Germplasm Screening Using DNA Markers and Genome-Wide Association Study for the Identification of Powdery Mildew Resistance Loci in Tomato
Abstract
:1. Introduction
2. Results
2.1. Pathogen Identification
2.2. PM Bioassay
2.3. Validation of the PMR-Linked Markers
2.4. Quality Evaluation of the Raw SNP Genotyping Data
2.5. Homology Analysis of the SNP-Flanking Probe Sequence among Species
2.6. SNP Validation Based on Cleaved Amplified Polymorphic Sequence (CAPS) and Derived Cleaved Amplified Polymorphic Sequence (dCAPS) Markers
2.7. SNP Filtering for Population Structure and GWAS
2.8. Population Structure Analysis
2.9. GWAS for PMR
2.10. Putative Candidate Genes for PMR
3. Discussion
4. Materials and Methods
4.1. Plant Materials
4.2. Pathogen Identification
4.2.1. Pathogen Isolation and Genomic DNA Extraction
4.2.2. Sequencing of the ITS Region of the Pathogen
4.2.3. Pathogen Identification
4.3. PM Bioassay
4.4. Evaluation of PMR-Linked Molecular Markers
4.5. SNP Genotyping Using the Axiom® Tomato Genotyping Array
4.6. SNP Genotyping Data QC and SNP Filtering
4.7. SNP Conversion to CAPS and dCAPS Markers
4.8. GWAS
4.8.1. Accessions and SNP Filtering
4.8.2. Population Structure Analysis
4.8.3. GWAS Analysis
4.8.4. Candidate Gene Selection
Supplementary Materials
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Conflicts of Interest
References
- Jones, H.; Whipps, J.; Gurr, S. The tomato powdery mildew fungus Oidium neolycopersici. Mol. Plant Pathol. 2001, 2, 303–309. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Lebeda, A.; Mieslerova, B.; Petrivalsky, M.; Luhová, L.; Spundova, M.; Sedlarova, M.; Nožková, V.; Pink, D. Review of tomato powdery mildew—A challenging problem for researchers, breeders and growers. Acta Hortic. 2017, 1159, 107–116. [Google Scholar] [CrossRef]
- Lebeda, A.; Mieslerová, B.; Petrivalsky, M.; Luhová, L.; Spundova, M.; Sedlarova, M.; Nožková, V.; Pink, D. Resistance mechanisms of wild tomato germplasm to infection of Oidium neolycopersici. Eur. J. Plant Pathol. 2013, 138, 569–596. [Google Scholar] [CrossRef] [Green Version]
- Baudoin, W.; Nersisyan, A.; Shamilov, A.; Hodder, A.; Gutierrez, D.; De Pascale, S.; Nicola, S.; Gruda, N.; Urban, L.; Tanny, J. Good Agricultural Practices for Greenhouse Vegetable Production in the South East European Countries—Principles for Sustainable Intensification of Smallholder Farms; FAO: Rome, Italy, 2017. [Google Scholar]
- Seifi, A.; Gao, D.; Zheng, Z.; Pavan, S.; Faino, L.; Visser, R.; Wolters, A.-M.; Ba, Y. Genetics and molecular mechanisms of resistance to powdery mildews in tomato (Solanum lycopersicum) and its wild relatives. Eur. J. Plant Pathol. 2013, 138, 641–665. [Google Scholar] [CrossRef] [Green Version]
- Bai, Y.; van der Hulst, R.; Bonnema, G.; Marcel, T.; Meijer-Dekens, F.; Niks, R.; Lindhout, P. Tomato defense to Oldium neolycopersici: Dominant Ol genes confer isolate-dependent resistance via a different mechanism than recessive ol-2. Mol. Plant Microbe Interact. 2005, 18, 354–362. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Bai, Y.; Huang, C.-C.; van der Hulst, R.; Meijer-Dekens, F.; Bonnema, G.; Lindhout, P. QTLs for tomato powdery mildew resistance (Oidium lycopersici) in Lycopersicon parviflorum G1.1601 co-localize with two qualitative powdery mildew resistance genes. Mol. Plant Microbe Interact. 2003, 16, 169–176. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Faino, L.; Shiva, B.; Bullet, A.; Houshyani, B.; Bullet, H.; Verzaux, E.; Maria, B.; Raffaella, E.; Bullet, R.; Visser, R.; et al. Fine mapping of two major QTLs conferring resistance to powdery mildew in tomato. Euphytica 2011, 184, 223–234. [Google Scholar] [CrossRef] [Green Version]
- Ciccarese, F.; Amenduni, M.; Schiavone, D.; Cirulli, M. Occurrence and inheritance of resistance to powdery mildew (Oidium lycopersici) in Lycopersicon species. Plant Pathol. 2002, 47, 417–419. [Google Scholar] [CrossRef]
- Bai, Y.; Pavan, S.; Zheng, Z.; Zappel, N.; Reinstädler, A.; Lotti, C.; De Giovanni, C.; Ricciardi, L.; Lindhout, P.; Visser, R.; et al. Naturally occurring broad-spectrum powdery mildew resistance in a Central American tomato accession is caused by loss of Mlo Function. Mol. Plant Microbe Interact. 2008, 21, 30–39. [Google Scholar] [CrossRef] [Green Version]
- Zheng, Z.; Appiano, M.; Pavan, S.; Bracuto, V.; Ricciardi, L.; Visser, R.; Wolters, A.-M.; Bai, Y. Genome-wide study of the tomato SlMLO gene family and its functional characterization in response to the powdery mildew fungus Oidium neolycopersici. Front. Plant Sci. 2016, 7, 380. [Google Scholar] [CrossRef]
- Kaler, A.; Gillman, J.; Beissinger, T.; Purcell, L. Comparing different statistical models and multiple testing corrections for association mapping in soybean and maize. Front. Plant Sci. 2020, 10, 1794. [Google Scholar] [CrossRef] [Green Version]
- Norrgard, K. Genetic variation and disease: GWAS. Nat. Educ. 2022, 1, 87. [Google Scholar]
- Gorjanc, G.; Cleveland, M.; Houston, R. Potential of genotyping-by-sequencing for genomic selection in livestock populations. Genet. Sel. Evol. 2015, 47, 12. [Google Scholar] [CrossRef]
- Darrier, B.; Russell, J.; Milner, S.G.; Hedley, P.E.; Shaw, P.D.; Macaulay, M.; Ramsay, L.D.; Halpin, C.; Mascher, M.; Fleury, D.L.; et al. A comparison of mainstream genotyping platforms for the evaluation and use of barley genetic resources. Front. Plant Sci. 2019, 10, 544. [Google Scholar] [CrossRef] [Green Version]
- Anderson, R.; Edwards, D.; Batley, J.; Bayer, P. Genome-Wide Association Studies in Plants; John Wiley & Sons, Ltd (Ed): Hoboken, NJ, USA, 2019; pp. 1–7. [Google Scholar]
- He, Y.; Wu, D.; Wei, D.; Fu, Y.; Cui, Y.; Dong, H.; Tan, C.; Qian, W. GWAS, QTL mapping and gene expression analyses in Brassica napus reveal genetic control of branching morphogenesis. Sci. Rep. 2017, 7, 15971. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Zhang, H.; Chu, Y.; Dang, P.; Tang, Y.; Jiang, T.; Clevenger, J.; Ozias-Akins, P.; Holbrook, C.; Wang, M.; Campbell, H.; et al. Identification of QTLs for resistance to leaf spots in cultivated peanut (Arachis hypogaea L.) through GWAS analysis. Theor. Appl. Genet. 2020, 133, 2051–2061. [Google Scholar] [CrossRef] [PubMed]
- Chen, S.; Cheng, X.; Yu, K.; Chang, X.; Bi, H.; Xu, H.; Wang, J.; Pei, X.; Zhang, Z.; Zhan, K. Genome-wide association study of differences in 14 agronomic traits under low- and high-density planting models based on the 660k SNP array for common wheat. Plant Breed. 2019, 139, 272–283. [Google Scholar] [CrossRef]
- Sim, S.-C.; Durstewitz, G.; Plieske, J.; Wieseke, R.; Ganal, M.; Deynze, A.; Hamilton, J.; Buell, C.; Causse, M.; Wijeratne, S.; et al. Development of a large SNP genotyping array and generation of high-density genetic maps in tomato. PLoS ONE 2012, 7, e40563. [Google Scholar] [CrossRef]
- Yamamoto, E.; Matsunaga, H.; Onogi, A.; Kajiya-Kanegae, H.; Minamikawa, M.; Suzuki, A.; Shirasawa, K.; Hirakawa, H.; Nunome, T.; Yamaguchi, H.; et al. A simulation-based breeding design that uses whole-genome prediction in tomato. Sci. Rep. 2016, 6, 19454. [Google Scholar] [CrossRef] [Green Version]
- Zhao, J.; Sauvage, C.; Zhao, J.; Bitton, F.; Bauchet, G.; Liu, D.; Huang, S.; Tieman, D.; Klee, H.; Causse, M. Meta-analysis of genome-wide association studies provides insights into genetic control of tomato flavor. Nat. Commun. 2019, 10, 1534. [Google Scholar] [CrossRef] [Green Version]
- Ruggieri, V.; Francese, G.; Sacco, A.; D’Alessandro, A.; Rigano, M.; Parisi, M.; Milone, M.; Cardi, T.; Mennella, G.; Barone, A. An association mapping approach to identify favourable alleles for tomato fruit quality breeding. BMC Plant Biol. 2014, 14, 337. [Google Scholar] [CrossRef] [PubMed]
- Kiss, L.; Cook, R.; Saenz, G.; Cunnington, J.; Takamatsu, S.; Pascoe, I.; Bardin, M.; Nicot, P.; Sato, Y.; Rossman, A. Identification of two powdery mildew fungi, Oidium neolycopersici sp. nov. and O. lycopersici, infecting tomato in different parts of the world. Mycol. Res. 2001, 105, 684–697. [Google Scholar] [CrossRef]
- Schwarz, D.; Thompson, A.; Kläring, H.-P. Guidelines to use tomato in experiments with a controlled environment. Front. Plant Sci. 2014, 5, 625. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Liu, N.; Bai, G.; Lin, M.; Xu, X.; Zheng, W. Genome-wide association analysis of powdery mildew resistance in U.S. winter wheat. Sci. Rep. 2017, 7, 11743. [Google Scholar] [CrossRef] [Green Version]
- Bengtsson, T.; Åhman, I.; Manninen, O.; Reitan, L.; Christerson, T.; Jensen, J.; Krusell, L.; Jahoor, A.; Orabi, J. A novel QTL for powdery mildew resistance in nordic spring barley (Hordeum vulgare L. ssp. vulgare) revealed by Genome-wide association study. Front. Plant Sci. 2017, 8, 1954. [Google Scholar] [CrossRef] [Green Version]
- Montilla-Bascón, G.; Rispail, N.; Sánchez-Martín, J.; Rubiales, D.; Mur, L.; Langdon, T.; Howarth, C.; Prats, E. Genome-wide association study for crown rust (Puccinia coronata f. sp. avenae) and powdery mildew (Blumeria graminis f. sp. avenae) resistance in an oat (Avena Sativa) collection of commercial varieties and landraces. Front. Plant Sci. 2015, 6, 103. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Alexander, L.J.; Hoover, M.M. Disease Resistance in wild species of tomato. In North Central Regional Publication; Ohio Agricultural Experiment Station: Wooster, OH, USA, 1955; p. 51. [Google Scholar]
- Lee, J.; Oh, C.-S.; Yeam, I. Molecular markers for selecting diverse disease resistances in tomato breeding programs. Plant Breed. Biotech. 2015, 3, 308–322. [Google Scholar] [CrossRef] [Green Version]
- Bitew, M. Vital fungal resistance gene of tomato: Identified genes in the wild source of tomato. J. Biol. Agric. Healthc. 2019, 9, 6. [Google Scholar] [CrossRef]
- Arens, P.; Mansilla, C.; Deinum, D.; Cavellini, L.; Moretti, A.; Rolland, S.; Schoot, H.; Calvache, D.; Ponz, F.; Collonnier, C.; et al. Development and evaluation of robust molecular markers linked to disease resistance in tomato for distinctness, uniformity and stability testing. Theor. Appl. Genet. 2009, 120, 655–664. [Google Scholar] [CrossRef] [Green Version]
- Pei, C.; Wang, H.; Zhang, J.; Wang, Y.; Francis, D.; Yang, W. Fine mapping and analysis of a candidate gene in tomato accession PI128216 conferring hypersensitive resistance to bacterial spot race T3. Theor. Appl. Genet. 2012, 124, 533–542. [Google Scholar] [CrossRef]
- Sharlach, M.; Dahlbeck, D.; Liu, L.; Chiu, J.; Jiménez-Gómez, J.; Kimura, S.; Koenig, D.; Maloof, J.; Sinha, N.; Minsavage, G.; et al. Fine genetic mapping of RXopJ4, a bacterial spot disease resistance locus from Solanum pennellii LA716. Theor. Appl. Genet. 2012, 126, 601–609. [Google Scholar] [CrossRef] [PubMed]
- Ho, J.-Y.; Weide, R.; Ma, H.; Wordragen, M.; Lambert, K.; Koornneef, M.; Zabel, P.; Williamson, V. The root-knot nematode resistance gene (Mi) in tomato: Construction of a molecular linkage map and identification of dominant cDNA markers in resistant genotypes. Plant J. 1992, 2, 971–982. [Google Scholar] [CrossRef] [PubMed]
- Lindhout, P.; Pet, G.; Beek, H. Screening wild Lycopersicon species for resistance to powdery mildew (Oidium lycoperiscum). Euphytica 1993, 72, 43–49. [Google Scholar] [CrossRef]
- Singh, A.; Singh, P.K.; Arya, M.; Singh, N.; Singh, U. Molecular screening of blast resistance genes in rice using SSR markers. Plant Pathol. J. 2015, 31, 12–24. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Siddique, M.; Lee, H.-Y.; Ro, N.-Y.; Han, K.; Venkatesh, J.; Mekonnen, S.; Patil, A.; Changkwian, A.; Kwon, J.-K.; Kang, B.-C. Identifying candidate genes for Phytophthora capsici resistance in pepper (Capsicum annuum) via genotyping-by-sequencing-based QTL mapping and genome-wide association study. Sci. Rep. 2019, 9, 9962. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Su, X.; Zhu, G.; Huang, Z.; Wang, X.; Guo, Y.; Li, B.; Du, Y.; Yang, W.; Gao, J. Fine mapping and molecular marker development of the Sm gene conferring resistance to gray leaf spot (Stemphylium spp.) in tomato. Theor. Appl. Genet Genet. 2019, 132, 871–882. [Google Scholar] [CrossRef] [PubMed]
- Fadista, J.; Manning, A.; Florez, J.; Groop, L. The (in)famous GWAS P-value threshold revisited and updated for low-frequency variants. Eur. J. Hum. Genet. 2016, 24, 1202–1205. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Lazzeroni, L.; Lu, Y.; Belitskaya-Levy, I. P-values in genomics: Apparent precision masks high uncertainty. Mol. Psychiatr. 2014, 19, 1336–1340. [Google Scholar] [CrossRef]
- Dangl, J.; Horvath, D.; Staskawicz, B. Pivoting the plant immune system from dissection to deployment. Science 2013, 341, 746–751. [Google Scholar] [CrossRef] [Green Version]
- Afzal, A.; Wood, A.; Lightfoot, D. Plant receptor-like serine threonine kinases: Roles in signaling and plant defense. Mol. Recent. Adv. Phytochem. 2008, 21, 507–517. [Google Scholar] [CrossRef] [Green Version]
- Dubey, N.; Singh, K. Role of NBS-LRR proteins in plant defense. In Molecular Aspects of Plants-pathogen Interaction; Springer Nature: Berlin, Germany, 2018; pp. 115–138. [Google Scholar]
- Wei, F.; Gobelman-Werner, K.; Morroll, S.; Kurth, J.; Mao, L.; Wing, R.; Leister, D.; Schulze-Lefert, P.; Wise, R. The Mla (Powdery mildew) resistance cluster is associated with three NBS-LRR gene families and suppressed recombination within a 240-kb DNA interval on chromosome 5S (1HS) of barley. Genetics 2000, 153, 1929–1948. [Google Scholar] [CrossRef] [PubMed]
- Coleman, C.; Copetti, D.; Cipriani, G.; Hoffmann, S.; Kozma, P.; Kovacs, L.; Morgante, M.; Testolin, R.; di Gaspero, G. The powdery mildew resistance gene REN1 co-segregates with an NBS-LRR gene cluster in two Central Asian grapevines. BMC Genet. 2009, 10, 89. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Yang, S.; Tang, F.; Caixeta, E.; Zhu, H. Epigenetic regulation of a powdery mildew resistance gene in Medicago truncatula. Mol. Plant 2013, 6, 2000–2003. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Martin, G.; Brommonschenkel, S.; Chunwongse, J.; Frary, A.; Ganal, M.; Spivey, R.; Wu, T.; Earle, E.; Tanksley, S. Map-based cloning of a protein kinase gene conferring disease resistance in tomato. Science 1993, 262, 1432–1436. [Google Scholar] [CrossRef]
- Zhou, J.-M.; Loh, Y.-T.; Bressan, R.; Martin, G. The tomato gene Pti1 encodes a serine/threonine kinase that is phosphorylated by Pto and is involved in the hypersensitive response. Cell 1996, 83, 925–935. [Google Scholar] [CrossRef] [Green Version]
- Sessa, G.; Martin, G. Signal recognition and transduction mediated by the tomato Pto kinase: A paradigm of innate immunity in plants. Microbes Infect. 2000, 2, 1591–1597. [Google Scholar] [CrossRef]
- Chandra, S.; Martin, G.; Low, P. The Pto kinase mediates a signal pathway leading to the oxidative burst in tomato. Proc. Natl. Acad. Sci. USA 1996, 93, 13393–13397. [Google Scholar] [CrossRef] [Green Version]
- Cao, A.; Xing, L.; Wang, X.; Yang, X.; Wang, W.; Sun, Y.; Qian, C.; Ni, J.; Chen, Y.; Liu, D.; et al. Serine/threonine kinase gene Stpk-V, a key member of powdery mildew resistance gene Pm21, confers powdery mildew resistance in wheat. Proc. Natl. Acad. Sci. USA 2011, 108, 7727–7732. [Google Scholar] [CrossRef] [Green Version]
- Santillán, M.I.; Bracuto, V.; Koseoglou, E.; Appiano, M.; Jacobsen, E.; Visser, R.; Wolters, A.; Bai, Y. CRISPR/Cas9-targeted mutagenesis of the tomato susceptibility gene PMR4 for resistance against powdery mildew. BMC Plant Biol. 2020, 20, 284. [Google Scholar] [CrossRef]
- Pramanik, D.; Shelake, R.M.; Park, J.; Kim, M.J.; Hwang, I.; Park, Y.; Kim, J.-Y. CRISPR/Cas9-Mediated Generation of Pathogen-Resistant Tomato against Tomato Yellow Leaf Curl Virus and Powdery Mildew. Int. J. Mol. Sci. 2021, 22, 1878. [Google Scholar] [CrossRef]
- Yan, Z.; Appiano, M.; van Tuinen, A.; Meijer-Dekens, F.; Schipper, D.; Gao, D.; Huibers, R.; Visser, R.G.F.; Bai, Y.; Wolters, A.-M.A. Discovery and Characterization of a Novel Tomato mlo Mutant from an EMS Mutagenized Micro-Tom Population. Genes 2021, 12, 719. [Google Scholar] [CrossRef] [PubMed]
- Zhang, Y.; Xu, K.; Pei, D.; Yu, D.; Zhang, J.; Li, X.; Chen, G.; Yang, H.; Zhou, W.; Li, C. ShORR-1, a Novel Tomato Gene, Confers Enhanced Host Resistance to Oidium neolycopersici. Front. Plant Sci. 2019, 10, 1400. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Chunwongse, J.; Bunn, T.B.; Crossman, C.; Jiang, J.; Tanksley, S. Chromosomal localization and molecular-marker tagging of the powdery mildew resistance gene (Lv) in tomato. Theor. Appl. Genet. 1994, 89, 76–79. [Google Scholar] [CrossRef] [PubMed]
- Chunwongse, J.; Doganlar, S.; Crossman, C.; Jiang, J.; Tanksley, S. High-resolution genetic map the Lv resistance locus in tomato. Theor. Appl. Genet. 1997, 95, 220–223. [Google Scholar] [CrossRef]
- Kim, D.; Jin, B.; Je, B.; Choi, Y.; Kim, B.-S.; Jung, H.-J.; Nou, I.-S.; Park, Y. Development of DNA markers for Slmlo1.1, a new mutant allele of the powdery mildew resistance gene SlMlo1 in tomato (Solanum lycopersicum). Genome 2018, 61, 703–712. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Thompson, J.; Higgins, D.; Gibson, T. W: CLUSTAL. Improving the sensitivity of progressive multiple sequence alignment through sequence weighting, position specific gap penalties and weight matrix choice. Nucleic Acids Res. 1994, 22, 4673–4680. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Kumar, S.; Stecher, G.; Li, M.; Knyaz, C.; Tamura, K. MEGA X: Molecular evolutionary genetics analysis across computing platforms. Mol. Biol. Evol. 2018, 35, 1547. [Google Scholar] [CrossRef] [PubMed]
- Saitou, N.M.; Nei, M. The Neighbor-Joining Method: A new method for reconstructing phylogenetic trees. Mol. Biol. Evol. 1987, 24, 189–204. [Google Scholar] [CrossRef]
- Jukes, T.; Cantor, C. Evolution of Protein Molecules in Mammalian Protein Metabolism III; Academic Press: New York, NY, USA, 1969; p. 3. [Google Scholar]
- Ullah, N.; Ali, A.; Ahmad, M.; Fahim, M.; Din, N.; Ahmad, F. Evaluation of tomato genotypes against Tomato mosaic virus (ToMV) and its effect on yield contributing parameters. Pak. J. Bot. 2017, 49, 1585–1592. [Google Scholar]
- Langmead, B.; Salzberg, S.L. Fast gapped-read alignment with Bowtie 2. Nat. Methods 2012, 9, 357–359. [Google Scholar] [CrossRef] [Green Version]
- Pritchard, J.; Mj, S.; Donnelly, P.J. Inference of population structure using multilocus genotype data. Genetics 2000, 155, 945–959. [Google Scholar] [CrossRef] [PubMed]
- Evanno, G.; Regnaut, S.; Goudet, J. Detecting the number of clusters of individuals using the software STRUCTURE: A simulation study. Mol. Ecol. 2005, 14, 2611–2620. [Google Scholar] [CrossRef] [PubMed]
- VanRaden, P. Efficient methods to compute genomic predictions. J. Dairy Sci. 2008, 91, 4414–4423. [Google Scholar] [CrossRef] [Green Version]
- Bradbury, P.; Zhang, Z.; Kroon, D.; Casstevens, T.; Ramdoss, Y.; Buckler, E. TASSEL: Software for association mapping of complex traits in diverse samples. Bioinformatics 2007, 23, 2633–2635. [Google Scholar] [CrossRef] [PubMed]
- Lipka, A.; Tian, F.; Wang, Q.; Peiffer, J.; Li, M.; Bradbury, P.; Gore, M.; Buckler, E.; Zhang, Z. GAPIT: Genome association and prediction integrated tool. Bioinformatics 2012, 28, 2397–2399. [Google Scholar] [CrossRef] [PubMed]
Accession | Species | PDI (%) | Expected PMR Locus | P1349 (Ol-1,3) 1 | H9A11 (Ol-1,3) | M/Slmlo1 [ol-2 (Slmlo1)] | dCAPS_ Slmlo1.1 [ol-2 (Slmlo1.1)] | GP79L (Ol-4,6) | 32.5Cla (Ol-4,6) | TG25 (Ol-5) | P21M47 (Ol-5, Ol-qtl1) | dCT136 (Ol-qtl1) | Y258 (Ol-qtl3) | TG111 (Ol-qtl3) |
---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
KNU17 | S. lycopersicum | 0.00 | ol-2 (Slmlo1.1) | 300/200 | 450 | 197 | 200 | 1200 /1000 | 773 | 300 | 226/90 | 150 | 137 | 397 |
LA1141 | S. galapagense | 0.00 | 300/200 | 425 | 197 | 170/30 | 750/600 | 320/120 | 300 | 196/90 | 150 | 110/26 | 397 | |
LA1272 | S. pennellii | 0.00 | 500/300 /200 | 450 | 197 | 170/30 | 1000 | 700 | 320 | 316/196/ 120 | 180 | 110 | N/A | |
LA1274 | S. cornerliomulleri | 0.00 | Ol-5/ Ol-qtl1,3 | 500/300 /200 | 425 | 197 | 170/30 | 1100/ 1000 | 773/460/ 230 | 350 | 196/120 | 180 | 110/26 | 1000 |
LA1674 | S. pennellii | 0.00 | Ol-qtl1,3 | 500/300 /200 | 425 | 197 | 170/30 | 1000 | 700 | 320 | 196/120 | 180 | 110/26 | 1000 |
LA1809 | S. pennellii | 0.00 | Ol-qtl1,3 | 500/300 /200 | 450/425 | 197 | 170/30 | 1000 | 700 | 320 | 196/120 | 180 | 110/26 | 1000 |
LA1963 | S. chilense | 0.00 | 500/300 /200 | 425 | 197 | 170/30 | 1200/ 1000/900 | 773/460/320 | 350/300 | 316/196 /120 | 180/150 | multi band | 1000 | |
LA2181 | S.pimpinellifolium | 0.00 | 300/200 | 430 | 197 | 170/30 | 1000/750 | 773 | 300 | 226/90 | 150 | 137 | 397 | |
LA2663 | S. chmielewskii | 0.00 | Ol-5 / Ol-qtl1,3 | 300/200 | N/A | 197 | 170/30 | N/A 2 | 320/120 | 350 | 196/120 | 180 | 110/26 | 1000 |
LA2744 | S.peruvianum | 0.00 | Ol-qtl3 | 500/450/300/200 | 450/430/420 | 197 | 170/30 | 1200/ 1000 | 773/570/ 470/320/ 260/220 | N/A | 196/120 | 180/150 | 110/26 | 1000 |
LA2932 | S. chilense | 0.00 | 300/200 | 450 | 197 | 170/30 | 1200/ 1100 | 773/460/ 320 | 310 | 316/196/ 120 | 180 | multi band | 1000 | |
PI126445 | S. habrochaites | 0.00 | Ol-4,6/ Ol-5/ Ol-qtl3 | 500 | 430 | 197 | 170/30 | 1200/ 1000 | 320/120 | 350 | 196/120 | N/A | 110/26 | 1000 |
A1161 | S. lycopersicum | 0.00 | 300/200 | 450 | 197 | 170/30 | 1000/750 | 773 | 300 | 226/90 | 150 | 137 | 397 | |
A1162 | S. lycopersicum | 0.00 | 300/200 | 450 | 197 | 170/30 | 1000/750 | 773 | 300 | 226/90 | 150 | 137 | 397 | |
A1216 | S. lycopersicum | 0.00 | 300/200 | 450 | 197 | 170/30 | 1000/750 | 773 | 300 | 226/90 | 150 | 137 | 397 | |
KNU16 | S. lycopersicum | 4.76 | ol-2 (Slmlo1.1) | 300/200 | 450 | 197 | 200 | 1100/750 | 773 | 300 | 226/90 | 150 | 137 | 397 |
LA0716 | S. pennellii | 4.76 | Ol-1,3/ Ol-qtl1,3 | 500 | 450 | 197 | 170/30 | 1000 | 320/120 | 320 | 196/120 | 180 | 110/26 | 1000 |
LA1340 | S. pennellii | 5.56 | Ol-qtl3 | 300/200 | 450 | 197 | 170/30 | 1000 | 700 | 320 | 316/196/ 120 | 180 | 110/26 | 1000 |
LA2184 | S. pimpinellifolium | 5.56 | 300/200 | 450 | 197 | 170/30 | 750 | 773 | 300 | 226/90 | 150 | 137 | 397 | |
PI308182 | S. habrochaites | 6.67 | Ol-5/ Ol-qtl3 | 500 | 430 | 197 | 170/30 | 1000 | 773/700/ 320/120 | 350 | 196/120 | N/A | 110/26 | 1000 |
PI134418 | S. habrochaites | 8.33 | Ol-1,3/ Ol-5 | 500 | 400 | 197 | 170/30 | N/A | 773/700/ 320/120 | 350 | 196/120 | N/A | multi band | N/A |
A1164 | S. lycopersicum | 9.52 | 300/200 | 450 | 197 | 170/30 | 1000/850/750 | 773 | 300 | 226/90 | 150 | 137 | 1400/397 | |
LA0458 (Lv) | S. chilense | 0.00 | 300/200 | 450 | 197 | 170/30 | 1100/1000 | 460/320 | 280 | 196/120 | 150 | multi band | 1000 | |
LA1969 (Lv) | S. chilense | 0.00 | Ol-qtl1 | 300/200 | 450 | 197 | 170/30 | 1000 | 320/120 | 350 | 196/120 | 180 | multi band | 1000 |
LA2172 (Ol-4) | S. peruvianum | 20.82 | Ol-4,6/ Ol-5/ Ol-qtl3 | 300/200 | N/A | 197 | 170/30 | 1200/ 1000 | 320/120 | 350 | 196/120 | 150 | 110/26 | 1000 |
PI247087 (Ol-5) | S. habrochaites | 40.00 | Ol-5 | 500 | 425 | 197 | 170/30 | 1000 | 320/120 | 350 | 196/120 | N/A | multi band | 1000 |
PNU-PMS | S. lycopersicum | 66.67 | 300/200 | 450 | 197 | 170/30 | 1000/750 | 773 | 300 | 226/90 | 150 | 137 | 397 | |
Money Maker | S. lycopersicum | 100.00 | 300/200 | 450 | 197 | 170/30 | 1000/750 | 773 | 300 | 226/90 | 150 | 137 | 397 |
Species (Number of Accessions) | DQC 1 | Call Rate (%) | Heterozygosity Rate (%) |
---|---|---|---|
S. lycopersicum (34) | 0.95 | 96.29 | 5.43 |
S. lycopersicum (habrochaites ILs 2) (10) | 0.96 | 96.56 | 4.29 |
S. lycopersicum (lycopersicoides ILs) (31) | 0.99 | 95.76 | 5.85 |
S. lycopersicum var. cerasiforme (50) | 0.79 | 95.57 | 7.44 |
S. cheesmaniae (1) | 0.15 | 95.31 | 7.74 |
S. galapagense (1) | 0.14 | 95.51 | 7.53 |
S. pimpinellifolium (18) | 0.10 | 94.21 | 14.88 |
S. neorickii (2) | 0.04 | 91.85 | 25.22 |
S. chmielewskii (2) | 0.04 | 91.02 | 26.87 |
S. habrochaites (8) | 0.03 | 91.00 | 33.44 |
S. pennellii (10) | 0.03 | 90.88 | 31.76 |
S. peruvianum (2) | 0.03 | 90.33 | 29.85 |
S. chilense (6) | 0.04 | 90.56 | 31.12 |
S. arcanum (3) | 0.04 | 91.61 | 24.68 |
S. corneliomulleri (3) | 0.04 | 90.68 | 27.42 |
S. huaylasense (1) | 0.04 | 90.06 | 28.10 |
Sample | Species | PDI (%) | SNPs | |||||
---|---|---|---|---|---|---|---|---|
AX-95781451 | AX-95767557 | AX-95784118 | AX-95773152 | AX-95809776 | AX-95814666 | |||
KNU17 | S. lycopersicum | 0.00 | GG | CC | AA | AA(GG) 1 | TT | CC |
LA1141 | S. galapagense | 0.00 | GG | CG(GG) | AA | GG | TT | CC |
LA1272 | S. pennellii | 0.00 | AG(AA) | GG | AA(AG) | AG(GG) | TT | CT(TT) |
LA1274 | S. cornerliomulleri | 0.00 | AA | GG(CG) | AG | AG(GG) | NA 2 (TT) | NA(CC) |
LA1674 | S. pennellii | 0.00 | NA(AA) | GG | AG(GG) | AG(GG) | AT(TT) | CT(TT) |
LA1809 | S. pennellii | 0.00 | AG(AA) | GG | AA | AG(GG) | AT(TT) | CT(TT) |
LA1963 | S. chilense | 0.00 | AG(AA) | GG | GG | AG(GG) | TT | CT(TT) |
LA2181 | S. pimpinellifolium | 0.00 | GG | CG(GG) | AA | AG(GG) | TT | CC |
LA2663 | S. chmielewskii | 0.00 | NA (AA) | CG(GG) | NA(GG) | AG(GG) | AT(TT) | NA(CC) |
LA2744 | S. peruvianum | 0.00 | NA(AA) | NA(GG) | AG(GG) | AG(GG) | AT(TT) | CT |
LA2932 | S. chilense | 0.00 | AG(AA) | GG | AG(GG) | AG(GG) | TT | CT(TT) |
PI126445 | S. habrochaites | 0.00 | AA | GG | AG | AG(GG) | AT(TT) | CT(TT) |
A1161 | S. lycopersicum | 0.00 | GG | CC | GG | AG(GG) | TT | CT |
A1162 | S. lycopersicum | 0.00 | GG | CC | GG | AG(GG) | TT | TT(CT) |
A1216 | S. lycopersicum | 0.00 | GG | CC | GG | GG | AA | CC |
KNU16 | S. lycopersicum | 4.76 | GG | CC | AA | AA | TT | CC |
LA0716 | S. pennellii | 4.76 | AG(AA) | GG | NA(AA) | AG(GG) | NA(TT) | CT(TT) |
LA1340 | S. pennellii | 5.56 | AG(AA) | GG | AA(AG) | AG(GG) | AT(TT) | CT(TT) |
LA2184 | S. pimpinellifolium | 5.56 | GG(AG) | CC | NA(GG) | AG(GG) | NA(TT) | CC |
PI308182 | S. habrochaites | 6.67 | AA | GG | AG(GG) | AG(GG) | AT(TT) | CT(TT) |
PI134418 | S. habrochaites | 8.33 | AA | GG | NA(AG) | AG(GG) | AT(TT) | CT(TT) |
A1164 | S. lycopersicum | 9.52 | GG | CC | GG | AG(GG) | TT | TT |
Marker | Primer Sequence (5’-3’) | Location (Chr, bp) 1 | Tm (°C) | Marker Type 2 (Enzyme) | Target Locus | Reference |
---|---|---|---|---|---|---|
P1349 | F:TGCTAAGAATCAGAAACCACACCT | Chr6 (Long arm) | 56 | CAPS | Ol-1,3 | Bai et al. [6] |
R:ACAACAAGCTGATCCACCTAAAGA | 35,136,894–35,137,379 | (Xcm I) | ||||
H9A11 | F:TGCTCTAACAAAATCACCAAAATC | Chr6 (Long arm) | 52 | SCAR | Ol-1,3 | Bai et al. [6] |
R:AAATGGTCAAACAAAGTCTATTGAG | 35,347,388–35,347,820 | |||||
M/SlMlo1 | F:ACCCTTAAGAAACTAGGGCAAA | Chr4 (Long arm) | 55 | SCAR | ol-2 | Bai et al. [10] |
R:ACCATCATGAACCCATGTCT | 38,702,897–38,703,092 | (Slmlo1) | ||||
dCAPS_ SlMlo1.1 | F:TATATAGAGAAATTCTGTAGATGTGATC | Chr4 (Long arm) | 50 | dCAPS | ol-2 | Kim et al. [55] |
R:TGGATAACCGCGTAATAAGT | 38,700,768–38,700,970 | (Bcl I) | (Slmlo1.1) | |||
GP79L | F:CACTCAATGGGGGAAGCAAC | Chr6 (Short arm) | 56 | CAPS | Ol-4,6 | Bai et al. [6] |
R:AATGGTAAACGAGCGGGACT | 2,746,498–2,747,964 | (Apo I) | ||||
32.5Cla | F:ACAGAAACAAAGTGCCAAG | Chr6 (Short arm) | 56 | CAPS | Ol-4,6 | Bai et al. [6] |
R:CCACCACCAAACAGGAGTGTG | 2,389,981–2,390,754 | (Hinf I) | ||||
TG25 | F:TAATTTGGCACTGCCGT | Chr6 (Long arm) | 52 | SCAR | Ol-5 | Bai et al. [6] |
R:TTGTYATRTTGTGYTTATCG | 33,814,128–33,814,425 | |||||
P21M47 | F:TAACAATCTCGACCATAGTTCC | Chr6 (Long arm) | T.D 3 | CAPS | Ol-5, | Faino et al. [8] |
R:CCATACCCGAATTTCCTTCC | 35,035,703–35,036,018 | (Hae III) | Ol-qtl1 | |||
dCT136 | F:CGAAGTGTCGGATCCGAAGGCTTT | Chr6 (Long arm) | T.D | dCAPS | Ol-qtl1 | Faino et al. [8] |
R:AACACAATCGGAAAAAA | 39,171,973–39,172,139 | (Xmn I) | ||||
Y258 | F:GTAATTCCAAAAAGTGAGGT | Chr12 (Long arm) | 50 | CAPS | Ol-qtl3 | Bai et al. [7] |
R:TTGCGTCTAGAGTTATTTT | 29,161,948–29,162,084 | (Mbo I) | ||||
TG111 | F:TGCCAACCCGGACAAAGA | Chr12 (Long arm) | 54 | SCAR | Ol-qtl3 | Bai et al. [7] |
R:TGGGGAAGTGATTAGACAGGACA | 47,133,362–47,133,758 |
Marker Name | Target SNP | Location 1 (Chr, bp) | Marker Type (Enzyme) | Sequence (5’-3’) | Expected Size SNP: (bp) |
---|---|---|---|---|---|
SNP1_ CAPS | AX-95781451 | Chr1: 815,871 | CAPS | F:TTACATTTAACTGTGACAAGCAGAT | G:172/54 |
(Hpy99 I) | R:AGTAGTTCATTTTCATTGCGAACT | A:226 | |||
SNP2_ dCAPS | AX-95767557 | Chr2:3,942,590 | dCAPS | F: ATTATGCCAACAACAAATCAGACAC | C:25/155 |
(Aci I) | R:ACAATAGAACAAGAAGCTGAAAGAA | G:187 | |||
SNP3_ CAPS | AX-95784118 | Chr4:6,054,103 | CAPS | F:CTTACCACATAAACATAGGGATCTG | G:155/72 |
(Hinf I) | R:GGACCCAAATAATCATCAAATCTAT | A:227 | |||
SNP4_ dCAPS | AX-95773152 | Chr6:34,738,782 | dCAPS | F:TGATCAATTAATTCCCGGAGATAG | G:174 |
(Rsa I) | R:AAAGGGCTCAATCTTTTATTTGTAT | A: 25/149 | |||
SNP5_ CAPS | AX-95809776 | Chr8:56,273,372 | CAPS | F:ATTTAGTTTTCATGTGTCGATGAAT | A:35/130 |
(Apo I) | R:TTCCTTTTAGCAATGTGATAGTTTT | T:165 | |||
SNP6_ CAPS | AX-95814666 | Chr11:49,774,551 | CAPS | F:CACTTTCATTAGATTCTTGTGGTCT | C:188/47 |
(Nde I) | R:CCACTAAGGTATCAATCAATTTTGT | T:235 |
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations. |
© 2022 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Park, J.; Lee, S.; Choi, Y.; Park, G.; Park, S.; Je, B.; Park, Y. Germplasm Screening Using DNA Markers and Genome-Wide Association Study for the Identification of Powdery Mildew Resistance Loci in Tomato. Int. J. Mol. Sci. 2022, 23, 13610. https://doi.org/10.3390/ijms232113610
Park J, Lee S, Choi Y, Park G, Park S, Je B, Park Y. Germplasm Screening Using DNA Markers and Genome-Wide Association Study for the Identification of Powdery Mildew Resistance Loci in Tomato. International Journal of Molecular Sciences. 2022; 23(21):13610. https://doi.org/10.3390/ijms232113610
Chicago/Turabian StylePark, Jiyeon, Siyoung Lee, Yunseo Choi, Girim Park, Seoyeon Park, Byoungil Je, and Younghoon Park. 2022. "Germplasm Screening Using DNA Markers and Genome-Wide Association Study for the Identification of Powdery Mildew Resistance Loci in Tomato" International Journal of Molecular Sciences 23, no. 21: 13610. https://doi.org/10.3390/ijms232113610