Nitric Oxide Metabolic Pathway in Drought-Stressed Nodules of Faba Bean (Vicia faba L.)
Abstract
1. Introduction
2. Results
2.1. Drought Stress Affects Nodule Nitrogen-Fixing Capacity and Energy State and Induces Hypoxia Marker Gene Expression
2.2. NO Production and Pgb–NO Respiration Are Induced under Drought Stress
2.3. Pgb–NO Respiration Contributes to the Maintenance of Energy State under Osmotic Stress
3. Discussion
4. Materials and Methods
4.1. Biological Material and Growth Conditions
4.2. Nitrogen-Fixing Capacity Measurement
4.3. Measurement of NO Production
4.4. Osmolarity of Nodule Cells
4.5. Extraction and Measurement of Adenine Nucleotides
4.6. Measurement of NR Activity
4.7. RNA Isolation, Reverse Transcription, and Gene Expression
4.8. Statistical Analysis
5. Conclusions
Author Contributions
Funding
Data Availability Statement
Conflicts of Interest
Abbreviations
| ARA | acetylene-reducing activity |
| CuFL | Cu (II) fluorescein |
| DAF-2 | 4,5-diaminofluorescein |
| NO | nitric oxide |
| NR | nitrate reductase |
| Pgb | phytoglobin |
| SNF | symbiotic nitrogen fixation |
References
- Heim, R.R. A review of twentieth-century drought indices used in the United States. Bull. Am. Meteorol. Soc. 2002, 83, 1149–1166. [Google Scholar] [CrossRef]
- Chaudhry, S.; Sidhu, G.P.S. Climate change regulated abiotic stress mechanisms in plants: A comprehensive review. Plant Cell Rep. 2022, 41, 1–31. [Google Scholar] [CrossRef]
- Saini, H.S.; Westgate, M.E. Reproductive development in grain crops during drought. In Advances in Agronomy; Sparks, D.L., Ed.; Academic Press: Cambridge, MA, USA, 1999; Volume 68, pp. 59–96. [Google Scholar]
- Zlatev, Z.; Lidon, F. An overview on drought induced changes in plant growth, water relations and photosynthesis. Emir. J. Food Agric. 2012, 24, 57–72. [Google Scholar]
- Yadav, S.; Modi, P.; Dave, A.; Vijapura, A.; Patel, D.; Patel, M. Effect of Abiotic Stress on Crops; Hasanuzzaman, M., Ed.; IntechOpen: Rijeka, Croatiia, 2020; ISBN 978-1-78985-318-6. [Google Scholar]
- Castañeda, V.; Gil-Quintana, E.; Echeverria, A.; González, E.M. Legume nitrogen utilization under drought stress. In Engineering Nitrogen Utilization in Crop Plants; Shrawat, A., Zayed, A., Lightfoot, D.A., Eds.; Springer International Publishing: Cham, Switzerland, 2018; pp. 173–184. ISBN 978-3-319-92958-3. [Google Scholar]
- Nadeem, M.; Li, J.; Yahya, M.; Sher, A.; Ma, C.; Wang, X.; Qiu, L. Research progress and perspective on drought stress in legumes: A review. Int. J. Mol. Sci. 2019, 20, 2541. [Google Scholar] [CrossRef] [PubMed]
- Ahluwalia, O.; Singh, P.C.; Bhatia, R. A review on drought stress in plants: Implications, mitigation and the role of plant growth promoting rhizobacteria. Resour. Environ. Sustain. 2021, 5, 100032. [Google Scholar] [CrossRef]
- Bashir, S.S.; Hussain, A.; Hussain, S.J.; Wani, O.A.; Zahid Nabi, S.; Dar, N.A.; Baloch, F.S.; Mansoor, S. Plant drought stress tolerance: Understanding its physiological, biochemical and molecular mechanisms. Biotechnol. Biotechnol. Equip. 2021, 35, 1912–1925. [Google Scholar] [CrossRef]
- De Oliveira, A.B.; Alencar, N.L.M.; Gomes-Filho, E. Responses of organisms to water stress. In Comparison Between the Water and Salt Stress Effects on Plant Growth and Develop-ment; IntechOpen: Rijeka, Croatiia; Marmara University: Istanbul, Turkey, 2013; ISBN 978-953-51-0933-4. [Google Scholar]
- Cornic, G. Drought stress inhibits photosynthesis by decreasing stomatal aperture–not by affecting ATP synthesis. Trends Plant Sci. 2000, 5, 187–188. [Google Scholar] [CrossRef]
- Parry, M.A.J.; Andralojc, P.J.; Khan, S.; Lea, P.J.; Keys, A.J. Rubisco activity: Effects of drought stress. Ann. Bot. 2002, 89, 833–839. [Google Scholar] [CrossRef]
- Bota, J.; Medrano, H.; Flexas, J. Is photosynthesis limited by decreased Rubisco activity and RuBP content under progressive water stress? New Phytol. 2004, 162, 671–681. [Google Scholar] [CrossRef]
- Kunert, K.J.; Vorster, B.J.; Fenta, B.A.; Kibido, T.; Dionisio, G.; Foyer, C.H. Drought stress responses in soybean roots and nodules. Front. Plant Sci. 2016, 7, 1015. [Google Scholar] [CrossRef]
- Todaka, D.; Zhao, Y.; Yoshida, T.; Kudo, M.; Kidokoro, S.; Mizoi, J.; Kodaira, K.-S.; Takebayashi, Y.; Kojima, M.; Sakakibara, H.; et al. Temporal and spatial changes in gene expression, metabolite accumulation and phytohormone content in rice seedlings grown under drought stress conditions. Plant J. 2017, 90, 61–78. [Google Scholar] [CrossRef] [PubMed]
- Cruz de Carvalho, M.H. Drought stress and reactive oxygen species. Plant Signal. Behav. 2008, 3, 156–165. [Google Scholar] [CrossRef] [PubMed]
- Kaur, G.; Asthir, B. Molecular responses to drought stress in plants. Biol. Plant. 2017, 61, 201–209. [Google Scholar] [CrossRef]
- Wang, Q.; Liu, J.; Zhu, H. Genetic and molecular mechanisms underlying symbiotic specificity in legume-rhizobium interactions. Front. Plant Sci. 2018, 9, 313. [Google Scholar] [CrossRef] [PubMed]
- Oldroyd, G.E.D.; Murray, J.D.; Poole, P.S.; Downie, J.A. The rules of engagement in the legume-rhizobial symbiosis. Annu. Rev. Genet. 2011, 45, 119–144. [Google Scholar] [CrossRef]
- Muktadir, M.A.; Adhikari, K.N.; Merchant, A.; Belachew, K.Y.; Vandenberg, A.; Stoddard, F.L.; Khazaei, H. Physiological and biochemical basis of faba bean breeding for drought adaptation—A review. Agronomy 2020, 10, 1345. [Google Scholar] [CrossRef]
- Worrall, V.S.; Roughley, R.J. The effect of moisture stress on infection of Trifolium subterraneum L. by Rhizobium trifolii Dang. J. Exp. Bot. 1976, 27, 1233–1241. [Google Scholar] [CrossRef]
- Serraj, R.; Sinclair, T.R.; Purcell, L.C. Symbiotic N2 fixation response to drought. J. Exp. Bot. 1999, 50, 143–155. [Google Scholar] [CrossRef]
- Durand, J.-L.; Sheehy, J.E.; Minchin, F.R. Nitrogenase activity, photosynthesis and nodule water potential in soyabean plants experiencing water deprivation. J. Exp. Bot. 1987, 38, 311–321. [Google Scholar] [CrossRef]
- Serraj, R.; Vadez, V.; Sinclair, T.R. Feedback regulation of symbiotic N2 fixation under drought stress. Agronomie 2001, 21, 621–626. [Google Scholar] [CrossRef]
- Gordon, A.J.; Minchin, F.R.; Skot, L.; James, C.L. Stress-induced declines in soybean N2 fixation are related to nodule sucrose synthase activity. Plant Physiol. 1997, 114, 937–946. [Google Scholar] [CrossRef]
- Baier, M.C.; Barsch, A.; Küster, H.; Hohnjec, N. Antisense repression of the Medicago truncatula nodule-enhanced sucrose synthase leads to a handicapped nitrogen fixation mirrored by specific alterations in the symbiotic transcriptome and metabolome. Plant Physiol. 2007, 145, 1600–1618. [Google Scholar] [CrossRef] [PubMed][Green Version]
- Marino, D.; Frendo, P.; Ladrera, R.; Zabalza, A.; Puppo, A.; Arrese-Igor, C.; González, E. Nitrogen fixation control under drought stress. Localized or systemic? Plant Physiol. 2007, 143, 1968–1974. [Google Scholar] [CrossRef] [PubMed]
- Ladrera, R.; Marino, D.; Larrainzar, E.; González, E.; Arrese-Igor, C. Reduced carbon availability to bacteroids and elevated ureides in nodules, but not in shoots, are involved in the nitrogen fixation response to early drought in soybean. Plant Physiol. 2007, 145, 539–546. [Google Scholar] [CrossRef] [PubMed]
- Gil-Quintana, E.; Larrainzar, E.; Seminario, A.; Díaz-Leal, J.L.; Alamillo, J.M.; Pineda, M.; Arrese-Igor, C.; Wienkoop, S.; González, E.M. Local inhibition of nitrogen fixation and nodule metabolism in drought-stressed soybean. J. Exp. Bot. 2013, 64, 2171–2182. [Google Scholar] [CrossRef]
- Gil-Quintana, E.; Larrainzar, E.; Arrese-Igor, C.; González, E. Is N-feedback involved in the inhibition of nitrogen fixation in drought-stressed Medicago truncatula? J. Exp. Bot. 2012, 64, 281–292. [Google Scholar] [CrossRef] [PubMed]
- King, A.; Purcell, L. Inhibition of N2 fixation in soybean is associated with elevated ureides and amino acids. Plant Physiol. 2005, 137, 1389–1396. [Google Scholar] [CrossRef]
- Sulieman, S.; Fischinger, S.A.; Gresshoff, P.M.; Schulze, J. Asparagine as a major factor in the N-feedback regulation of N2 fixation in Medicago truncatula. Physiol. Plant. 2010, 140, 21–31. [Google Scholar] [CrossRef]
- Guerin, V.; Trinchant, J.C.; Rigaud, J. Nitrogen fixation (C2H2 Reduction) by broad bean (Vicia faba L.) nodules and bacteroids under water-restricted conditions. Plant Physiol. 1990, 92, 595–601. [Google Scholar] [CrossRef]
- Serraj, R.; Roy, G.; Drevon, J. Salt stress induces a decrease in the oxygen uptake of soybean nodules and in their permeability to oxygen diffusion. Physiol. Plant. 1994, 91, 161–168. [Google Scholar] [CrossRef]
- Sinclair, T.; Serraj, R. Legume nitrogen-fixation and drought. Nature 1995, 378, 344. [Google Scholar] [CrossRef]
- Serraj, R.; Sinclair, T.R. N2 fixation response to drought in common bean (Phaseolus vulgaris L.). Ann. Bot. 1998, 82, 229–234. [Google Scholar] [CrossRef][Green Version]
- Serraj, R.; Drevon, J.-J. Effects of salt stress on nitrogen fixation, oxygen diffusion, and ion distribution in soybean, common bean, and alfalfa. J. Plant Nutr. 1998, 21, 475–488. [Google Scholar] [CrossRef]
- Aridhi, F.; Sghaier, H.; Gaitanaros, A.; Khadri, A.; Aschi-Smiti, S.; Brouquisse, R. Nitric oxide production is involved in maintaining energy state in Alfalfa (Medicago sativa L.) nodulated roots under both salinity and flooding. Planta 2020, 252, 22. [Google Scholar] [CrossRef] [PubMed]
- Dordas, C.; Hasinoff, B.B.; Igamberdiev, A.U.; Manac’h, N.; Rivoal, J.; Hill, R.D. Expression of a stress-induced hemoglobin affects NO levels produced by alfalfa root cultures under hypoxic stress. Plant J. 2003, 35, 763–770. [Google Scholar] [CrossRef]
- Planchet, E.; Jagadis Gupta, K.; Sonoda, M.; Kaiser, W.M. Nitric oxide emission from tobacco leaves and cell suspensions: Rate limiting factors and evidence for the involvement of mitochondrial electron transport. Plant J. Cell Mol. Biol. 2005, 41, 732–743. [Google Scholar] [CrossRef]
- Horchani, F.; Prévot, M.; Boscari, A.; Evangelisti, E.; Meilhoc, E.; Bruand, C.; Raymond, P.; Boncompagni, E.; Aschi-Smiti, S.; Puppo, A.; et al. Both plant and bacterial nitrate reductases contribute to nitric oxide production in Medicago truncatula nitrogen-fixing nodules. Plant Physiol. 2011, 155, 1023–1036. [Google Scholar] [CrossRef]
- Berger, A.; Boscari, A.; Horta Araújo, N.; Maucourt, M.; Hanchi, M.; Bernillon, S.; Rolin, D.; Puppo, A.; Brouquisse, R. Plant nitrate reductases regulate nitric oxide production and nitrogen-fixing metabolism during the Medicago truncatula–Sinorhizobium meliloti symbiosis. Front. Plant Sci. 2020, 11, 1313. [Google Scholar] [CrossRef]
- Berger, A.; Boscari, A.; Puppo, A.; Brouquisse, R. Nitrate reductases and hemoglobins control nitrogen-fixing symbiosis by regulating nitric oxide accumulation. J. Exp. Bot. 2021, 72, 873–884. [Google Scholar] [CrossRef]
- Gupta, K.J.; Igamberdiev, A.U. The anoxic plant mitochondrion as a nitrite: NO reductase. Mitochondrion 2011, 11, 537–543. [Google Scholar] [CrossRef]
- Hill, R.D. Non-symbiotic haemoglobins—What’s happening beyond nitric oxide scavenging? AoB Plants 2012, 2012, pls004. [Google Scholar] [CrossRef]
- Attia, H.; Alamer, K.; Ouhibi, C.; Oueslati, S.; Lachaal, M. Interaction Between Salt Stress and Drought Stress on Some Physiological Parameters in Two Pea Cultivars. Int. J. Bot. 2020, 16, 1–8. [Google Scholar] [CrossRef]
- Saïdi, S.; Ramírez-Bahena, M.-H.; Santillana, N.; Zúñiga, D.; Álvarez-Martínez, E.; Peix, A.; Mhamdi, R.; Velázquez, E. Rhizobium laguerreae sp. nov. nodulates Vicia faba on several continents. Int. J. Syst. Evol. Microbiol. 2014, 64, 242–247. [Google Scholar] [CrossRef]
- Limami, A.M.; Diab, H.; Lothier, J. Nitrogen metabolism in plants under low oxygen stress. Planta 2014, 239, 531–541. [Google Scholar] [CrossRef] [PubMed]
- Mustroph, A.; Zanetti, M.E.; Jang, C.J.H.; Holtan, H.E.; Repetti, P.P.; Galbraith, D.W.; Girke, T.; Bailey-Serres, J. Profiling translatomes of discrete cell populations resolves altered cellular priorities during hypoxia in Arabidopsis. Proc. Natl. Acad. Sci. USA 2009, 106, 18843–18848. [Google Scholar] [CrossRef] [PubMed]
- Igamberdiev, A.U.; Hill, R.D. Plant mitochondrial function during anaerobiosis. Ann. Bot. 2009, 103, 259–268. [Google Scholar] [CrossRef]
- Berger, A.; Guinand, S.; Boscari, A.; Puppo, A.; Brouquisse, R. Medicago truncatula Phytoglobin 1.1 controls symbiotic nodulation and nitrogen fixation via the regulation of nitric oxide concentration. New Phytol. 2020, 227, 84–98. [Google Scholar] [CrossRef]
- Hille, R. Molybdenum and tungsten in biology. Trends Biochem. Sci. 2002, 27, 360–367. [Google Scholar] [CrossRef]
- Chamizo-Ampudia, A.; Sanz-Luque, E.; Llamas, A.; Galvan, A.; Fernandez, E. Nitrate reductase regulates plant nitric oxide homeostasis. Trends Plant Sci. 2017, 22, 163–174. [Google Scholar] [CrossRef]
- Bender, D.; Schwarz, G. Nitrite-dependent nitric oxide synthesis by molybdenum enzymes. FEBS Lett. 2018, 592, 2126–2139. [Google Scholar] [CrossRef]
- Money, N.P. Osmotic pressure of aqueous polyethylene glycols 1: Relationship between molecular weight and vapor pressure deficit. Plant Physiol. 1989, 91, 766–769. [Google Scholar] [CrossRef] [PubMed]
- Abdel Wahab, A.M.; Abd-Alla, M.H. The role of potassium fertilizer in nodulation and nitrogen fixation of faba bean (Vicia faba L.) plants under drought stress. Biol. Fertil. Soils 1995, 20, 147–150. [Google Scholar] [CrossRef]
- Guérin, V.; Pladys, D.; Trinchant, J.-C.; Rigaud, J. Proteolysis and nitrogen fixation in faba-bean (Vicia faba) nodules under water stress. Physiol. Plant. 1991, 82, 360–366. [Google Scholar] [CrossRef]
- Larrainzar, E.; Wienkoop, S.; Scherling, C.; Kempa, S.; Ladrera, R.; Arrese-Igor, C.; Weckwerth, W.; González, E.M. Carbon metabolism and bacteroid functioning are involved in the regulation of nitrogen fixation in Medicago truncatula under drought and recovery. Mol. Plant-Microbe Interact. 2009, 22, 1565–1576. [Google Scholar] [CrossRef]
- Siddiqui, M.H.; Al-Khaishany, M.Y.; Al-Qutami, M.A.; Al-Whaibi, M.H.; Grover, A.; Ali, H.M.; Al-Wahibi, M.S.; Bukhari, N.A. Response of different genotypes of faba bean plant to drought stress. Int. J. Mol. Sci. 2015, 16, 10214–10227. [Google Scholar] [CrossRef]
- Appleby, C.A. The origin and functions of haemoglobin in plants. In Science Progress (1933-); SAGE Publications: New York, NY, USA, 1992; Volume 76, pp. 365–398. [Google Scholar]
- Ruiz, B.; Le Scornet, A.; Sauviac, L.; Rémy, A.; Bruand, C.; Meilhoc, E. The nitrate assimilatory pathway in Sinorhizobium meliloti: Contribution to NO production. Front. Microbiol. 2019, 10, 1526. [Google Scholar] [CrossRef]
- Arasimowicz-Jelonek, M.; Floryszak-Wieczorek, J.; Kubiś, J. Involvement of nitric oxide in water stress-induced responses of cucumber roots. Plant Sci. 2009, 177, 682–690. [Google Scholar] [CrossRef]
- Yu, M.; Lamattina, L.; Spoel, S.H.; Loake, G.J. Nitric oxide function in plant biology: A redox cue in deconvolution. New Phytol. 2014, 202, 1142–1156. [Google Scholar] [CrossRef]
- Aparicio-Tejo, P.; Sánchez-Díaz, M. Nodule and leaf nitrate reductases and nitrogen fixation in Medicago sativa L. under water stress. Plant Physiol. 1982, 69, 479–482. [Google Scholar] [CrossRef]
- da Silveira, J.A.G.; da Costa, R.C.L.; Oliveira, J.T.A. Drought-induced effects and recovery of nitrate assimilation and nodule activity in cowpea plants inoculated with Bradyrhizobium spp. under moderate nitrate level. Braz. J. Microbiol. 2001, 32, 187–194. [Google Scholar] [CrossRef]
- Basra, S.; Iram, A. Drought stress induced changes in some organic substances in nodules and other plant parts of two potential legumes differing in salt tolerance. Flora-Morphol. Distrib. Funct. Ecol. Plants 2005, 200, 535–546. [Google Scholar] [CrossRef]
- Deng, M.; Moureaux, T.; Caboche, M. Tungstate, a molybdate analog inactivating nitrate reductase, deregulates the expression of the nitrate reductase structural gene. Plant Physiol. 1989, 91, 304–309. [Google Scholar] [CrossRef] [PubMed]
- Lillo, C.; Meyer, C.; Lea, U.S.; Provan, F.; Oltedal, S. Mechanism and importance of post-translational regulation of nitrate reductase. J. Exp. Bot. 2004, 55, 1275–1282. [Google Scholar] [CrossRef] [PubMed]
- Han, M.-L.; Lv, Q.-Y.; Zhang, J.; Wang, T.; Zhang, C.-X.; Tan, R.-J.; Wang, Y.-L.; Zhong, L.-Y.; Gao, Y.-Q.; Chao, Z.-F.; et al. Decreasing nitrogen assimilation under drought stress by suppressing DST-mediated activation of Nitrate Reductase 1.2 in rice. Mol. Plant 2022, 15, 167–178. [Google Scholar] [CrossRef]
- Klok, E.J.; Wilson, I.W.; Wilson, D.; Chapman, S.C.; Ewing, R.M.; Somerville, S.C.; Peacock, W.J.; Dolferus, R.; Dennis, E.S. Expression profile analysis of the low-oxygen response in arabidopsis root cultures. Plant Cell 2002, 14, 2481–2494. [Google Scholar] [CrossRef]
- Foyer, C.H.; Valadier, M.-H.; Migge, A.; Becker, T.W. Drought-induced effects on nitrate reductase activity and mRNA and on the coordination of nitrogen and carbon metabolism in maize leaves. Plant Physiol. 1998, 117, 283–292. [Google Scholar] [CrossRef]
- Gloser, V.; Dvorackova, M.; Mota, D.H.; Petrovic, B.; Gonzalez, P.; Geilfus, C.M. Early changes in nitrate uptake and assimilation under drought in relation to transpiration. Front. Plant Sci. 2020, 11, 602065. [Google Scholar] [CrossRef]
- Mohn, M.A.; Thaqi, B.; Fischer-Schrader, K. Isoform-specific NO synthesis by arabidopsis thaliana nitrate reductase. Plants 2019, 8, 67. [Google Scholar] [CrossRef]
- Wray, J.L.; Filner, P. Structural and functional relationships of enzyme activities induced by nitrate in barley. Biochem. J. 1970, 119, 715–725. [Google Scholar] [CrossRef]
- Simontacchi, M.; Galatro, A.; Ramos-Artuso, F.; Santa-María, G.E. Plant survival in a changing environment: The role of nitric oxide in plant responses to abiotic stress. Front. Plant Sci. 2015, 6, 977. [Google Scholar] [CrossRef]
- Farnese, F.S.; Menezes-Silva, P.E.; Gusman, G.S.; Oliveira, J.A. When bad guys become good ones: The key role of reactive oxygen species and nitric oxide in the plant responses to abiotic stress. Front. Plant Sci. 2016, 7, 471. [Google Scholar] [CrossRef] [PubMed]
- Sánchez-Vicente, I.; Fernández-Espinosa, M.G.; Lorenzo, O. Nitric oxide molecular targets: Reprogramming plant development upon stress. J. Exp. Bot. 2019, 70, 4441–4460. [Google Scholar] [CrossRef] [PubMed]
- Igamberdiev, A.U.; Hill, R.D. Nitrate, NO and haemoglobin in plant adaptation to hypoxia: An alternative to classic fermentation pathways. J. Exp. Bot. 2004, 55, 2473–2482. [Google Scholar] [CrossRef]
- Vincent, J.M. A manual for the practical study of the root-nodule bacteria. Man. Pract. Study Root-Nodule Bact. 1970, 8, 977. [Google Scholar]
- Hardy, R.W.F.; Holsten, R.D.; Jackson, E.K.; Burns, R.C. The acetylene-ethylene assay for N2 fixation: Laboratory and field evaluation 1. Plant Physiol. 1968, 43, 1185–1207. [Google Scholar] [CrossRef] [PubMed]
- Miranda, K.M.; Espey, M.G.; Wink, D.A. A rapid, simple spectrophotometric method for simultaneous detection of nitrate and nitrite. Nitric Oxide 2001, 5, 62–71. [Google Scholar] [CrossRef]
- Jayakodi, M.; Golicz, A.A.; Kreplak, J.; Fechete, L.I.; Angra, D.; Bednář, P.; Bornhofen, E.; Zhang, H.; Boussageon, R.; Kaur, S.; et al. The giant diploid faba genome unlocks variation in a global protein crop. bioRxiv 2022. [Google Scholar] [CrossRef]
- Gutierrez, N.; Gimenez, M.; Palomino, C.; Avila, C. Assessment of candidate reference genes for expression studies in Vicia faba L. by real-time quantitative PCR. Mol. Breed. 2010, 28, 13–24. [Google Scholar] [CrossRef]
- Hilliou, F.; Trang, T. RqPCRAnalysis: Analysis of quantitative real-time PCR data. Bioinformatics 2013, 202–211. [Google Scholar] [CrossRef]






| Gene | Accession ID | Description | Forward and Reverse Primer (5′–3′) | Efficiency (%) | Reference |
|---|---|---|---|---|---|
| ACT1(1) | P30164 | actin 1 | F: GCTGTCCTCTCCCTCTATGCA R: GCCGAGGTGGTGAACATATACC | 92.0 | [83] |
| ELF1A(1) | AJ222579 | eukariotic elongation factor 1-alpha | F: GTGAAGCCCGGTATGCTTGT R: CTTGAGATCCTTGACTGCAACATT | 100.5 | [83] |
| Pgb1.1 | CSVX01042149.1 | phytoglobin 1.1 | F: ACTTGAGAGCTAGTTCTGCAGAA R: TGTTTCACGGAAGAGCAAGAAG | 99.6 | This work |
| NR1 | Vfaba.Hedin2.R1.2g082320 | nitrate reductase 1 | F: AGCTTGGTTCTATAAACCGGAG R: CTGAGTAGTCTCTGAGTCAACC | 98.3 | This work |
| NR2 | CSVX01059671.1 | nitrate reductase 2 | F: TAGTTTGCGCTGGTAACCGT R: ACCGAATTTGAAACCGCTGC | 102.8 | This work |
| AlaAT | CSVX01002777.1 | alanine aminotransferase | F: CGCCACAGGAATCGTTGTTG R: CAAACGGGTGACAATGGCTG | 90.4 | This work |
| ADH | CSVX01017814.1 | alcohol dehydrogenase | F: ACACCCTCACCTACACTCTC R: TCAAGATACTCTTCACCTCCCT | 101.43 | This work |
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations. |
© 2022 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Chammakhi, C.; Boscari, A.; Pacoud, M.; Aubert, G.; Mhadhbi, H.; Brouquisse, R. Nitric Oxide Metabolic Pathway in Drought-Stressed Nodules of Faba Bean (Vicia faba L.). Int. J. Mol. Sci. 2022, 23, 13057. https://doi.org/10.3390/ijms232113057
Chammakhi C, Boscari A, Pacoud M, Aubert G, Mhadhbi H, Brouquisse R. Nitric Oxide Metabolic Pathway in Drought-Stressed Nodules of Faba Bean (Vicia faba L.). International Journal of Molecular Sciences. 2022; 23(21):13057. https://doi.org/10.3390/ijms232113057
Chicago/Turabian StyleChammakhi, Chaima, Alexandre Boscari, Marie Pacoud, Grégoire Aubert, Haythem Mhadhbi, and Renaud Brouquisse. 2022. "Nitric Oxide Metabolic Pathway in Drought-Stressed Nodules of Faba Bean (Vicia faba L.)" International Journal of Molecular Sciences 23, no. 21: 13057. https://doi.org/10.3390/ijms232113057
APA StyleChammakhi, C., Boscari, A., Pacoud, M., Aubert, G., Mhadhbi, H., & Brouquisse, R. (2022). Nitric Oxide Metabolic Pathway in Drought-Stressed Nodules of Faba Bean (Vicia faba L.). International Journal of Molecular Sciences, 23(21), 13057. https://doi.org/10.3390/ijms232113057

