Involvement of Oxytocin and Progesterone Receptor Expression in the Etiology of Canine Uterine Inertia
Abstract
:1. Introduction
2. Results
2.1. Determination of Serum P4 Concentrations
2.2. OXTR Expression
2.3. PGR Expression
3. Discussion
4. Materials and Methods
4.1. Animals and Study Design
4.2. Grouping
4.3. Tissue Sample Collection and Processing
4.4. RNA Isolation and Reverse Transcription
4.5. Immunohistochemistry for OXTR and PGR and Evaluation of the Staining
4.6. Statistical Analysis
5. Conclusions
Supplementary Materials
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Darvelid, A.W.; Linde-Forsberg, C. Dystocia in the bitch: A retrospective study of 182 cases. J. Small Anim. Pract. 1994, 35, 402–407. [Google Scholar] [CrossRef]
- Davidson, A.P. Primary Uterine Inertia in Four Labrador Bitches. J. Am. Anim. Hosp. Assoc. 2011, 47, 83–88. [Google Scholar] [CrossRef] [PubMed]
- Linde Forsberg, C.; Persson, G. A survey of dystocia in the Boxer breed. Acta Vet. Scand. 2007, 49, 8. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Feldman, E.; Nelson, R. Canine and Feline Endocrinology and Reproduction, 3rd ed.; WB Saunders: Philadelphia, PA, USA, 2004; pp. 752–805. [Google Scholar]
- Linde-Forsberg, C.; Eneroth, A. Abnormalities in pregnancy, parturition, and the periparturient period. In Textbook of Veterinary Internal Medicine, 6th ed.; Ettinger, S.J., Feldmann, E.C., Eds.; WB Saunders: Philadelphia, PA, USA, 2005; Volume 5, pp. 1655–1667. [Google Scholar]
- Münnich, A.; Küchenmeister, U. Dystocia in Numbers—Evidence-Based Parameters for Intervention in the Dog: Causes for Dystocia and Treatment Recommendations. Reprod. Domest. Anim. 2009, 44, 141–147. [Google Scholar] [CrossRef]
- Prashantkumar, K.A.; Walikar, A. Evaluation of treatment protocols for complete primary uterine inertia in female dogs. Pharm. Innov. J. 2018, 7, 661.e4. [Google Scholar]
- Gaudet, D. Retrospective study of 128 cases of canine dystocia. J. Am. Anim. Hosp. Assoc. 1985, 21, 813–818. [Google Scholar]
- Bergström, A.; Nødtvedt, A.; Lagerstedt, A.S.; Egenvall, A. Incidence and Breed Predilection for Dystocia and Risk Factors for Cesarean Section in a Swedish Population of Insured Dogs. Vet. Surg. 2006, 35, 786–791. [Google Scholar] [CrossRef]
- Bergström, A.; Fransson, B.; Lagerstedt, A.S.; Olsson, K. Primary uterine inertia in 27 bitches: Aetiology and treatment. J. Small Anim. Pract. 2006, 47, 456–460. [Google Scholar] [CrossRef]
- Bennett, D. Canine dystocia—A review of the literature. J. Small Anim. Pract. 1974, 15, 101–117. [Google Scholar] [CrossRef]
- Johnston, S.D.; Root Kustritz, M.V.; Olson, P.S. Canine and Feline Theriogenology, 1st ed.; WB Saunders: Philadelphia, PA, USA, 2001. [Google Scholar]
- Gill, M.A. Perinatal and Late Neonatal Mortality in the Dog. Ph.D. Thesis, University of Sydney, Sydney, Australia, 2001. [Google Scholar]
- Hollinshead, F.K.; Hanlon, D.W.; Gilbert, R.O.; Verstegen, J.P.; Krekeler, N.; Volkmann, D.H. Calcium, parathyroid hormone, oxytocin and pH profiles in the whelping bitch. Theriogenology 2010, 73, 1276–1283. [Google Scholar] [CrossRef]
- Frehner, B.; Reichler, I.; Keller, S.; Goericke-Pesch, S.; Balogh, O. Blood calcium, glucose and haematology profiles of parturient bitches diagnosed with uterine inertia or obstructive dystocia. Reprod. Domest. Anim. 2018, 53, 680–687. [Google Scholar] [CrossRef]
- Egloff, S.; Reichler, I.M.; Kowalewski, M.P.; Keller, S.; Goericke-Pesch, S.; Balogh, O. Uterine expression of smooth muscle alpha- and gamma-actin and smooth muscle myosin in bitches diagnosed with uterine inertia and obstructive dystocia. Theriogenology 2020, 156, 162–170. [Google Scholar] [CrossRef]
- Frehner, B.L.; Reichler, I.M.; Kowalewski, M.P.; Gram, A.; Keller, S.; Goericke-Pesch, S.; Balogh, O. Implications of the RhoA/Rho associated kinase pathway and leptin in primary uterine inertia in the dog. J. Reprod. Dev. 2021, 67, 207–215. [Google Scholar] [CrossRef]
- Naaktgeboren, C.; Slijper, E.J. Biologie der Geburt: Eine Einführung in die Vergleichende Geburtskunde, 1st ed.; Paul Parey: Hamburg, Germany, 1970; pp. 67–160. [Google Scholar]
- Purohit, G.N. Parturition in Domestic Animals: A Review. WebmedCentral Reprod. 2010, 1, WMC00748. [Google Scholar]
- Bergström, A.; Fransson, B.; Lagerstedt, A.S.; Kindahl, H.; Olsson, U.; Olsson, K. Hormonal concentrations in bitches with primary uterine inertia. Theriogenology 2010, 73, 1068–1075. [Google Scholar] [CrossRef]
- Baan, M.; Taverne, M.A.; de Gier, J.; Kooistra, H.S.; Kindahl, H.; Dieleman, S.J.; Okkens, A.C. Hormonal changes in spontaneous and aglépristone-induced parturition in dogs. Theriogenology 2008, 69, 399–407. [Google Scholar] [CrossRef]
- Hoffmann, B.; Höveler, R.; Nohr, B.; Hasan, S.H. Investigations on hormonal changes around parturition in the dog and the occurrence of pregnancy-specific non conjugated oestrogens. Exp. Clin. Endocrinol. 1994, 102, 185–189. [Google Scholar] [CrossRef]
- Hinderer, J.; Lüdeke, J.; Riege, L.; Haimerl, P.; Bartel, A.; Kohn, B.; Weber, C.; Müller, E.; Arlt, S.P. Progesterone Concentrations during Canine Pregnancy. Animals 2021, 11, 3369. [Google Scholar] [CrossRef]
- Concannon, P.W.; McCann, J.P.; Temple, M. Biology and endocrinology of ovulation, pregnancy and parturition in the dog. J. Reprod. Fertil. Suppl. 1989, 39, 3–25. [Google Scholar]
- Hoffmann, B.; Höveler, R.; Hasan, S.H.; Failing, K. Ovarian and pituitary function in dogs after hysterectomy. J. Reprod. Fertil. 1992, 96, 837–845. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Nohr, B.; Hoffmann, B.; Steinetz, B.E. Investigation of the endocrine control of parturition in the dog by application of an antigestagen. J. Reprod. Fertil. Suppl. 1993, 47, 542–543. [Google Scholar] [PubMed]
- Kowalewski, M.P.; Tavares Pereira, M.; Kazemian, A. Canine conceptus-maternal communication during maintenance and termination of pregnancy, including the role of species-specific decidualization. Theriogenology 2020, 150, 329–338. [Google Scholar] [CrossRef] [PubMed]
- Kowalewski, M.P. Luteal regression vs. prepartum luteolysis: Regulatory mechanisms governing canine corpus luteum function. Reprod. Biol. 2014, 14, 89–102. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Van der Weyden, G.C.; Taverne, M.A.; Dieleman, S.J.; Wurth, Y.; Bevers, M.M.; van Oord, H. Physiological aspects of pregnancy and parturition in dogs. J. Reprod. Fertil. Suppl. 1989, 39, 211–224. [Google Scholar] [PubMed]
- Irons, P.C.; Nöthling, J.O.; Volkmann, D.H. Failure of luteolysis leads to prolonged gestation in a bitch: A case report. Theriogenology 1997, 48, 353–359. [Google Scholar] [CrossRef]
- McLean, L. Single pup syndrome in an English Bulldog: Failure of luteolysis. Companion Anim. 2012, 17, 17–20. [Google Scholar] [CrossRef]
- Tamminen, T.; Sahlin, L.; Masironi-Malm, B.; Dahlbom, M.; Katila, T.; Taponen, J.; Laitinen-Vapaavuori, O. Expression of uterine oxytocin receptors and blood progesterone, 13,14-dihydro-15-Keto-Prostaglandin F2α, and ionized calcium levels in dystocic bitches. Theriogenology 2019, 135, 38–45. [Google Scholar] [CrossRef]
- Derussi, A.; De Souza, R.; Volpato, R.; Guaitolini, C.; Ackermann, C.; Taffarel, M.; Cardoso, G.; Dal-Pai-Silva, M.; Lopes, M. Progesterone (PR), Oestrogen (ER-α and ER-β) and Oxytocin (OTR) Gene Expression in the Oviduct and Uterus of Pregnant and Non-Pregnant Bitches. Reprod. Domest. Anim. 2012, 47, 197–199. [Google Scholar] [CrossRef]
- Kowalewski, M. Endocrine and Molecular Control of Luteal and Placental Function in Dogs: A Review. Reprod. Domest. Anim. 2012, 47, 19–24. [Google Scholar] [CrossRef]
- Hoffmann, B.; Büsges, F.; Engel, E.; Kowalewski, M.P.; Papa, P. Regulation of corpus luteum-function in the bitch. Reprod. Domest. Anim. 2004, 39, 232–240. [Google Scholar] [CrossRef]
- Papa, P.C.; Kowalewski, M.P. Factors affecting the fate of the canine corpus luteum: Potential contributors to pregnancy and non-pregnancy. Theriogenology 2020, 150, 339–346. [Google Scholar] [CrossRef]
- Papa, P.C.; Hoffmann, B. The corpus luteum of the dog: Source and target of steroid hormones? Reprod. Domest. Anim. 2011, 46, 750–756. [Google Scholar] [CrossRef]
- Arrowsmith, S.; Wray, S. Oxytocin: Its Mechanism of Action and Receptor Signalling in the Myometrium. J. Neuroendocrinol. 2014, 26, 356–369. [Google Scholar] [CrossRef]
- Ferguson, J.K.W. A study of the motility of the intact uterus at term. Surg. Gynecol. Obstet. 1941, 73, 359–366. [Google Scholar]
- Gram, A.; Boos, A.; Kowalewski, M.P. Uterine and placental expression of canine oxytocin receptor during pregnancy and normal and induced parturition. Reprod. Domest. Anim 2014, 49 (Suppl. S2), 41–49. [Google Scholar] [CrossRef]
- Veiga, G.A.; Milazzotto, M.P.; Nichi, M.; Lúcio, C.F.; Silva, L.C.; Angrimani, D.S.; Vannucchi, C.I. Gene expression of estrogen and oxytocin receptors in the uterus of pregnant and parturient bitches. Braz. J. Med. Biol. Res. 2015, 48, 339–343. [Google Scholar] [CrossRef] [Green Version]
- Olsson, K.; Bergström, A.; Kindahl, H.; Lagerstedt, A.S. Increased plasma concentrations of vasopressin, oxytocin, cortisol and the prostaglandin F2alpha metabolite during labour in the dog. Acta Physiol. Scand. 2003, 179, 281–287. [Google Scholar] [CrossRef]
- Fuchs, A.R.; Rust, W.; Fields, M.J. Accumulation of cyclooxygenase-2 gene transcripts in uterine tissues of pregnant and parturient cows: Stimulation by oxytocin. Biol. Reprod. 1999, 60, 341–348. [Google Scholar] [CrossRef] [Green Version]
- Meier, S.; Lau, T.M.; Jenkin, G.; Fairclough, R.J. Oxytocin-induced prostaglandin F2 alpha release and endometrial oxytocin receptor concentrations throughout pregnancy in ewes. J. Reprod. Fertil. 1995, 103, 233–238. [Google Scholar] [CrossRef] [Green Version]
- Rempel, L.M.; Körber, H.; Reichler, I.M.; Balogh, O.; Goericke-Pesch, S. Investigations on the potential role of prostaglandin E2 in canine uterine inertia. Theriogenology 2021, 175, 134–147. [Google Scholar] [CrossRef]
- Rempel, L.M.; Lillevang, K.T.A.; Straten, A.-K.T.; Friðriksdóttir, S.B.; Körber, H.; Wehrend, A.; Kowalewski, M.P.; Reichler, I.M.; Balogh, O.; Goericke-Pesch, S. Do uterine PTGS2, PGFS, and PTGFR expression play a role in canine uterine inertia? Cell Tissue Res. 2021, 385, 251–264. [Google Scholar] [CrossRef] [PubMed]
- Fusi, J.; Veronesi, M.C. Canine parturition: What is known about the hormonal setting? Domest. Anim. Endocrinol. 2022, 78, 106687. [Google Scholar] [CrossRef]
- Arlt, S.P. The bitch around parturition. Theriogenology 2020, 150, 452–457. [Google Scholar] [CrossRef] [PubMed]
- Phaneuf, S. Desensitization of oxytocin receptors in human myometrium. Hum. Reprod. Update 1998, 4, 625–633. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Kowalewski, M.P.; Gram, A.; Kautz, E.; Graubner, F.R. The Dog: Nonconformist, Not Only in Maternal Recognition Signaling. Adv. Anat. Embryol. Cell Biol. 2015, 216, 215–237. [Google Scholar]
- Tamminen, T.M.; Sahlin, L.; Masironi, B.; Taponen, J.; Laitinen-Vapaavuori, O.; Katila, T. Oxytocin receptors in dioestrous and anoestrous canine uteri. Reprod. Domest. Anim. 2017, 52, 153–159. [Google Scholar] [CrossRef]
- Prapaiwan, N.; Manee-in, S.; Olanratmanee, E.; Srisuwatanasagul, S. Expression of oxytocin, progesterone, and estrogen receptors in the reproductive tract of bitches with pyometra. Theriogenology 2017, 89, 131–139. [Google Scholar] [CrossRef]
- Taylor, C.R.; Levenson, R.M. Quantification of immunohistochemistry—Issues concerning methods, utility and semiquantitative assessment II. Histopathology 2006, 49, 411–424. [Google Scholar] [CrossRef]
- Uvnäs-Moberg, K.; Stock, S.; Erikson, M.; Lindén, A.; Einarsson, S.; Kunavongkrit, A. Plasma levels of oxytocin increase in response to suckling and feeding in dogs and sows. Acta Physiol. Scand. 1985, 124, 391–398. [Google Scholar] [CrossRef]
- El Alj, A.; Bonoris, E.; Cynober, E.; Germain, G. Heterogeneity of oxytocin receptors in the pregnant rat myometrium near parturition. Eur. J. Pharmacol. 1990, 186, 231–238. [Google Scholar] [CrossRef]
- Lambert, F.L.; Pelletier, G.; Dufour, M.; Fortier, M.A. Specific properties of smooth muscle cells from different layers of rabbit myometrium. Am. J. Physiol. 1990, 258, C794–C802. [Google Scholar] [CrossRef]
- Taneike, T.; Miyazaki, H.; Nakamura, H.; Ohga, A. Autonomic innervation of the circular and longitudinal layers in swine myometrium. Biol. Reprod. 1991, 45, 831–840. [Google Scholar] [CrossRef] [Green Version]
- Gorriz Martin, L. An In Vitro Study on the Myometrial Contractility in Dairy Cattle before Calving and after Postpartum LPS Infusion. Relation to Blood Progesterone and Estradiol-17β Levels. Ph.D. Thesis, University of Veterinary Medicine Hannover, Hannover, Germany, 2013. [Google Scholar]
- Doualla-Bell, F.; Lye, S.J.; Labrie, F.; Fortier, M.A. Differential expression and regulation of connexin-43 and cell-cell coupling in myocytes from the circular and longitudinal layers of bovine myometrium. Endocrinology 1995, 136, 5322–5328. [Google Scholar] [CrossRef]
- Jungmann, C.; Mazzuoli-Weber, G.; Goericke-Pesch, S. Insight into canine uterine inertia—The organ bath as an ex vivo method for studying the contraction behaviour of canine pregnant myometrium responding to Oxytocin—Preliminary results. In Proceedings of the 23rd European Veterinary Society for Small Animal Reproduction (EVSSAR) Congress, Milano, Italy, 1–2 October 2021; Volume 57, p. 23. [Google Scholar]
- Gogny, A.; Mallem, Y.; Destrumelle, S.; Thorin, C.; Desfontis, J.C.; Gogny, M.; Fiéni, F. In vitro comparison of myometrial contractility induced by aglepristone-oxytocin and aglepristone-PGF2alpha combinations at different stages of the estrus cycle in the bitch. Theriogenology 2010, 74, 1531–1538. [Google Scholar] [CrossRef]
- Taverne, M.A.; Naaktgeboren, C.; Elsaesser, F.; Forsling, M.L.; van der Weyden, G.C.; Ellendorff, F.; Smidt, D. Myometrial electrical activity and plasma concentrations of progesterone, estrogens and oxytocin during late pregnancy and parturition in the miniature pig. Biol. Reprod. 1979, 21, 1125–1134. [Google Scholar] [CrossRef]
- Taverne, M.A.; van der Weyden, G.C.; Fontijne, P.; Ellendorff, F.; Naaktgeboren, C.; Smidt, D. Uterine position and presentation of minipig-fetuses and their order and presentation at birth. Am. J. Vet. Res. 1977, 38, 1761–1764. [Google Scholar]
- Taverne, M.A.M.; Naaktgeboren, C.; van der Weyden, G.C. Myometrial activity and expulsion of fetuses. Anim. Reprod. Sci. 1979, 2, 117–131. [Google Scholar] [CrossRef]
- Fuller, G.; McGee, G.; Nelson, J.; Willis, D.; Culpepper, J. Birth sequence in mice. Lab. Anim. Sci. 1976, 26, 198–200. [Google Scholar]
- Van Engelen, E.; Taverne, M.A.M.; Everts, M.E.; van der Weijden, G.C.; Doornenbal, A.; Breeveld-Dwarkasing, V.N.A. EMG activity of the muscular and stromal layer of the cervix in relation to EMG activity of the myometrium and cervical dilatation in PGF2α induced parturition in the cow. Theriogenology 2007, 67, 1158–1167. [Google Scholar] [CrossRef]
- Taverne, M.A.; van der Weijden, G.C. Parturition in domestic animals: Targets for future research. Reprod. Domest. Anim. 2008, 43 (Suppl. S5), 36–42. [Google Scholar] [CrossRef]
- Van der Weyden, G.C.V.; Taverne, M.A.M.; Okkens, A.C.; Fontijne, P. The intra-uterine position of canine foetuses and their sequence of expulsion at birth. J. Small Anim. Pract. 1981, 22, 503–510. [Google Scholar] [CrossRef] [PubMed]
- Peavey, M.C.; Wu, S.-P.; Li, R.; Liu, J.; Emery, O.M.; Wang, T.; Zhou, L.; Wetendorf, M.; Yallampalli, C.; Gibbons, W.E.; et al. Progesterone receptor isoform B regulates the Oxtr-Plcl2-Trpc3 pathway to suppress uterine contractility. Proc. Natl. Acad. Sci. USA 2021, 118, e2011643118. [Google Scholar] [CrossRef] [PubMed]
- Gracanin, A.; De Gier, J.; Zegers, K.; Bominaar, M.; Rutteman, G.; Schaefers-Okkens, A.; Kooistra, H.; Mol, J. Progesterone Receptor Isoforms in the Mammary Gland of Cats and Dogs. Reprod. Domest. Anim. 2012, 47, 313–317. [Google Scholar] [CrossRef] [PubMed]
- Vermeirsch, H.; Simoens, P.; Lauwers, H. Immunohistochemical detection of the estrogen receptor-α and progesterone receptor in the canine pregnant uterus and placental labyrinth. Anatom. Rec. 2000, 260, 42–50. [Google Scholar] [CrossRef]
- Kautz, E.; de Carvalho Papa, P.; Reichler, I.M.; Gram, A.; Boos, A.; Kowalewski, M.P. In vitro decidualisation of canine uterine stromal cells. Reprod. Biol. Endocrinol. 2015, 13, 85. [Google Scholar] [CrossRef] [Green Version]
- Hoffmann, B.; Kyrein, H.J.; Ender, M.L. An efficient procedure for the determination of progesterone by radioimmunoassay applied to bovine peripheral plasma. Horm. Res. 1973, 4, 302–310. [Google Scholar] [CrossRef]
- Borge, K.S.; Tønnessen, R.; Nødtvedt, A.; Indrebø, A. Litter size at birth in purebred dogs—A retrospective study of 224 breeds. Theriogenology 2011, 75, 911–919. [Google Scholar] [CrossRef]
- Nowak, M.; Aslan, S.; Kowalewski, M.P. Determination of novel reference genes for improving gene expression data normalization in selected canine reproductive tissues—A multistudy analysis. BMC Vet. Res. 2020, 16, 1–12. [Google Scholar] [CrossRef]
- Körber, H.; Goericke-Pesch, S. Expression of PTGS2, PGFS and PTGFR during downregulation and restart of spermatogenesis following GnRH agonist treatment in the dog. Cell Tissue Res. 2019, 375, 531–541. [Google Scholar] [CrossRef]
- Pfaffl, M.W. A new mathematical model for relative quantification in real-time RT-PCR. Nucleic Acids Res. 2001, 29, e45. [Google Scholar] [CrossRef]
- Hellemans, J.; Mortier, G.; De Paepe, A.; Speleman, F.; Vandesompele, J. qBase relative quantification framework and software for management and automated analysis of real-time quantitative PCR data. Genome Biol. 2007, 8, R19. [Google Scholar] [CrossRef] [Green Version]
- Jakobsson, U.; Westergren, A. Statistical methods for assessing agreement for ordinal data. Scand. J. Caring Sci. 2005, 19, 427–431. [Google Scholar] [CrossRef]
Primer | Accession Nr. | Forward Sequence (5′→3′) | Reverse Sequence (5′→3′) | Amplicon Length (bp) | Efficiency |
---|---|---|---|---|---|
OXTR | NM_001198659.1 | GGATCACGCTCTCCGTCTACA | CGTCTTGAGTCGCAGGTTCTG | 98 | 2.08 |
PGR | NM_001003074.1 | CGAGTCATTACCTCAGAAGATTTGTTT | CTTCCATTGCCCTTTTAAAGAAGA | 113 | 2.07 |
PTK2 | XM_038685127.1 | AGATGCTGACCGCTGCTCAT | TCAGTGTGGCCTCGTTGGTC | 104 | 1.98 |
GAPDH | NM_001003142 | GGCCAAGAGGGTCATCATCTC | GGGGCCGTCCACGGTCTTC | 229 | 1.93 |
EIF4H | XM_038667880.1 | GGAGTGTGCGGCTAGTCAGA | ACCCAACAGTGCACCATCGTA | 199 | 1.97 |
KDM4A | XM_038687969.1 | CCCGGCGGTGGATTGAGTAT | AACTCGGCTGCTTCTGGTGT | 181 | 2.04 |
Antibody | Source | Clone | Dilution (µg/µL) | SKU | Secondary Antibody | Isotype Control |
---|---|---|---|---|---|---|
OXTR | Rabbit | Monoclonal | 0.02 | ab217212 * | n.a. 1 | Rabbit IgG *** (I-1000 Control Antibody) |
PGR | Mouse | Monoclonal | 0.02 | PRAT 4.14 ** | Horse anti-mouse *** (BA-2000) | Mouse IgG *** (I-2000 Control Antibody) |
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations. |
© 2022 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Jungmann, C.; Houghton, C.G.; Nielsen, F.G.; Packeiser, E.-M.; Körber, H.; Reichler, I.M.; Balogh, O.; Goericke-Pesch, S. Involvement of Oxytocin and Progesterone Receptor Expression in the Etiology of Canine Uterine Inertia. Int. J. Mol. Sci. 2022, 23, 13601. https://doi.org/10.3390/ijms232113601
Jungmann C, Houghton CG, Nielsen FG, Packeiser E-M, Körber H, Reichler IM, Balogh O, Goericke-Pesch S. Involvement of Oxytocin and Progesterone Receptor Expression in the Etiology of Canine Uterine Inertia. International Journal of Molecular Sciences. 2022; 23(21):13601. https://doi.org/10.3390/ijms232113601
Chicago/Turabian StyleJungmann, Carolin, Caroline Gauguin Houghton, Frederik Goth Nielsen, Eva-Maria Packeiser, Hanna Körber, Iris M. Reichler, Orsolya Balogh, and Sandra Goericke-Pesch. 2022. "Involvement of Oxytocin and Progesterone Receptor Expression in the Etiology of Canine Uterine Inertia" International Journal of Molecular Sciences 23, no. 21: 13601. https://doi.org/10.3390/ijms232113601
APA StyleJungmann, C., Houghton, C. G., Nielsen, F. G., Packeiser, E.-M., Körber, H., Reichler, I. M., Balogh, O., & Goericke-Pesch, S. (2022). Involvement of Oxytocin and Progesterone Receptor Expression in the Etiology of Canine Uterine Inertia. International Journal of Molecular Sciences, 23(21), 13601. https://doi.org/10.3390/ijms232113601