seedlings by Modulating Antioxidant Systems, Osmoregulation, and Corresponding Gene Expression. International Journal of Molecular Sciences. 2022; 23(20):12075. https://doi.org/10.3390/ijms232012075

Chicago/Turabian Style

Luo, Chengke, Weifang Min, Maryam Akhtar, Xuping Lu, Xiaorong Bai, Yinxia Zhang, Lei Tian, and Peifu Li. 2022. "Melatonin Enhances Drought Tolerance in Rice Seedlings by Modulating Antioxidant Systems, Osmoregulation, and Corresponding Gene Expression" International Journal of Molecular Sciences 23, no. 20: 12075. https://doi.org/10.3390/ijms232012075

APA Style

Luo, C., Min, W., Akhtar, M., Lu, X., Bai, X., Zhang, Y., Tian, L., & Li, P. (2022). Melatonin Enhances Drought Tolerance in Rice Seedlings by Modulating Antioxidant Systems, Osmoregulation, and Corresponding Gene Expression. International Journal of Molecular Sciences, 23(20), 12075. https://doi.org/10.3390/ijms232012075

Note that from the first issue of 2016, this journal uses article numbers instead of page numbers. See further details here.

Article Metrics

Back to TopTop